Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034353 Streptomyces sp. KPB2 chromosome, complete genome 12 crisprs csa3,DEDDh,DinG,WYL,cas3,c2c9_V-U4,Cas14u_CAS-V,Cas9_archaeal,cas4 3 8 3 0

Results visualization

1. CP034353
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_3 1552875-1552989 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_4 2941001-2941105 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_5 3146297-3146359 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_6 3726808-3726917 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_9 4365141-4365217 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_11 5259424-5259517 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_12 5333748-5333831 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_13 5333964-5334100 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_14 5362904-5363144 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_15 6142298-6142404 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_16 6413174-6413332 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034353_17 7535780-7536001 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 5935651-5935667 0 1.0
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 5935690-5935706 0 1.0
CP034353_17 17.1|7535827|44|CP034353|PILER-CR 7535827-7535870 44 CP034353.1 7536002-7536045 0 1.0
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 2268086-2268102 1 0.941
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 3693552-3693568 1 0.941
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 3726958-3726974 1 0.941
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 3748732-3748748 1 0.941
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 5043842-5043858 1 0.941
CP034353_5 5.1|3146320|17|CP034353|CRISPRCasFinder 3146320-3146336 17 CP034353.1 5843977-5843993 1 0.941
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 CP034353.1 2268501-2268529 2 0.931
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 CP034353.1 5936066-5936094 2 0.931

1. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 5935651-5935667, mismatch: 0, identity: 1.0 

ccccgcacccccaccga	CRISPR spacer
ccccgcacccccaccga	Protospacer
*****************

2. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 5935690-5935706, mismatch: 0, identity: 1.0 

ccccgcacccccaccga	CRISPR spacer
ccccgcacccccaccga	Protospacer
*****************

3. spacer 17.1|7535827|44|CP034353|PILER-CR matches to position: 7536002-7536045, mismatch: 0, identity: 1.0 

cgcgccggtgcccgcggcgctgtggcccgcccgtgtcggtgcgt	CRISPR spacer
cgcgccggtgcccgcggcgctgtggcccgcccgtgtcggtgcgt	Protospacer
********************************************

4. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 2268086-2268102, mismatch: 1, identity: 0.941 

ccccgcacccccaccga	CRISPR spacer
ccccgcaccaccaccga	Protospacer
********* *******

5. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 3693552-3693568, mismatch: 1, identity: 0.941 

ccccgcacccccaccga	CRISPR spacer
ccgcgcacccccaccga	Protospacer
** **************

6. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 3726958-3726974, mismatch: 1, identity: 0.941 

ccccgcacccccaccga	CRISPR spacer
ccgcgcacccccaccga	Protospacer
** **************

7. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 3748732-3748748, mismatch: 1, identity: 0.941 

ccccgcacccccaccga	CRISPR spacer
ccccgcaccaccaccga	Protospacer
********* *******

8. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 5043842-5043858, mismatch: 1, identity: 0.941 

ccccgcacccccaccga	CRISPR spacer
ccccgcaccaccaccga	Protospacer
********* *******

9. spacer 5.1|3146320|17|CP034353|CRISPRCasFinder matches to position: 5843977-5843993, mismatch: 1, identity: 0.941 

ccccgcacccccaccga	CRISPR spacer
ccccgcaccaccaccga	Protospacer
********* *******

10. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to position: 2268501-2268529, mismatch: 2, identity: 0.931 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
ccacacccacgccgggtgaccaggcaacc	Protospacer
********.****************.***

11. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to position: 5936066-5936094, mismatch: 2, identity: 0.931 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
ccacacccgcgccgggtgaccgggcaacc	Protospacer
*********************.***.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 301025-301049 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 315429-315453 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 307245-307269 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 294089-294113 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 307245-307269 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 299657-299681 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 299646-299670 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 307257-307281 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 307278-307302 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 307244-307268 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 301045-301069 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 301044-301068 3 0.88
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 301041-301065 3 0.88
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP033315 Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence 419281-419305 3 0.88
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP032342 Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence 278895-278919 3 0.88
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP033321 Azospirillum brasilense strain Cd plasmid p3, complete sequence 116124-116148 3 0.88
CP034353_14 14.3|5363043|23|CP034353|CRT 5363043-5363065 23 NZ_CP038636 Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence 940393-940415 3 0.87
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 DQ372923 Bacteriophage mu1/6, complete genome 20804-20831 4 0.857
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NC_007967 Streptomyces phage mu1/6, complete genome 20804-20831 4 0.857
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 MN310546 Microbacterium phage PhriedRice, complete genome 33693-33721 4 0.862
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 MT657337 Microbacterium phage Mazun, complete genome 33908-33936 4 0.862
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 MT310890 Microbacterium phage Phedro, complete genome 33589-33617 4 0.862
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 MT310889 Microbacterium phage Phractured, complete genome 33589-33617 4 0.862
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 MT310891 Microbacterium phage Pharky, complete genome 33589-33617 4 0.862
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP032326 Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence 215366-215390 4 0.84
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 205375-205399 4 0.84
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 223240-223264 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 703819-703843 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 390283-390307 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 392922-392946 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1236364-1236388 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP032349 Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence 496280-496304 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1156469-1156493 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1035819-1035843 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1101412-1101436 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1034916-1034940 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1059119-1059143 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1059108-1059132 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1035811-1035835 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1035167-1035191 4 0.84
CP034353_13 13.2|5334047|25|CP034353|CRISPRCasFinder 5334047-5334071 25 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1035802-1035826 4 0.84
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 220797-220825 4 0.862
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NZ_CP023977 Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.2, complete sequence 39180-39207 5 0.821
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP021449 Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence 162678-162702 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 82806-82830 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP049790 Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence 106177-106201 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 84125-84149 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP015116 Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence 242860-242884 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP016555 Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence 1812638-1812662 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052069 Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence 83808-83832 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP016915 Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence 700996-701020 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP016905 Ralstonia solanacearum strain KACC 10709 plasmid unnamed1 1122792-1122816 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP025986 Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence 315464-315488 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022769 Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence 85449-85473 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022773 Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence 87909-87933 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022783 Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence 82884-82908 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022795 Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence 82889-82913 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052071 Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP009763 Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence 83747-83771 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 82862-82886 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022779 Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence 85467-85491 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052075 Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052085 Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence 101411-101435 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052095 Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence 83824-83848 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052105 Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052077 Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence 85621-85645 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052087 Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence 101411-101435 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052097 Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence 83824-83848 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052115 Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052127 Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence 101411-101435 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052079 Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence 85621-85645 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052089 Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence 101411-101435 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052093 Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence 83824-83848 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052101 Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence 83824-83848 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052099 Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence 83824-83848 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052107 Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022781 Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence 85366-85390 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052117 Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052125 Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence 85621-85645 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022793 Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence 87910-87934 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022785 Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence 87903-87927 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022787 Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence 85344-85368 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022756 Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence 86250-86274 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052129 Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence 82646-82670 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052121 Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052123 Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence 85621-85645 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052131 Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence 101411-101435 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 CP011998 Ralstonia solanacearum strain YC45 plasmid, complete sequence 120105-120129 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052073 Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052081 Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence 85621-85645 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052083 Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence 85621-85645 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052109 Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052091 Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence 83824-83848 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052111 Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence 84199-84223 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052103 Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052119 Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence 98871-98895 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP052113 Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence 84199-84223 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP016613 Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence 546226-546250 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP049794 Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence 545478-545502 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP049788 Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence 1852569-1852593 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP049792 Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence 326954-326978 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP015851 Ralstonia solanacearum strain YC40-M plasmid, complete sequence 298997-299021 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022791 Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence 1925446-1925470 5 0.8
