Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034451 Mesorhizobium sp. M3A.F.Ca.ET.080.04.2.1 chromosome, complete genome 6 crisprs csa3,RT,cas3,WYL,DEDDh 0 1 2 0

Results visualization

1. CP034451
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034451_1 1048198-1048314 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034451_2 1232634-1232723 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034451_3 1743053-1743151 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034451_4 2469850-2469944 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034451_5 5532102-5532181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034451_6 5588063-5588207 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 521819-521847 6 0.793
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 648818-648846 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP016287 Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence 643906-643934 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP032695 Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence 2199401-2199429 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 27770-27798 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP030761 Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence 237287-237315 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP050092 Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence 77382-77410 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP050099 Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence 27775-27803 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP050104 Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence 345022-345050 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP025014 Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence 27333-27361 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP025507 Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence 47797-47825 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP050109 Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence 345022-345050 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP022666 Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence 761917-761945 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP050086 Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence 359047-359075 7 0.759
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP018229 Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence 687086-687114 8 0.724
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP053441 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence 250640-250668 8 0.724
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP021071 Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence 176908-176936 8 0.724
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP015065 Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence 206961-206989 8 0.724
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP015063 Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence 224947-224975 8 0.724
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NZ_CP022566 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence 272095-272123 8 0.724
CP034451_4 4.1|2469883|29|CP034451|CRISPRCasFinder 2469883-2469911 29 NC_014918 Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence 313199-313227 8 0.724

1. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 6, identity: 0.793

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
acacttttgcgcgacatgctttggtttaa	Protospacer
.****************** * ***.*  

2. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
acacttttgcgcgacatgcttagctggcc	Protospacer
.****************** *** *  ..

3. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
acacttttgcgcgacatgcttagcaatgc	Protospacer
.****************** ***   * .

4. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgcgcgacatgctttggagccg	Protospacer
******************* * **  .. 

5. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcat-----aggtcttt	CRISPR spacer
acacttttgggcgacatgcattggggagg-----	Protospacer
.******** ***********     ***     

6. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

7. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

8. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP050099 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b5, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcat-----aggtcttt	CRISPR spacer
acacttttgggcgacatgcattggggagg-----	Protospacer
.******** ***********     ***     

9. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

10. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP025014 (Rhizobium leguminosarum strain Norway plasmid pRLN2, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcat-----aggtcttt	CRISPR spacer
acacttttgggcgacatgcattggggagg-----	Protospacer
.******** ***********     ***     

11. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

12. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

13. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

14. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 7, identity: 0.759

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattagttgaa	Protospacer
********* *********** .**.   

15. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
acacttttgcgcgacatgcttagccgacg	Protospacer
.****************** *** .  . 

16. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP053441 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eE, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
acacttttgcgcgacatgcttaaagcggc	Protospacer
.****************** **.. *  .

17. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP021071 (Mesorhizobium sp. WSM1497 plasmid pWSM1497, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattaaccagc	Protospacer
********* *********** ...*  .

18. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP015065 (Mesorhizobium ciceri biovar biserrulae strain WSM1284 plasmid pMc1284, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattaaccagc	Protospacer
********* *********** ...*  .

19. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP015063 (Mesorhizobium ciceri strain CC1192 plasmid pMc1192, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattaaccagc	Protospacer
********* *********** ...*  .

20. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NZ_CP022566 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK02, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
acacttttgggcgacatgcatggggagga	Protospacer
.******** ***********.**     

21. spacer 4.1|2469883|29|CP034451|CRISPRCasFinder matches to NC_014918 (Mesorhizobium ciceri biovar biserrulae WSM1271 plasmid pMESCI01, complete sequence) position: , mismatch: 8, identity: 0.724

gcacttttgcgcgacatgcataggtcttt	CRISPR spacer
gcacttttgggcgacatgcattaaccagc	Protospacer
********* *********** ...*  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 3841035 : 3930624 58 Stx2-converting_phage(25.0%) transposase NA
DBSCAN-SWA_2 5814299 : 5822590 9 uncultured_Mediterranean_phage(85.71%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage