1. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 3, identity: 0.889
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagcta Protospacer
******.*************** ***.
2. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 3, identity: 0.889
acacttctgggcgacatgcat--ttgctg CRISPR spacer
acacttccgggcgacatgcattattgc-- Protospacer
*******.************* ****
3. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 3, identity: 0.889
acacttctgggcgacatgcat--ttgctg CRISPR spacer
acacttccgggcgacatgcattattgc-- Protospacer
*******.************* ****
4. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 3, identity: 0.885
cacacttctgggcgacaggcatttgt CRISPR spacer
caaacttccgggcgacaggcatttgg Protospacer
** *****.****************
5. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 3, identity: 0.885
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacaggcattaga Protospacer
*******.*************** *
6. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagcat Protospacer
******.*************** **
7. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagtcg Protospacer
******.*************** *..*
8. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattagagg Protospacer
*******.************** * *
9. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagttc Protospacer
******.*************** *.*
10. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattagagg Protospacer
*******.************** * *
11. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattaaccg Protospacer
******.*************** .*.*
12. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg- CRISPR spacer
acacttttgggcgacatgca-ttacggc Protospacer
******.************* **.* *
13. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattaggcg Protospacer
*******.************** * .*
14. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattaagtg Protospacer
******.*************** . **
15. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattaaccg Protospacer
******.*************** .*.*
16. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagtgg Protospacer
******.*************** *. *
17. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattagagg Protospacer
*******.************** * *
18. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattagtcg Protospacer
*******.************** *..*
19. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattaagtg Protospacer
******.*************** . **
20. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852
acacttctgggcgacatgcatttgctg CRISPR spacer
cctcttctgggccacctgcatttgctg Protospacer
* ********* ** ***********
21. spacer 3.1|2530582|25|CP034446|CRISPRCasFinder matches to HM596271 (Leuconostoc phage phiMH1, partial genome) position: , mismatch: 4, identity: 0.84
ctacgtctatcatcaccggcaccac CRISPR spacer
aaacgtctatcatcacaggcagcac Protospacer
************** **** ***
22. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattggg Protospacer
*******.********* ***** *
23. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
24. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattagc Protospacer
*******.********* ***** *.
25. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
26. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattagc Protospacer
*******.********* ***** *.
27. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattatt Protospacer
********.******** ***** *
28. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattaga Protospacer
********.******** ***** *
29. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
30. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattagg Protospacer
*******.********* ***** *
31. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
32. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
33. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattggg Protospacer
*******.********* ***** *
34. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattggg Protospacer
*******.********* ***** *
35. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattagg Protospacer
********.******** ***** *
36. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
37. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattaga Protospacer
********.******** ***** *
38. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattagg Protospacer
********.******** ***** *
39. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattatt Protospacer
********.******** ***** *
40. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaga Protospacer
*******.********* ***** *
41. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattaga Protospacer
********.******** ***** *
42. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 4, identity: 0.846
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattaga Protospacer
********.******** ***** *
43. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagagc Protospacer
******.*************** *
44. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagaac Protospacer
******.*************** *
45. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcagagg Protospacer
*******.*************. * *
46. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattgagcg Protospacer
*******.************** . .*
47. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013553 (Rhizobium phaseoli strain N931 plasmid pRphaN931a, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattggtcc Protospacer
*******.************** *..
48. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattaagcg Protospacer
*******.************** . .*
49. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcagagg Protospacer
*******.*************. * *
50. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagaac Protospacer
******.*************** *
51. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013586 (Rhizobium phaseoli strain N161 plasmid pRphaN161a, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattggtcc Protospacer
*******.************** *..
52. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattagaga Protospacer
*******.************** * .
53. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattggtat Protospacer
*******.************** *.
54. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagaga Protospacer
******.*************** * .
55. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013538 (Rhizobium phaseoli strain R630 plasmid pRphaR630a, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattagtcc Protospacer
*******.************** *..
56. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013564 (Rhizobium phaseoli strain N831 plasmid pRphaN831a, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattggtcc Protospacer
*******.************** *..
57. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattaggct Protospacer
******.*************** * .
58. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagtac Protospacer
******.*************** *.
59. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattgggga Protospacer
******.*************** * .
60. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcagagg Protospacer
*******.*************. * *
61. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattagagc Protospacer
******.*************** *
62. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattgggga Protospacer
******.*************** * .
63. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattgggga Protospacer
******.*************** * .
64. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcattaggca Protospacer
*******.************** * ..
65. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcagagg Protospacer
*******.*************. * *
66. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcatggggag Protospacer
******.************** * *
67. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 5, identity: 0.815
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcagagg Protospacer
*******.*************. * *
68. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 5, identity: 0.821
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgtttttacgcaattccggacgggaaac Protospacer
* *..* .********************
69. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 5, identity: 0.821
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgtttttacgcaattccggacgggaaac Protospacer
* *..* .********************
70. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 5, identity: 0.821
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgttttgccgcaactccggacgggaaac Protospacer
* *..** *****.**************
71. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 5, identity: 0.821
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgttttgacgcaattccggacggaaaac Protospacer
* *..**.***************.****
72. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 5, identity: 0.821
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgttttgccgcaattccggacggaaaac Protospacer
* *..** ***************.****
73. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaag Protospacer
*******.********* ***** .
74. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattacg Protospacer
*******.********* *****
75. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaag Protospacer
*******.********* ***** .
76. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaac Protospacer
*******.********* ***** ..
77. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaag Protospacer
*******.********* ***** .
78. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttctgggcgacatgcactaag Protospacer
***************** ***.* .
79. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttttgggcgacatgcattaac Protospacer
*******.********* ***** ..
80. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattgag Protospacer
********.******** ***** .
81. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP020951 (Rhizobium sp. CIAT894 plasmid pRheCIAT894d, complete sequence) position: , mismatch: 5, identity: 0.808
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttccgggcgacatgcattaag Protospacer
********.******** ***** .
82. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
gcacttccgggcgacatgcattgggca Protospacer
.******.************** * ..
83. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttttgggcgacatgcattaagca Protospacer
******.*************** . ..
84. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttctgggcgacatgcactaagcc Protospacer
********************.* . .
85. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
ccacttccgggcgacatgcattaagcg Protospacer
******.************** . .*
86. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttctgggcgacatgcaccaaatc Protospacer
********************.. . *
87. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
gcacttttgggcgacgtgcatttggcc Protospacer
.*****.********.******** .
88. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttctgggcgacatgcaccaaatc Protospacer
********************.. . *
89. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcaggac Protospacer
*******.*************. *
90. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcggagc Protospacer
*******.*************. *
91. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
gcacttttgggcgacatgcattaacca Protospacer
.*****.*************** .*..
92. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
gcacttttgggcgacatgcattaacca Protospacer
.*****.*************** .*..
93. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
gcacttttgggcgacatgcattaacca Protospacer
.*****.*************** .*..
94. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcggagc Protospacer
*******.*************. *
95. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcggagc Protospacer
*******.*************. *
96. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcggagc Protospacer
*******.*************. *
97. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcaggca Protospacer
*******.*************. * ..
98. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
gcacttttgggcgacatgcattaacca Protospacer
.*****.*************** .*..
99. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcaggca Protospacer
*******.*************. * ..
100. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
ccacttttgggcgacatgcattagagc Protospacer
*****.*************** *
101. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 6, identity: 0.778
acacttctgggcgacatgcatttgctg CRISPR spacer
ccacttccgggcgacatgcattaagcg Protospacer
******.************** . .*
102. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
103. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
104. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
105. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
106. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
107. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
108. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
109. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
110. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
111. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatgacgcaattccggacgggaacc Protospacer
* **.****************** *
112. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatgacgcaattccggacgggaacc Protospacer
* **.****************** *
113. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
114. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
115. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
116. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
117. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
118. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
119. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
120. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
121. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
122. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgtttctgcgcaattccggacggaaaac Protospacer
* *... ****************.****
123. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
124. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.786
tttcctggcgcaattccggacgggaaac CRISPR spacer
tgaaatggcgcacttccggacggaaaac Protospacer
* ******* **********.****
125. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP024310 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3c, complete sequence) position: , mismatch: 6, identity: 0.769
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttctgggcgacatgcaccaaa Protospacer
***************** ***.. .
126. spacer 10.1|6220835|26|CP034446|CRISPRCasFinder matches to NZ_CP023064 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631b, complete sequence) position: , mismatch: 6, identity: 0.769
cacacttctgggcgacaggcatttgt CRISPR spacer
cacacttctgggcgacatgcaccaaa Protospacer
***************** ***.. .
127. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.741
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcaatgc Protospacer
*******.*************. ..
128. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 7, identity: 0.741
acacttctgggcgacatgcatttgctg CRISPR spacer
tcacttccgggcgacatgcattaatgc Protospacer
******.************** ..
129. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.741
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcaatgc Protospacer
*******.*************. ..
130. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.741
acacttctgggcgacatgcatttgctg CRISPR spacer
acacttccgggcgacatgcatcaatgc Protospacer
*******.*************. ..
131. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to NZ_CP021126 (Rhizobium sp. Kim5 plasmid pRetKim5b, complete sequence) position: , mismatch: 7, identity: 0.741
acacttctgggcgacatgcatttgctg CRISPR spacer
tcacttccgggcgacatgcattaatgc Protospacer
******.************** ..
132. spacer 1.1|1451033|27|CP034446|CRISPRCasFinder matches to CP007642 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803a, complete sequence) position: , mismatch: 7, identity: 0.741
acacttctgggcgacatgcatttgctg CRISPR spacer
tcacttccgggcgacatgcattaatgc Protospacer
******.************** ..
133. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 7, identity: 0.75
tttcctggcgcaattccggacgggaaac CRISPR spacer
agagttgacgcaattccggacggaaaac Protospacer
.**.***************.****
134. spacer 8.1|4204232|28|CP034446|CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 7, identity: 0.75
tttcctggcgcaattccggacgggaaac CRISPR spacer
agagttgacgcaattccggacggaaaac Protospacer
.**.***************.****
135. spacer 9.1|4581056|36|CP034446|CRISPRCasFinder matches to NC_008712 (Paenarthrobacter aurescens TC1 plasmid pTC1, complete sequence) position: , mismatch: 7, identity: 0.806
gcttcggcg-acgcgccggccaagccggcggcaccgg CRISPR spacer
-cgccgacgaacgcgccggccatgccggcggcgccga Protospacer
* .**.** ************ *********.***.
136. spacer 9.1|4581056|36|CP034446|CRISPRCasFinder matches to NZ_CP027299 (Streptomyces sp. SGAir0924 plasmid unnamed_5) position: , mismatch: 9, identity: 0.75
gcttcggcgacgcgccggccaagccggcggcaccgg CRISPR spacer
gcagcacgcccgcgccggccaggccggcggcagcgg Protospacer
** *. ***********.********** ***
137. spacer 9.1|4581056|36|CP034446|CRISPRCasFinder matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 11, identity: 0.694
gcttcggcgacgcgccggccaagccggcggcaccgg CRISPR spacer
gtcggtgcgacgcgccggccatgcctgcggcaggct Protospacer
*.. *************** *** ******