CP034353_13 13.1|5333993|25|CP034353|CRISPRCasFinder 5333993-5334017 25 NZ_CP022482 Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence 1000333-1000357 5 0.8
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022775 Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence 1291328-1291356 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NC_014310 Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence 1345856-1345884 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022762 Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence 1216294-1216322 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP033508 Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence 140510-140538 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP033369 Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence 140510-140538 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP023017 Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence 1275995-1276023 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP014703 Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence 1215391-1215419 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022760 Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence 1248320-1248348 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022789 Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence 1248311-1248339 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022771 Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence 1216286-1216314 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022777 Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence 1215641-1215669 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022799 Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence 1216277-1216305 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022764 Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence 1291462-1291490 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP016080 Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence 369033-369061 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022797 Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence 1291445-1291473 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP022758 Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence 1291434-1291462 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP043960 Streptomyces tendae strain 139 plasmid unnamed1, complete sequence 171202-171230 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 MN428050 Mycobacterium phage Apex, complete genome 24338-24366 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 KX589269 Mycobacterium phage Fortunato, complete genome 24154-24182 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NC_008195 Mycobacterium phage Cooper, complete genome 23345-23373 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NC_042034 Mycobacterium phage ChrisnMich, complete sequence 23117-23145 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 KF493881 Mycobacterium phage JAMaL, complete genome 24336-24364 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 MT310870 Mycobacterium phage RawrgerThat, complete genome 24157-24185 5 0.828
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NC_008381 Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence 69128-69156 5 0.828
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NC_020548 Azoarcus sp. KH32C plasmid pAZKH, complete sequence 289790-289817 6 0.786
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NZ_CP031082 Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence 101309-101336 6 0.786
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 MK686072 Streptomyces phage RosaAsantewaa, complete genome 8713-8740 6 0.786
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NZ_CP029832 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence 310808-310835 6 0.786
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NZ_CP054622 Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence 282333-282360 6 0.786
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NZ_CP044080 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence 219289-219316 6 0.786
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NZ_CP039651 Azospirillum sp. TSA2s plasmid p1 325076-325103 6 0.786
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 146435-146465 6 0.806
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 163614-163642 6 0.793
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP013635 Rhizobium sp. N324 plasmid pRspN324e, complete sequence 465954-465982 6 0.793
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 MH744423 Mycobacterium phage Saguaro, complete genome 26128-26156 6 0.793
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 4294794-4294822 6 0.793
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 KF279411 Mycobacterium phage Adawi, complete genome 22840-22868 6 0.793
CP034353_2 2.2|1514653|28|CP034353|PILER-CR 1514653-1514680 28 NC_025133 Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence 5756-5783 7 0.75
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 850692-850722 7 0.774
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NC_013855 Azospirillum sp. B510 plasmid pAB510a, complete sequence 690258-690286 7 0.759
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 MH744420 Streptomyces phage Kromp, complete genome 52515-52543 7 0.759
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 CP054921 Streptomyces sp. NA03103 plasmid unnamed1, complete sequence 10756-10784 7 0.759
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP043441 Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence 508383-508411 7 0.759
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NC_015383 Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence 171119-171147 7 0.759
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP012265 Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence 136288-136316 7 0.759
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NC_016585 Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence 475755-475785 8 0.742
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP018231 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3 189277-189307 8 0.742
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 810113-810143 8 0.742
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP016289 Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence 305245-305275 8 0.742
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP032676 Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence 207624-207654 8 0.742
CP034353_9 9.1|4365165|29|CP034353|CRISPRCasFinder 4365165-4365193 29 NC_017957 Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence 107842-107870 8 0.724
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP027859 Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence 845656-845684 8 0.724
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP032054 Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence 447425-447453 8 0.724
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 NZ_CP016560 Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence 104681-104709 8 0.724
CP034353_14 14.1|5362929|29|CP034353|CRT 5362929-5362957 29 CP000662 Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence 99292-99320 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NC_019848 Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence 346671-346699 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NC_017327 Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence 491756-491784 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021798 Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence 1006887-1006915 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP009145 Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence 516394-516422 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021801 Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence 438461-438489 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021830 Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence 1451917-1451945 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021824 Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence 394382-394410 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021794 Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence 928669-928697 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021217 Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence 76673-76701 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NC_003037 Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence 1075799-1075827 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NC_017324 Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence 51265-51293 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021827 Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence 1136463-1136491 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP021805 Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence 1420058-1420086 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP026526 Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence 1376841-1376869 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP019483 Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence 929721-929749 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NZ_CP019486 Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence 887105-887133 8 0.724
CP034353_14 14.4|5363091|29|CP034353|CRT 5363091-5363119 29 NC_020527 Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence 1074138-1074166 8 0.724
CP034353_7 7.1|4030628|31|CP034353|CRISPRCasFinder 4030628-4030658 31 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 1261071-1261101 10 0.677

1. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

2. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

3. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

4. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

5. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

6. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

7. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

8. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

9. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

10. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

11. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

12. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

13. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.88 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gctgcgcgggccagccgggtcggcc	Protospacer
* **  *******************

14. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.88 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattgacg	Protospacer
  .**********************

15. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.88 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattgacg	Protospacer
  .**********************

16. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 3, identity: 0.88 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattgacg	Protospacer
  .**********************

17. spacer 14.3|5363043|23|CP034353|CRT matches to NZ_CP038636 (Cupriavidus oxalaticus strain X32 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.87 

ggttgccgctcccgtgccggcca	CRISPR spacer
ggtcgccgctcccgtgccggcgt	Protospacer
***.*****************

18. spacer 2.2|1514653|28|CP034353|PILER-CR matches to DQ372923 (Bacteriophage mu1/6, complete genome) position: , mismatch: 4, identity: 0.857 

agtca--ggcaacgtcaccgagcgcaccga	CRISPR spacer
--tcatcggctacgtcatcgagcgcaccga	Protospacer
  ***  *** ******.************

19. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NC_007967 (Streptomyces phage mu1/6, complete genome) position: , mismatch: 4, identity: 0.857 

agtca--ggcaacgtcaccgagcgcaccga	CRISPR spacer
--tcatcggctacgtcatcgagcgcaccga	Protospacer
  ***  *** ******.************

20. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to MN310546 (Microbacterium phage PhriedRice, complete genome) position: , mismatch: 4, identity: 0.862 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
atacacccgcgccgggggaccaggcaacc	Protospacer
 .************** ********.***

21. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to MT657337 (Microbacterium phage Mazun, complete genome) position: , mismatch: 4, identity: 0.862 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
atacacccgcgccgggggaccaggcaacc	Protospacer
 .************** ********.***

22. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to MT310890 (Microbacterium phage Phedro, complete genome) position: , mismatch: 4, identity: 0.862 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
atacacccgcgccgggggaccaggcaacc	Protospacer
 .************** ********.***

23. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to MT310889 (Microbacterium phage Phractured, complete genome) position: , mismatch: 4, identity: 0.862 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
atacacccgcgccgggggaccaggcaacc	Protospacer
 .************** ********.***

24. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to MT310891 (Microbacterium phage Pharky, complete genome) position: , mismatch: 4, identity: 0.862 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
atacacccgcgccgggggaccaggcaacc	Protospacer
 .************** ********.***

25. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP032326 (Azospirillum brasilense strain MTCC4035 plasmid p5, complete sequence) position: , mismatch: 4, identity: 0.84 

gatgaccgggccagccgggtcggcc	CRISPR spacer
agcgcccgggccagccgggtcggcc	Protospacer
...* ********************

26. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

gatgaccgggccagccgggtcggcc	CRISPR spacer
cgcgaccgggccagccggggcggcc	Protospacer
 ..**************** *****

27. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 4, identity: 0.84 

gatgaccgggccagccgggtcggcc	CRISPR spacer
gatgaccgggccagccttgtcggaa	Protospacer
****************  *****

28. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattggcg	Protospacer
  .*******************.**

29. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattggcg	Protospacer
  .*******************.**

30. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattggcg	Protospacer
  .*******************.**

31. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggattggcg	Protospacer
  .*******************.**

32. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
tgcggcgggaccagccggtttgacg	Protospacer
  .*************** ******

33. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

34. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

35. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

36. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

37. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

38. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

39. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

40. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

41. spacer 13.2|5334047|25|CP034353|CRISPRCasFinder matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.84 

attggcgggaccagccggattgacg	CRISPR spacer
ggtggccggaccagccggattgtcg	Protospacer
. **** *************** **

42. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.862 

ggcgccggccaccgctcccgt---gccggcca	CRISPR spacer
ggcgccggtcaccgctcccgtcgagccgg---	Protospacer
********.************   *****

43. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NZ_CP023977 (Streptomyces alboflavus strain MDJK44 plasmid pMDJK44.2, complete sequence) position: , mismatch: 5, identity: 0.821 

agtca--ggcaacgtcaccgagcgcaccga	CRISPR spacer
--ccaacggcaacgtcaccgaggtcaccga	Protospacer
  .**  ***************  ******

44. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

45. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

46. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

47. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

48. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

49. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

50. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

51. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

52. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

53. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

54. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

55. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

56. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

57. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

58. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

59. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

60. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

61. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

62. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

63. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

64. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

65. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

66. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

67. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

68. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

69. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

70. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

71. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

72. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

73. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

74. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

75. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

76. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

77. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

78. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

79. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

80. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

81. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

82. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

83. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

84. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

85. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

86. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

87. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

88. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

89. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

90. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

91. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

92. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

93. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

94. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

95. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

96. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

97. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

98. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

99. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

100. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

101. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

102. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

103. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

104. spacer 13.1|5333993|25|CP034353|CRISPRCasFinder matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 5, identity: 0.8 

gatgaccgggccagccgggtcggcc	CRISPR spacer
aggaaccgcgccagccgggtcggcc	Protospacer
.. .**** ****************

105. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

106. spacer 14.1|5362929|29|CP034353|CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcgt	Protospacer
  *** ***** ****************

107. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

108. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP033508 (Mesorhizobium jarvisii strain ATCC 700743 plasmid pMJ700743a, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gtcgccggccacagcacccgtgccggtga	Protospacer
* ********** ** **********. *

109. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP033369 (Mesorhizobium loti strain SU343 plasmid pMLSU343a, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gtcgccggccacagcacccgtgccggtga	Protospacer
* ********** ** **********. *

110. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

111. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

112. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcgt	Protospacer
  *** ***** ****************

113. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcgt	Protospacer
  *** ***** ****************

114. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

115. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

116. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

117. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

118. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gtcgccggccacagcacccgtgccggtga	Protospacer
* ********** ** **********. *

119. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

120. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgc-cggccaccgctcccgtgccggcca	CRISPR spacer
-ccgcgcggcctccgctcccgtgccggcat	Protospacer
  *** ***** ****************

121. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.828 

-ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
cagtg-cggccacggctcccctgccggcca	Protospacer
 .*.* ******* ****** *********

122. spacer 14.1|5362929|29|CP034353|CRT matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgcccg	Protospacer
**  ************ ******** **.

123. spacer 14.1|5362929|29|CP034353|CRT matches to KX589269 (Mycobacterium phage Fortunato, complete genome) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgcccg	Protospacer
**  ************ ******** **.

124. spacer 14.1|5362929|29|CP034353|CRT matches to NC_008195 (Mycobacterium phage Cooper, complete genome) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgcccg	Protospacer
**  ************ ******** **.

125. spacer 14.1|5362929|29|CP034353|CRT matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgcccg	Protospacer
**  ************ ******** **.

126. spacer 14.1|5362929|29|CP034353|CRT matches to KF493881 (Mycobacterium phage JAMaL, complete genome) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgcccg	Protospacer
**  ************ ******** **.

127. spacer 14.1|5362929|29|CP034353|CRT matches to MT310870 (Mycobacterium phage RawrgerThat, complete genome) position: , mismatch: 5, identity: 0.828 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgcccg	Protospacer
**  ************ ******** **.

128. spacer 14.1|5362929|29|CP034353|CRT matches to NC_008381 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL10, complete sequence) position: , mismatch: 5, identity: 0.828 

-ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ctgcgac-gccaccgctccggtgccggccc	Protospacer
  *** * *********** *********

129. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NC_020548 (Azoarcus sp. KH32C plasmid pAZKH, complete sequence) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
gcgtcggcaacgtcaccgagctcaccga	Protospacer
.  . **************** ******

130. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NZ_CP031082 (Paracoccus yeei strain CCUG 32053 plasmid pYEE4, complete sequence) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
gctggggcaacggcaccgagcgcgccga	Protospacer
. * .******* **********.****

131. spacer 2.2|1514653|28|CP034353|PILER-CR matches to MK686072 (Streptomyces phage RosaAsantewaa, complete genome) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
tggtcggcaacgacaccgagggcaccga	Protospacer
 * . ******* ******* *******

132. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
atgcctgcaacgtcaccgaccgcaccgc	Protospacer
*  *  ************* *******

133. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NZ_CP054622 (Azospirillum oryzae strain KACC 14407 plasmid unnamed7, complete sequence) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
cagcaggcatcgtcaccgagcacaccaa	Protospacer
 . ****** ***********.****.*

134. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NZ_CP044080 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
gctggggcaacggcaccgagcgcgccga	Protospacer
. * .******* **********.****

135. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NZ_CP039651 (Azospirillum sp. TSA2s plasmid p1) position: , mismatch: 6, identity: 0.786 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
cagcaggcatcgtcaccgagcacaccaa	Protospacer
 . ****** ***********.****.*

136. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 6, identity: 0.806 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
catgtccgccaccctgccggaggccatcggc	Protospacer
* .* ******************* *.** *

137. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 6, identity: 0.793 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
tcgcacccgcgccgggggtccaggcgccg	Protospacer
.*.************* * ******* *

138. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 6, identity: 0.793 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
aatgccggccgccgcacccgtgccggcaa	Protospacer
...*******.**** *********** *

139. spacer 14.1|5362929|29|CP034353|CRT matches to MH744423 (Mycobacterium phage Saguaro, complete genome) position: , mismatch: 6, identity: 0.793 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gccgccgcccaccgctgccgtgccggtgg	Protospacer
* ***** ******** *********. .

140. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.793 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gtagccggccaccgcgcccttgccggtga	Protospacer
*  ************ *** ******. *

141. spacer 14.1|5362929|29|CP034353|CRT matches to KF279411 (Mycobacterium phage Adawi, complete genome) position: , mismatch: 6, identity: 0.793 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggatccggccaccgctgccgtgccgccag	Protospacer
**  ************ ******** * .

142. spacer 2.2|1514653|28|CP034353|PILER-CR matches to NC_025133 (Sphingobium wenxiniae strain JZ-1 plasmid pPBA, complete sequence) position: , mismatch: 7, identity: 0.75 

agtcaggcaacgtcaccgagcgcaccga	CRISPR spacer
taccaggcaacgtcaccaagcgcagcag	Protospacer
 ..**************.****** *..

143. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774 

cccgaccg--ccaccctgccggaggcaaccgcc	CRISPR spacer
--cagtcgctccaccgtgccggaggcaacggcc	Protospacer
  *...**  ***** ************* ***

144. spacer 14.1|5362929|29|CP034353|CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 7, identity: 0.759 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
ggggccggccaccgctcccgtccccctgc	Protospacer
** ****************** **  .

145. spacer 14.1|5362929|29|CP034353|CRT matches to MH744420 (Streptomyces phage Kromp, complete genome) position: , mismatch: 7, identity: 0.759 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
catcccgcccaccgctcccgtcccggccg	Protospacer
 .. *** ************* ******.

146. spacer 14.1|5362929|29|CP034353|CRT matches to CP054921 (Streptomyces sp. NA03103 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
accaccggcccccgctcccgtgcccgctg	Protospacer
. *.****** ************* **..

147. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
cgcgccggcagccgctcccgtgcccgtgg	Protospacer
 ******** .************* *. .

148. spacer 14.1|5362929|29|CP034353|CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 7, identity: 0.759 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
tccgaccgccaccgctcccgtgccgctga	Protospacer
  ** * ****************** . *

149. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 7, identity: 0.759 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gcgcccggcccccgctgccgtgccggcat	Protospacer
*   ****** ***** **********

150. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.742 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
gccggccgccaccctgccggcggcggcggtg	Protospacer
 ***.*************** ***..* *.

151. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP018231 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed3) position: , mismatch: 8, identity: 0.742 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
gcgggtgaccaccgtgccggcggcaaccgcc	Protospacer
 * *.. .***** ****** **********

152. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
gccggccgccaccctgccggcggcggcggtg	Protospacer
 ***.*************** ***..* *.

153. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.742 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
gcgggtgaccaccgtgccggcggcaaccgcc	Protospacer
 * *.. .***** ****** **********

154. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 8, identity: 0.742 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
cccgacggccaccatgccggagggcgcgacg	Protospacer
****** ****** *********  .* .*

155. spacer 9.1|4365165|29|CP034353|CRISPRCasFinder matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.724 

ccacacccgcgccgggtgaccaggcgacc	CRISPR spacer
cggtcggtgcgccgggtgaccaggcggcc	Protospacer
* ..   .******************.**

156. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.724 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gataccggtcaccgctcccgtgccgcggg	Protospacer
*...****.****************   .

157. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP032054 (Streptomyces clavuligerus strain F1D-5 plasmid pSCL1, complete sequence) position: , mismatch: 8, identity: 0.724 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gataccggtcaccgctcccgtgccgcggg	Protospacer
*...****.****************   .

158. spacer 14.1|5362929|29|CP034353|CRT matches to NZ_CP016560 (Streptomyces clavuligerus strain F613-1 plasmid pSCL4, complete sequence) position: , mismatch: 8, identity: 0.724 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
gataccggtcaccgctcccgtgccgcggg	Protospacer
*...****.****************   .

159. spacer 14.1|5362929|29|CP034353|CRT matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.724 

ggcgccggccaccgctcccgtgccggcca	CRISPR spacer
atcgccggccaccgcacccgcgccgatgt	Protospacer
. ************* ****.****..

160. spacer 14.4|5363091|29|CP034353|CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

161. spacer 14.4|5363091|29|CP034353|CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

162. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

163. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

164. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

165. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

166. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

167. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

168. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

169. spacer 14.4|5363091|29|CP034353|CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

170. spacer 14.4|5363091|29|CP034353|CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

171. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

172. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

173. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

174. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

175. spacer 14.4|5363091|29|CP034353|CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

176. spacer 14.4|5363091|29|CP034353|CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.724 

tgcaccggttctcactcccgcgccggcaa	CRISPR spacer
gacaccggttgtcactccggcgccgtttg	Protospacer
 .******** ******* ****** . .

177. spacer 7.1|4030628|31|CP034353|CRISPRCasFinder matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.677 

cccgaccgccaccctgccggaggcaaccgcc	CRISPR spacer
cctgaccgccaccccgccggagggggtgaat	Protospacer
**.***********.******** ... . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1793846 : 1803864 6 Bacillus_phage(33.33%) NA NA
DBSCAN-SWA_2 3431087 : 3445178 11 Streptomyces_phage(77.78%) tail NA
DBSCAN-SWA_3 4482818 : 4506677 19 Catovirus(25.0%) tail,plate,tRNA NA

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage