1. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 1, identity: 0.968
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacggaaaaccgctgc Protospacer
***.***************************
2. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 1, identity: 0.968
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacggaaaaccgctgc Protospacer
***.***************************
3. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttctcgcaattccggacggaaaaccgctgc Protospacer
.**.***************************
4. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttgctcgcaattccggacggaaaaccgctgc Protospacer
** .***************************
5. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggacggaaaaccgctgc Protospacer
* *.***************************
6. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttctcgcaattccggacggaaaaccgctgc Protospacer
.**.***************************
7. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttgctcgcaattccggacggaaaaccgctgc Protospacer
** .***************************
8. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggacggaaaaccgctgc Protospacer
* *.***************************
9. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050094 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b4, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
10. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
11. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
12. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctgc Protospacer
**** ************** ***********
13. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
14. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
15. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
16. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
17. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
18. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
19. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
20. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
21. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_008379 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL9, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
22. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
23. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
24. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
25. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021029 (Rhizobium sp. TAL182 plasmid pRetTAL182e, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
26. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP018230 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed2, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
27. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP018233 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed5, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
28. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
29. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
30. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
31. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
32. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013600 (Rhizobium sp. N741 plasmid pRspN741e, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
33. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
34. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013504 (Rhizobium esperanzae strain N561 plasmid pRspN561d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
35. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
36. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
37. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
38. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
39. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013510 (Rhizobium sp. N1341 plasmid pRspN1341e, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
40. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013521 (Rhizobium sp. N113 plasmid pRspN113d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
41. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013494 (Rhizobium sp. N6212 plasmid pRspN6212d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
42. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
43. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttttcgcaatcccggacggaaaaccgcttc Protospacer
***********.***************** *
44. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
45. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054029 (Rhizobium sp. JKLM19E plasmid pPR19E02, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
46. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013594 (Rhizobium sp. N871 plasmid pRspN871d, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
47. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
48. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttttcgcaatttcggacggaaaaccgctac Protospacer
************.****************.*
49. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
50. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
51. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
52. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
53. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
54. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
55. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
56. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
57. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
58. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttctgcgcaattccggacggaaaaccgctgc Protospacer
**.* **************************
59. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
60. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgcaattccggacggaaaaccgctac Protospacer
****.************************.*
61. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
62. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
63. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttc Protospacer
**** ************************ *
64. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 2, identity: 0.935
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctgc Protospacer
**** ************** ***********
65. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
actctcgcaattccggacggaaaaccgctgc Protospacer
.*.***************************
66. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctcgcaattccggacggaaaaccgctcc Protospacer
**..************************* *
67. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctagcaattccggacggaaaaccgctgc Protospacer
**..* *************************
68. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tatctagcaattccggacggaaaaccgctgc Protospacer
* *.* *************************
69. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctagcaattccggacggaaaaccgctgc Protospacer
**..* *************************
70. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
actctcgcaattccggacggaaaaccgctgc Protospacer
.*.***************************
71. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctcgcaattccggacggaaaaccgctcc Protospacer
**..************************* *
72. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctagcaattccggacggaaaaccgctgc Protospacer
**..* *************************
73. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tatctagcaattccggacggaaaaccgctgc Protospacer
* *.* *************************
74. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctagcaattccggacggaaaaccgctgc Protospacer
**..* *************************
75. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc- CRISPR spacer
ttttacgcaattccggac-gaaaaccgcttcg Protospacer
**** ************* ********** *
76. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttttagtaattccggacggaaaaccgcttc Protospacer
***** *.********************* *
77. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050101 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b6, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccgaacggaaaaccgcttc Protospacer
**** **********.************* *
78. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
79. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
80. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcagttccggacggaaaaccgcttc Protospacer
**** ****.******************* *
81. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttttagtaattccggacggaaaaccgcttc Protospacer
***** *.********************* *
82. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccgaacggaaaaccgcttc Protospacer
**** **********.************* *
83. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacgcaaaaccgctac Protospacer
***.*************** *********.*
84. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
85. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
86. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttgcgtaattccggacggaaaaccgctac Protospacer
**** **.*********************.*
87. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacgcaaaaccgctac Protospacer
***.*************** *********.*
88. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcttt Protospacer
**** ************************ .
89. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 3, identity: 0.903
-tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttttacgc-attccggacgcaaaaccgctgc Protospacer
**** *** ********** ***********
90. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaactgcttc Protospacer
**** ********************.*** *
91. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
92. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacgcaaaaccgctac Protospacer
***.*************** *********.*
93. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
94. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcccgcaattccggacggaaaaccgctac Protospacer
***..************************.*
95. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
96. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgtaattccggacggaaaaccgctac Protospacer
****.**.*********************.*
97. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
98. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
99. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
100. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgtaattccggacggaaaaccgctac Protospacer
****.**.*********************.*
101. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
102. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaacccgcttc Protospacer
**** ****************** ***** *
103. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
104. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttctcggcaattccggacggaaaaccgctgc Protospacer
**.*. *************************
105. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
106. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaaccgctgc Protospacer
.***** ***********************
107. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
108. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacgcaaaaccgctac Protospacer
***.*************** *********.*
109. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttttcgcaattccggacacaaaaccgctgc Protospacer
.*****************. ***********
110. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttttcgcaattccggacacaaaaccgctgc Protospacer
.*****************. ***********
111. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttttcgcaattccggacacaaaaccgctgc Protospacer
.*****************. ***********
112. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 3, identity: 0.903
-tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
attttacgc-attccggacgcaaaaccgctgc Protospacer
**** *** ********** ***********
113. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
114. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050083 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b3, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaacccgcttc Protospacer
**** ****************** ***** *
115. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
116. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgtaattccggacggaaaaccgctac Protospacer
****.**.*********************.*
117. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.903
-tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
attttacgc-attccggacgcaaaaccgctgc Protospacer
**** *** ********** ***********
118. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
119. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP049733 (Rhizobium leguminosarum strain A1 plasmid pRL10, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttaagcaattccggacggaaaaccgcttc Protospacer
**** *********************** *
120. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttccgtaattccggacggaaaaccgctac Protospacer
****.**.*********************.*
121. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgcttc Protospacer
**** ************** ********* *
122. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcatttccggacggaaaaccgcttc Protospacer
**** **** ******************* *
123. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
124. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
125. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacgg-aaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaaccgctt- Protospacer
**** *************** *********
126. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_011371 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG204, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttaacgcaattccggacggaaaaccgcttc Protospacer
*** ************************ *
127. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttaacgcaattccggacggaaaaccgcttc Protospacer
*** ************************ *
128. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttgcgtaattccggacggaaaaccgctac Protospacer
**** **.*********************.*
129. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctctcgcaattccggacggaaaaccgcttc Protospacer
*.*.************************* *
130. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctctcgcaattccggatggaaaaccgctgc Protospacer
*.*.*************.*************
131. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
132. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaactccggacggaaaaccgcttc Protospacer
**** *****.****************** *
133. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggacgtaaaaccgctgc Protospacer
* *.*************** ***********
134. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttctcgcaattccggacggaaaatcgctac Protospacer
***.********************.****.*
135. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttgcgtaattccggacggaaaaccgctac Protospacer
**** **.*********************.*
136. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013515 (Rhizobium sp. N1314 plasmid pRspN1314d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaatttcggacggaaaaccgcttc Protospacer
**** *******.**************** *
137. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054025 (Rhizobium sp. JKLM12A2 plasmid pPR12A204, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgggaaaccgcttc Protospacer
**** ***************.******** *
138. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032696 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525b, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgtttc Protospacer
**** **********************.* *
139. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
140. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054034 (Rhizobium sp. JKLM13E plasmid pPR13E03, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgggaaaccgcttc Protospacer
**** ***************.******** *
141. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013605 (Rhizobium sp. N731 plasmid pRspN731d, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaatttcggacggaaaaccgcttc Protospacer
**** *******.**************** *
142. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttatcgcagttccggacggaaaaccgcttc Protospacer
*** *****.******************* *
143. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053207 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1C, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttaagcaattccggacggaaaaccgcttc Protospacer
**** *********************** *
144. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 3, identity: 0.903
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgaaaaaccgcttc Protospacer
**** **************.********* *
145. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttctacgcaattccggacggaaaaccgctat Protospacer
**.* ************************..
146. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgtaattccggacggaaaaccgctgc Protospacer
**.. **.***********************
147. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttctacgcaattccggacggaaaaccgctat Protospacer
**.* ************************..
148. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgtaattccggacggaaaaccgctgc Protospacer
**.. **.***********************
149. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttgcggctattccggacggaaaaccgctgc Protospacer
*** . ** **********************
150. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaactgctgc Protospacer
.***** *****************.*****
151. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctct Protospacer
**** ************** ********* .
152. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gcttccgaaattccggacggaaaaccgctgc Protospacer
.**.** ***********************
153. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttgcggctattccggacggaaaaccgctgc Protospacer
*** . ** **********************
154. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gcttccgaaattccggacggaaaaccgctgc Protospacer
.**.** ***********************
155. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttgcggctattccggacggaaaaccgctgc Protospacer
*** . ** **********************
156. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaactgctgc Protospacer
.***** *****************.*****
157. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttgccgcaattccggacggaaaaccgttac Protospacer
*** .**********************.*.*
158. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacggaaaaccgcaat Protospacer
**** *********************** ..
159. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctct Protospacer
**** ************** ********* .
160. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050093 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b5, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccgcgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
161. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050105 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b6, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
162. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaactgctgc Protospacer
.***** *****************.*****
163. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctct Protospacer
**** ************** ********* .
164. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_008384 (Rhizobium leguminosarum bv. viciae 3841 plasmid pRL11, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccgcgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
165. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaactgctgc Protospacer
.***** *****************.*****
166. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgtttcgccattccggacggaagaccgctgc Protospacer
. ****** *************.********
167. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
168. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025508 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaatttcggacggaaaaccgtttc Protospacer
**** *******.**************.* *
169. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_012858 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132502, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctct Protospacer
**** ************** ********* .
170. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaactgctgc Protospacer
.***** *****************.*****
171. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgtttcgccattccggacggaagaccgctgc Protospacer
. ****** *************.********
172. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc- CRISPR spacer
ttttacgcagttccggacgg-aaaccgctccg Protospacer
**** ****.********** ******** *
173. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050110 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b4, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
174. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP048282 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctct Protospacer
**** ************** ********* .
175. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttgcgcaattccggacgcaaaaccgcgtc Protospacer
**** ************** ******** *
176. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggacggagaaccgcttc Protospacer
* *.*****************.******* *
177. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gctttcgaaattccggacggaaaactgctgc Protospacer
.***** *****************.*****
178. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
179. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022667 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR2, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaatttcggacggaaaaccgtttc Protospacer
**** *******.**************.* *
180. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gcttccgaaattccggacggaaaaccgctgc Protospacer
.**.** ***********************
181. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggacgcaaaaccgctct Protospacer
**** ************** ********* .
182. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccacgcaattccggacgcaaaaccgctgc Protospacer
**.. ************** ***********
183. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050087 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b5, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaatttcggacggaaaaccgtttc Protospacer
**** *******.**************.* *
184. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013634 (Rhizobium sp. N324 plasmid pRspN324d, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttgcgcaattccggacggaaagccgcgtc Protospacer
**** ******************.**** *
185. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcacgcaattccggacggaaaaccgccac Protospacer
***. ***********************..*
186. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcaacgcaattccggacggaaaaccgcttc Protospacer
**. ************************ *
187. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP035000 (Rhizobium acidisoli strain FH23 plasmid pRapFH23b, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttaaacgcaattccggacggaaaaccgcttc Protospacer
** ************************ *
188. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025017 (Rhizobium leguminosarum strain Norway plasmid pRLN5, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgc Protospacer
***. .************* ***********
189. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP029209 (Nitratireductor sp. OM-1 plasmid pOM-1, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcaattccggtcggaaaaccggttc Protospacer
**** *********** ********** * *
190. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tcttacacaattccggacggaaaaccgcttc Protospacer
*.** *.********************** *
191. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 4, identity: 0.871
tttttcgcaattccggacggaaaaccgctgc- CRISPR spacer
ttttacgcacttccggacgg-aaaccgcttca Protospacer
**** **** ********** ******** *
192. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccttgcaattccggacggaaaaccgctca Protospacer
**..*.***********************
193. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgca----attccggacggaaaaccgctgc CRISPR spacer
----tcccaacgcattccggacggaaaaccgctgc Protospacer
** ** **********************
194. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccttgcaattccggacggaaaaccgctca Protospacer
**..*.***********************
195. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgca----attccggacggaaaaccgctgc CRISPR spacer
----tcccaacgcattccggacggaaaaccgctgc Protospacer
** ** **********************
196. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050106 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b5, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgt Protospacer
***. .************* **********.
197. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025506 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvE, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgt Protospacer
***. .************* **********.
198. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
atcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
199. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050111 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b1, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgt Protospacer
***. .************* **********.
200. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030763 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgt Protospacer
***. .************* **********.
201. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054023 (Rhizobium sp. JKLM12A2 plasmid pPR12A202, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccgcgcaattccggacgcaaaaccgcggc Protospacer
**.. ************** ******** **
202. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
atcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
203. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022668 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR3, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgt Protospacer
***. .************* **********.
204. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gtcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
205. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
atcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
206. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
atcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
207. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gtcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
208. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtgacgcaattccgaacggaaaaccgcttc Protospacer
* * **********.************* *
209. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacgg--aaaaccgctgc CRISPR spacer
cttgtcgcaatttcggacggaaaaaaccgct-- Protospacer
.** ********.******* *********
210. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050081 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b5, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaacggaaaaccgctac Protospacer
*.* **********.*************.*
211. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggaaggaaaaccgccgg Protospacer
* *.************* **********.*
212. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050082 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b4, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctctacgcaattccggacgcaaaacccctgc Protospacer
.*.* ************** ****** ****
213. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggaaggaaaaccgccgg Protospacer
* *.************* **********.*
214. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP049732 (Rhizobium leguminosarum strain A1 plasmid pRL11, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctctacgcaattccggacgcaaaacccctgc Protospacer
.*.* ************** ****** ****
215. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015737 (Shinella sp. HZN7 plasmid pShin-01, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcaacgcaattccggacgcaaaaccgcttc Protospacer
**. ************** ********* *
216. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
atcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
217. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gcttcggaaattccggacggaaaaccgctgc Protospacer
.**. * ***********************
218. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP016289 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcatgcaattccggacgcaaaaccgctgt Protospacer
***. .************* **********.
219. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttcaagcaattccggacggaaatccgccgc Protospacer
***. ***************** ****.**
220. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tgtctcgcaattccggacggaaaaccggttg Protospacer
* *.*********************** *
221. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gttctcgcaattgcggacggaaaaccgcgtc Protospacer
**.******** *************** *
222. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
atcgccgccattccggacggaaaaccgctgc Protospacer
*. .*** **********************
223. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054033 (Rhizobium sp. JKLM13E plasmid pPR13E02, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttccgcgcaattccggacgcaaaaccgcggc Protospacer
**.. ************** ******** **
224. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030764 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctccacgcaattccggacgcaaaaccgctgc Protospacer
.*.. ************** ***********
225. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022567 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK03, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttcgcgcaattccggacgcagaaccgctgc Protospacer
.**. ************** *.*********
226. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttgacgcaattccggacggaaaaccgccca Protospacer
*** ***********************.
227. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_022536 (Rhizobium sp. IRBG74 plasmid IRBL74_p, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttttacgcatttccggacggaaaaccggcgt Protospacer
**** **** ***************** .*.
228. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aattacgcaattccggacggaaaaccgttac Protospacer
** **********************.*.*
229. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015740 (Shinella sp. HZN7 plasmid pShin-04, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttaaacgcaattccggacgcaaaaccgcttc Protospacer
** ************** ********* *
230. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053208 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1B, complete sequence) position: , mismatch: 5, identity: 0.839
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctctacgcaattccggacgcaaaacccctgc Protospacer
.*.* ************** ****** ****
231. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttgctacgcattccggacggaaaaccgctgc Protospacer
** .* **********************
232. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttgctacgcattccggacggaaaaccgctgc Protospacer
** .* **********************
233. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttcacacaattccggacgcaaaatcgctgc Protospacer
.**. *.************ ****.******
234. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaacggaaaaccccttc Protospacer
*.* **********.********** ** *
235. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcaatgcaatcccggacggaaaaccgcttc Protospacer
**. .*****.***************** *
236. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tttgcgtaaattccggacgcaaaaccgctgc Protospacer
*** . *********** ***********
237. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaacggaaaaccccttc Protospacer
*.* **********.********** ** *
238. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctatacgcaattccggacggaaaaccgccat Protospacer
.* * ***********************...
239. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tccttacgcattccggacggaaaaccgctgc Protospacer
*..** **********************
240. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaacggaaaaccccttc Protospacer
*.* **********.********** ** *
241. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttgctacgcattccggacggaaaaccgctgc Protospacer
** .* **********************
242. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032686 (Rhizobium sp. CCGE531 plasmid pRCCGE531c, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctagcaattccgggcggaaaaccgctca Protospacer
**..* **********.************
243. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttgctacgcattccggacggaaaaccgctgc Protospacer
** .* **********************
244. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032691 (Rhizobium sp. CCGE532 plasmid pRCCGE532c, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcctagcaattccgggcggaaaaccgctca Protospacer
**..* **********.************
245. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctaacgcagttccggacgcaaaaccgcttc Protospacer
*.* ****.********* ********* *
246. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tcttacgcaattccggacggaaagccgcact Protospacer
*.** ******************.**** .
247. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctgagcacaattccggacggaaaaccgctgt Protospacer
.* *.***********************.
248. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcaacgcaattcctgacgcaaaaccgcttc Protospacer
**. ********* **** ********* *
249. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ctgagcacaattccggacggaaaaccgctgt Protospacer
.* *.***********************.
250. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aactgcacaattcctgacggaaaaccgctgc Protospacer
.* *.******* ****************
251. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_HG938354 (Neorhizobium galegae bv. orientalis str. HAMBI 540 plasmid pHAMBI540a, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgctgcgcaattccgaacggaaaaccgcttc Protospacer
. .* **********.************* *
252. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgctgcgcaattccgaacggaaaaccgcttc Protospacer
. .* **********.************* *
253. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaacggaaaaccgcgtc Protospacer
*.* **********.************ *
254. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to CP054911 (Pantoea ananatis strain FDAARGOS_680 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.806
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tccctcgcaaatccggacggaaaagcgcttc Protospacer
*...****** ************* **** *
255. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaa----ccgctgc CRISPR spacer
ttttacgcaattccgggcggaaagaaatccg---- Protospacer
**** ***********.******. ***
256. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaa----ccgctgc CRISPR spacer
ttttacgcaattccgggcggaaagaaatccg---- Protospacer
**** ***********.******. ***
257. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP050098 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b4, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaaaggaaaaccgcgtc Protospacer
*.* **********.* ********** *
258. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
259. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP053440 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eF, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tctgacgcaattccgaaaggaaaaccgcgtc Protospacer
*.* **********.* ********** *
260. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
261. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aacggtgcacttccggacggaaaaccgctgc Protospacer
. .*** *********************
262. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
263. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
264. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
265. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aactgcgcacttccgcacggaaaaccgctac Protospacer
.* **** ***** *************.*
266. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
267. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
268. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
269. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatcgcgcacttccggacggaaaaccgttac Protospacer
*. **** *****************.*.*
270. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
271. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
272. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
273. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
274. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
275. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
276. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
277. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
278. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
279. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cttacagcaattccggacgcaaaactgcttc Protospacer
.** . ************* *****.*** *
280. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
281. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
282. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatggcgcacttccggacggaaaaccgttac Protospacer
* **** *****************.*.*
283. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
agcggtgcatttccggacggaaaaccgctgc Protospacer
. .*** *********************
284. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021821 (Sinorhizobium meliloti strain M162 plasmid accessoryA, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tccaacgcacttccggacggaaaaccgttac Protospacer
*.. **** *****************.*.*
285. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
agccgtgcatttccggacggaaaaccgctgc Protospacer
.. .*** *********************
286. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
tccaacgcacttccggacggaaaaccgttac Protospacer
*.. **** *****************.*.*
287. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aatcgcgcacttccggacggaaaaccgttac Protospacer
*. **** *****************.*.*
288. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aactgcgcacttccggacggaaaaccgttac Protospacer
.* **** *****************.*.*
289. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.774
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aactgcgcacttccggacggaaaaccgttac Protospacer
.* **** *****************.*.*
290. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aaccacgcacttccggacggaaaaccgttac Protospacer
.. **** *****************.*.*
291. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aacggtgcacttacggacggaaaaccgctgc Protospacer
. .*** ** ******************
292. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgaatcgcaattccggacttaaaaccgcctc Protospacer
. ************** ********. *
293. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP016452 (Sinorhizobium sp. RAC02 plasmid pBSY16_1, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ggccgcgcaatcccagacggaaaaccgcttc Protospacer
.. ******.**.************** *
294. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
agcggcgcaattcctaacggaaaaccgcttc Protospacer
. ********* .************* *
295. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
agcggcgcaattcctaacggaaaaccgcttc Protospacer
. ********* .************* *
296. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013110 (Sinorhizobium americanum strain CFNEI 73 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aacgacgcaattccggacggaaaaccgtgac Protospacer
. **********************. .*
297. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP013054 (Sinorhizobium americanum CCGM7 plasmid C, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
aacgacgcaattccggacggaaaaccgtgac Protospacer
. **********************. .*
298. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP015006 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA01, complete sequence) position: , mismatch: 8, identity: 0.742
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
ttcgacgcagttcctgacggaaaaccgcgtt Protospacer
**. ****.**** ************* .
299. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgctgcgcacttccggacggaaaaccgtcaa Protospacer
. .* **** *****************...
300. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
301. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgctgcgcacttccggacggaaaaccgtcaa Protospacer
. .* **** *****************...
302. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
303. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
304. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
305. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
306. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gtcgctgccattccggacggaaaaccgcgca Protospacer
*. ..** *******************
307. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
308. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
309. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
310. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
311. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgctgcgcacttccggacggaaaaccgtcaa Protospacer
. .* **** *****************...
312. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
313. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
314. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaccaagcactgccggacggaaaaccgctcc Protospacer
.. *** * ***************** *
315. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
316. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
cgctgcgcacttccggacggaaaaccgtcaa Protospacer
. .* **** *****************...
317. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
318. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
319. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.
320. spacer 5.1|6667273|31|CP034448|CRISPRCasFinder matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 9, identity: 0.71
tttttcgcaattccggacggaaaaccgctgc CRISPR spacer
gaaaacccacttcaggacggaaaaccgctgt Protospacer
* ** *** ****************.