Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025863 Escherichia coli strain 504237 plasmid p504237_142, complete sequence 0 crisprs NA 0 0 0 0
CP025864 Escherichia coli strain 504237 plasmid p504237_36, complete sequence 0 crisprs NA 0 0 0 0
CP025862 Escherichia coli strain 504237 chromosome, complete genome 4 crisprs NA 0 9 0 0

Results visualization

1. CP025862
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025862_1 918925-919021 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025862_2 1158446-1158591 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025862_3 3432732-3433065 Orphan I-E
5 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025862_4 3458910-3459426 Orphan I-E
8 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025862_3 3.1|3432761|32|CP025862|CRT 3432761-3432792 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 3 0.906
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 39364-39395 5 0.844
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP044424 Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence 99-130 6 0.812
CP025862_3 3.1|3432761|32|CP025862|CRT 3432761-3432792 32 NZ_CP015038 Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence 112768-112799 7 0.781
CP025862_4 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT 3458939-3458970 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_LR134463 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence 97059-97090 7 0.781
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 362913-362944 7 0.781
CP025862_3 3.1|3432761|32|CP025862|CRT 3432761-3432792 32 NZ_AP014705 Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence 1428097-1428128 8 0.75
CP025862_3 3.3|3432883|32|CP025862|CRT,CRISPRCasFinder,PILER-CR 3432883-3432914 32 MK448454 Streptococcus satellite phage Javan361, complete genome 9192-9223 8 0.75
CP025862_3 3.5|3433005|32|CP025862|CRT,CRISPRCasFinder,PILER-CR 3433005-3433036 32 NZ_CP006991 Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence 532343-532374 8 0.75
CP025862_4 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT 3458939-3458970 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP025862_4 4.2|3459000|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459000-3459031 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP029831 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence 376196-376227 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 MH155873 Microbacterium phage Paschalis, complete genome 25033-25064 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 546692-546723 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 202063-202094 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 86816-86847 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP007794 Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence 570824-570855 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NC_016623 Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence 500613-500644 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP040820 Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence 162469-162500 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP029356 Azospirillum sp. CFH 70021 plasmid unnamed1 89306-89337 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NC_013857 Azospirillum sp. B510 plasmid pAB510c, complete sequence 638043-638074 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1365174-1365205 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 124144-124175 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 496002-496033 8 0.75
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 767196-767227 8 0.75
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_KY433363 Proteus mirabilis strain R997 plasmid pR997, complete sequence 57742-57773 8 0.75
CP025862_4 4.8|3459366|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459366-3459397 32 MK972713 Salmonella phage SW5, complete genome 18872-18903 8 0.75
CP025862_4 4.8|3459366|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459366-3459397 32 MK972714 Salmonella phage SW3, complete genome 19094-19125 8 0.75
CP025862_4 4.8|3459366|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459366-3459397 32 NC_049460 Salmonella phage SI7, complete genome 9314-9345 8 0.75
CP025862_3 3.1|3432761|32|CP025862|CRT 3432761-3432792 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 141278-141309 9 0.719
CP025862_3 3.5|3433005|32|CP025862|CRT,CRISPRCasFinder,PILER-CR 3433005-3433036 32 NZ_CP040723 Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence 35740-35771 9 0.719
CP025862_4 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT 3458939-3458970 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP030828 Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence 447780-447811 9 0.719
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NC_016587 Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence 335975-336006 9 0.719
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 AP021850 Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome 207494-207525 9 0.719
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP020539 Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence 226955-226986 9 0.719
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 NZ_CP014519 Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence 62779-62810 9 0.719
CP025862_4 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459061-3459092 32 MH834603 Arthrobacter phage Bridgette, complete genome 29555-29586 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_KX528687 Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence 60757-60788 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP031977 Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence 41217-41248 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP018638 Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence 697-728 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP031973 Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence 41217-41248 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP045203 Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence 184766-184797 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP021429 Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence 54225-54256 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP040913 Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence 46038-46069 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP030755 Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence 51662-51693 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 CP033526 Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence 26822-26853 9 0.719
CP025862_4 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459183-3459214 32 NZ_CP025619 Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence 145953-145984 9 0.719
CP025862_4 4.6|3459244|32|CP025862|CRISPRCasFinder,CRT,PILER-CR 3459244-3459275 32 NZ_CP030864 Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence 52197-52228 9 0.719
CP025862_4 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT 3458939-3458970 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688

1. spacer 3.1|3432761|32|CP025862|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
caagtgatgtccatcatcgcatccagtgcgtc	Protospacer
.*******.*********************.*

2. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.844

gatcctgaacgacgccgcgcccaccgcaccga--	CRISPR spacer
catcctgagcgacgccgcgctcaccg--ccgact	Protospacer
 *******.***********.*****  ****  

3. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 6, identity: 0.812

gatcctgaacgacgccgcgcccaccg-caccga	CRISPR spacer
catcctgaacgacgccgagaccaccgacgacg-	Protospacer
 **************** * ****** *. ** 

4. spacer 3.1|3432761|32|CP025862|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781

taagtgat-atccatcatcgcatccagtgcgcc	CRISPR spacer
-ggttgatcgtccttcatcgcagccagtgcgcc	Protospacer
 .. **** .*** ******** **********

5. spacer 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

6. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 7, identity: 0.781

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
gctcctggacgaggccgcgcccaccgtcgcca	Protospacer
* *****.**** *************.  * *

7. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 7, identity: 0.781

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
gttcgagaacgacgccgcgcccgccggactgg	Protospacer
* **  ****************.*** **.*.

8. spacer 3.1|3432761|32|CP025862|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75

taagtg---atatccatcatcgcatccagtgcgcc	CRISPR spacer
---gtgcgcccctccatcaccgcttccagtgcgcc	Protospacer
   ***    . *******.*** ***********

9. spacer 3.3|3432883|32|CP025862|CRT,CRISPRCasFinder,PILER-CR matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75

tgaagcatcaaacatttggtggaccaaacgga	CRISPR spacer
tgaagaatcaaaaatttggtggattgataaga	Protospacer
***** ****** **********...*  .**

10. spacer 3.5|3433005|32|CP025862|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75

ggatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
ggatcggccagcgcatctgcgggaggatgatg	Protospacer
***** ******** ********. *.*.*  

11. spacer 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

12. spacer 4.2|3459000|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75

-gacagaacggcctcagtagtctcgtcaggctc	CRISPR spacer
ccaccg-ctggccccagtagcctcgtcaggctt	Protospacer
  ** *  .****.******.***********.

13. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

14. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cgaccgatacgacgccgcgcccaccgcggcga	Protospacer
 . ** . *******************. ***

15. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgccctgt	Protospacer
  * *************** ***.*** *.* 

16. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
caccgacaacgaggccgcgcccagcgcaccca	Protospacer
 *.*   ***** ********** ****** *

17. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cttgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

18. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgccctgt	Protospacer
  * *************** ***.*** *.* 

19. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgccctgt	Protospacer
  * *************** ***.*** *.* 

20. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

21. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

22. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgccctgt	Protospacer
  * *************** ***.*** *.* 

23. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

24. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

25. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

26. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cctgctgaacgacgccgcggccatcgcgctgt	Protospacer
  * *************** ***.***.*.* 

27. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 8, identity: 0.75

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgatggag	Protospacer
*** *********** ******** .*   * 

28. spacer 4.8|3459366|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 8, identity: 0.75

atcgctgctgcttttcactcagtgtcatttgt	CRISPR spacer
aaagttgctgtttttcactcagtttcattgcg	Protospacer
*  *.*****.************ *****   

29. spacer 4.8|3459366|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 8, identity: 0.75

atcgctgctgcttttcactcagtgtcatttgt	CRISPR spacer
aaagttgctgtttttcactcagtttcattgcg	Protospacer
*  *.*****.************ *****   

30. spacer 4.8|3459366|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 8, identity: 0.75

atcgctgctgcttttcactcagtgtcatttgt	CRISPR spacer
aaagttgctgtttttcactcagtttcattgcg	Protospacer
*  *.*****.************ *****   

31. spacer 3.1|3432761|32|CP025862|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719

taagtgatatccatcatcgcatccagtgcgcc	CRISPR spacer
ctcatcgcatccatcatcggttccagtgcgcc	Protospacer
.  .* ..***********  ***********

32. spacer 3.5|3433005|32|CP025862|CRT,CRISPRCasFinder,PILER-CR matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719

ggatctgccagcgcctctgcggggcggtaaac	CRISPR spacer
gtcgctgccagcgcctcggcgaggcggtctcg	Protospacer
*   ************* ***.******    

33. spacer 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

34. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 9, identity: 0.719

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
atgatagagcgacgacgcgcccaccgcaccgc	Protospacer
.   . **.***** **************** 

35. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
gtccgccgccgccgccgcgcacaccgcaccga	Protospacer
* .* . . ** ******** ***********

36. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cttcctgcaggacgccgcgcccaccacgacct	Protospacer
  ***** * ***************.*. *  

37. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
agtcaccaacgacgccgcgccgcccgcacccc	Protospacer
..** . **************  *******  

38. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014519 (Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence) position: , mismatch: 9, identity: 0.719

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
tcccatgaacgacggcgcgcccacggcattgc	Protospacer
  .* ********* ********* ***..* 

39. spacer 4.3|3459061|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 9, identity: 0.719

gatcctgaacgacgccgcgcccaccgcaccga	CRISPR spacer
cggccccctcgacgccgcgcccaccgaagcga	Protospacer
 . **.   ***************** * ***

40. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

41. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

42. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

43. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

44. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggcg	Protospacer
*** *********** ******** .*     

45. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

46. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

47. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

48. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggtg	Protospacer
*** *********** ******** .*     

49. spacer 4.5|3459183|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 9, identity: 0.719

gaaacgccggttgaacgtcgtgcaaaaatcat	CRISPR spacer
gaaccgccggttgaaggtcgtgcatgacggcg	Protospacer
*** *********** ******** .*     

50. spacer 4.6|3459244|32|CP025862|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

gactggtacggcccgtgggagcgtgtgatcgg	CRISPR spacer
gactggtccggccggtgggagcggctgccgaa	Protospacer
******* ***** *********  ** . ..

51. spacer 4.1|3458939|32|CP025862|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage