Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025841 Escherichia coli strain 214-4 plasmid p214_4_132, complete sequence 0 crisprs NA 0 0 0 0
CP025840 Escherichia coli strain 214-4 chromosome, complete genome 11 crisprs NA 1 23 0 0

Results visualization

1. CP025840
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_1 177355-177499 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_2 554159-554303 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_3 703658-703754 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_4 949157-949298 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_5 2899758-2899970 Orphan I-E
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_6 2901352-2901929 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_7 2928740-2929317 Orphan I-E
9 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_8 3466903-3467020 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_9 4144387-4144510 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_10 4905720-4905811 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025840_11 5076016-5076221 Orphan I-F
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP025840_6 6.2|2901442|32|CP025840|PILER-CR,CRISPRCasFinder 2901442-2901473 32 CP025840.1 5046467-5046498 0 1.0

1. spacer 6.2|2901442|32|CP025840|PILER-CR,CRISPRCasFinder matches to position: 5046467-5046498, mismatch: 0, identity: 1.0 

gaccagagatgtcgtagccgtatttcgcagcc	CRISPR spacer
gaccagagatgtcgtagccgtatttcgcagcc	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025840_10 10.1|4905746|40|CP025840|CRISPRCasFinder 4905746-4905785 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 0 1.0
CP025840_7 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT 2929257-2929288 32 LC542972 Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence 246937-246968 1 0.969
CP025840_6 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder 2901625-2901656 32 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 63538-63569 2 0.938
CP025840_6 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder 2901625-2901656 32 MT074430 Salmonella phage pink, complete genome 39944-39975 2 0.938
CP025840_6 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder 2901625-2901656 32 KY709687 Salmonella phage 29485, complete genome 17835-17866 2 0.938
CP025840_6 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder 2901625-2901656 32 NC_022752 Salmonella phage SETP13, complete genome 32901-32932 2 0.938
CP025840_6 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder 2901625-2901656 32 KY176369 Salmonella phage STP03, complete genome 33437-33468 2 0.938
CP025840_7 7.4|2928951|33|CP025840|PILER-CR 2928951-2928983 33 NC_004313 Salmonella phage ST64B, complete genome 32736-32768 2 0.939
CP025840_7 7.4|2928951|33|CP025840|PILER-CR 2928951-2928983 33 KU927493 Salmonella phage 118970_sal3, complete genome 70348-70380 2 0.939
CP025840_7 7.4|2928951|33|CP025840|PILER-CR 2928951-2928983 33 AY055382 Salmonella typhimurium phage ST64B complete sequence 32736-32768 2 0.939
CP025840_7 7.11|2928952|32|CP025840|CRISPRCasFinder,CRT 2928952-2928983 32 NC_004313 Salmonella phage ST64B, complete genome 32737-32768 2 0.938
CP025840_7 7.11|2928952|32|CP025840|CRISPRCasFinder,CRT 2928952-2928983 32 KU927493 Salmonella phage 118970_sal3, complete genome 70349-70380 2 0.938
CP025840_7 7.11|2928952|32|CP025840|CRISPRCasFinder,CRT 2928952-2928983 32 AY055382 Salmonella typhimurium phage ST64B complete sequence 32737-32768 2 0.938
CP025840_9 9.1|4144430|38|CP025840|CRISPRCasFinder 4144430-4144467 38 NZ_CP043437 Enterobacter sp. LU1 plasmid unnamed 113727-113764 2 0.947
CP025840_6 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder 2901625-2901656 32 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 46242-46273 3 0.906
CP025840_6 6.14|2901625|36|CP025840|CRT 2901625-2901660 36 NZ_KY515226 Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence 63538-63573 4 0.889
CP025840_6 6.14|2901625|36|CP025840|CRT 2901625-2901660 36 MT074430 Salmonella phage pink, complete genome 39940-39975 4 0.889
CP025840_6 6.14|2901625|36|CP025840|CRT 2901625-2901660 36 KY709687 Salmonella phage 29485, complete genome 17835-17870 4 0.889
CP025840_6 6.14|2901625|36|CP025840|CRT 2901625-2901660 36 NC_022752 Salmonella phage SETP13, complete genome 32897-32932 4 0.889
CP025840_6 6.14|2901625|36|CP025840|CRT 2901625-2901660 36 KY176369 Salmonella phage STP03, complete genome 33437-33472 4 0.889
CP025840_6 6.6|2901686|32|CP025840|PILER-CR,CRISPRCasFinder 2901686-2901717 32 NZ_CP017563 Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence 632328-632359 5 0.844
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24789-24826 6 0.842
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24902-24939 6 0.842
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4073-4110 6 0.842
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4072-4109 6 0.842
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4072-4109 6 0.842
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4072-4109 6 0.842
CP025840_6 6.14|2901625|36|CP025840|CRT 2901625-2901660 36 CP053410 Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence 46242-46277 6 0.833
CP025840_7 7.10|2928891|32|CP025840|CRISPRCasFinder,CRT 2928891-2928922 32 NZ_CP007144 Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence 138784-138815 6 0.812
CP025840_7 7.14|2929135|32|CP025840|CRISPRCasFinder,CRT 2929135-2929166 32 NZ_AP018520 Sphingobium sp. YG1 plasmid pYGP1, complete sequence 43472-43503 6 0.812
CP025840_7 7.9|2928830|32|CP025840|CRISPRCasFinder,CRT 2928830-2928861 32 MN434094 Klebsiella phage AmPh_EK80, complete genome 63674-63705 7 0.781
CP025840_7 7.9|2928830|32|CP025840|CRISPRCasFinder,CRT 2928830-2928861 32 MN101228 Klebsiella phage KPN4, complete genome 50865-50896 7 0.781
CP025840_7 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT 2929257-2929288 32 MK455769 Aeromonas phage MJG, complete genome 10369-10400 7 0.781
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 3331-3368 8 0.789
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 3330-3367 8 0.789
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 3330-3367 8 0.789
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 3330-3367 8 0.789
CP025840_5 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT 2899848-2899879 32 NZ_CP040765 Paracoccus sp. 2251 plasmid unnamed1, complete sequence 230307-230338 8 0.75
CP025840_6 6.6|2901686|32|CP025840|PILER-CR,CRISPRCasFinder 2901686-2901717 32 NZ_CP029830 Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence 460575-460606 8 0.75
CP025840_6 6.9|2901869|32|CP025840|PILER-CR,CRISPRCasFinder 2901869-2901900 32 MK814759 Gordonia phage Reyja, complete genome 4467-4498 8 0.75
CP025840_7 7.6|2929073|33|CP025840|PILER-CR 2929073-2929105 33 NC_018454 Cronobacter phage phiES15, complete genome 8780-8812 8 0.758
CP025840_7 7.6|2929073|33|CP025840|PILER-CR 2929073-2929105 33 JQ780327 Cronobacter phage phiES15, complete sequence 8780-8812 8 0.758
CP025840_7 7.13|2929074|32|CP025840|CRISPRCasFinder,CRT 2929074-2929105 32 NC_018454 Cronobacter phage phiES15, complete genome 8781-8812 8 0.75
CP025840_7 7.13|2929074|32|CP025840|CRISPRCasFinder,CRT 2929074-2929105 32 JQ780327 Cronobacter phage phiES15, complete sequence 8781-8812 8 0.75
CP025840_3 3.1|703685|43|CP025840|CRISPRCasFinder 703685-703727 43 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 4037-4079 9 0.791
CP025840_3 3.1|703685|43|CP025840|CRISPRCasFinder 703685-703727 43 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 4036-4078 9 0.791
CP025840_3 3.1|703685|43|CP025840|CRISPRCasFinder 703685-703727 43 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 4036-4078 9 0.791
CP025840_3 3.1|703685|43|CP025840|CRISPRCasFinder 703685-703727 43 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 4036-4078 9 0.791
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 14114-14151 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 51843-51880 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053606 Escherichia coli strain NEB_Turbo plasmid F', complete sequence 229388-229425 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053608 Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence 239882-239919 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP014271 Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence 230794-230831 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP014273 Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence 211764-211801 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 40383-40420 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 313601-313638 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 386517-386554 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 397090-397127 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023206 Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence 404135-404172 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 114998-115035 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 40307-40344 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 MT230112 Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence 103-140 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023207 Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence 31308-31345 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 8897-8934 9 0.763
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 17901-17938 9 0.763
CP025840_5 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT 2899848-2899879 32 NZ_CP046574 Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence 32983-33014 9 0.719
CP025840_5 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT 2899848-2899879 32 NZ_CP009112 Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence 288224-288255 9 0.719
CP025840_5 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT 2899848-2899879 32 NZ_CP054616 Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence 298192-298223 9 0.719
CP025840_6 6.6|2901686|32|CP025840|PILER-CR,CRISPRCasFinder 2901686-2901717 32 NZ_CP006988 Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence 91348-91379 9 0.719
CP025840_6 6.7|2901747|32|CP025840|PILER-CR,CRISPRCasFinder 2901747-2901778 32 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 224876-224907 9 0.719
CP025840_7 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT 2929257-2929288 32 NC_047954 Pseudomonas phage Njord, complete genome 11435-11466 9 0.719
CP025840_11 11.3|5076160|33|CP025840|CRISPRCasFinder,CRT 5076160-5076192 33 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4203 9 0.727
CP025840_11 11.5|5076161|32|CP025840|PILER-CR 5076161-5076192 32 MN855903 Myoviridae sp. isolate 490, partial genome 4171-4202 9 0.719
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP044308 Escherichia coli strain C27A plasmid pC27A-3, complete sequence 56040-56077 10 0.737
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP053046 Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence 58275-58312 10 0.737
CP025840_4 4.1|949209|38|CP025840|CRISPRCasFinder 949209-949246 38 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30215-30252 10 0.737
CP025840_5 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT 2899848-2899879 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 117189-117220 10 0.688
CP025840_7 7.12|2929013|32|CP025840|CRISPRCasFinder,CRT 2929013-2929044 32 NZ_CP027239 Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence 55281-55312 10 0.688
CP025840_7 7.14|2929135|32|CP025840|CRISPRCasFinder,CRT 2929135-2929166 32 NZ_CP021914 Sagittula sp. P11 plasmid unnamed1, complete sequence 50199-50230 10 0.688
CP025840_7 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT 2929257-2929288 32 NC_047894 Pseudomonas phage uligo, complete genome 11353-11384 10 0.688
CP025840_6 6.2|2901442|32|CP025840|PILER-CR,CRISPRCasFinder 2901442-2901473 32 NZ_CP014527 Haematospirillum jordaniae strain H5569 plasmid unnamed 2, complete sequence 231306-231337 11 0.656
CP025840_8 8.1|3466934|56|CP025840|CRISPRCasFinder 3466934-3466989 56 NZ_AP023208 Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence 12101-12156 11 0.804

1. spacer 10.1|4905746|40|CP025840|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0 

gcgctgcgggtcattcttgaaattacccccgctgtgctgt	CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt	Protospacer
****************************************

2. spacer 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 1, identity: 0.969 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactggatgcgatgatggacatcacttg	Protospacer
***********************.********

3. spacer 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 2, identity: 0.938 

aggagtttaatttccagattgagcgctggata	CRISPR spacer
aagagtttaatttccagatagagcgctggata	Protospacer
*.***************** ************

4. spacer 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder matches to MT074430 (Salmonella phage pink, complete genome) position: , mismatch: 2, identity: 0.938 

aggagtttaatttccagattgagcgctggata	CRISPR spacer
aagagtttaatttccagatagagcgctggata	Protospacer
*.***************** ************

5. spacer 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 2, identity: 0.938 

aggagtttaatttccagattgagcgctggata	CRISPR spacer
aagagtttaatttccagatagagcgctggata	Protospacer
*.***************** ************

6. spacer 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder matches to NC_022752 (Salmonella phage SETP13, complete genome) position: , mismatch: 2, identity: 0.938 

aggagtttaatttccagattgagcgctggata	CRISPR spacer
aagagtttaatttccagatagagcgctggata	Protospacer
*.***************** ************

7. spacer 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder matches to KY176369 (Salmonella phage STP03, complete genome) position: , mismatch: 2, identity: 0.938 

aggagtttaatttccagattgagcgctggata	CRISPR spacer
aagagtttaatttccagatagagcgctggata	Protospacer
*.***************** ************

8. spacer 7.4|2928951|33|CP025840|PILER-CR matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 2, identity: 0.939 

ctgatcacatcatgtttattcgcggtcgtattg	CRISPR spacer
ccgatcacatcatgtttatccgcggtcgtattg	Protospacer
*.*****************.*************

9. spacer 7.4|2928951|33|CP025840|PILER-CR matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 2, identity: 0.939 

ctgatcacatcatgtttattcgcggtcgtattg	CRISPR spacer
ccgatcacatcatgtttatccgcggtcgtattg	Protospacer
*.*****************.*************

10. spacer 7.4|2928951|33|CP025840|PILER-CR matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 2, identity: 0.939 

ctgatcacatcatgtttattcgcggtcgtattg	CRISPR spacer
ccgatcacatcatgtttatccgcggtcgtattg	Protospacer
*.*****************.*************

11. spacer 7.11|2928952|32|CP025840|CRISPRCasFinder,CRT matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 2, identity: 0.938 

tgatcacatcatgtttattcgcggtcgtattg	CRISPR spacer
cgatcacatcatgtttatccgcggtcgtattg	Protospacer
.*****************.*************

12. spacer 7.11|2928952|32|CP025840|CRISPRCasFinder,CRT matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 2, identity: 0.938 

tgatcacatcatgtttattcgcggtcgtattg	CRISPR spacer
cgatcacatcatgtttatccgcggtcgtattg	Protospacer
.*****************.*************

13. spacer 7.11|2928952|32|CP025840|CRISPRCasFinder,CRT matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 2, identity: 0.938 

tgatcacatcatgtttattcgcggtcgtattg	CRISPR spacer
cgatcacatcatgtttatccgcggtcgtattg	Protospacer
.*****************.*************

14. spacer 9.1|4144430|38|CP025840|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947 

cggacgcaggatggtgcgttcaattggactcgaaccaa	CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa	Protospacer
*.*******.****************************

15. spacer 6.5|2901625|32|CP025840|PILER-CR,CRISPRCasFinder matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906 

aggagtttaatttccagattgagcgctggata	CRISPR spacer
aagagtttaatttccagacagagcgctggata	Protospacer
*.****************. ************

16. spacer 6.14|2901625|36|CP025840|CRT matches to NZ_KY515226 (Salmonella enterica subsp. enterica serovar Derby strain S701 plasmid AnCo3, complete sequence) position: , mismatch: 4, identity: 0.889 

aggagtttaatttccagattgagcgctggatagagt	CRISPR spacer
aagagtttaatttccagatagagcgctggatacagc	Protospacer
*.***************** ************ **.

17. spacer 6.14|2901625|36|CP025840|CRT matches to MT074430 (Salmonella phage pink, complete genome) position: , mismatch: 4, identity: 0.889 

aggagtttaatttccagattgagcgctggatagagt	CRISPR spacer
aagagtttaatttccagatagagcgctggatacagc	Protospacer
*.***************** ************ **.

18. spacer 6.14|2901625|36|CP025840|CRT matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 4, identity: 0.889 

aggagtttaatttccagattgagcgctggatagagt	CRISPR spacer
aagagtttaatttccagatagagcgctggatacagc	Protospacer
*.***************** ************ **.

19. spacer 6.14|2901625|36|CP025840|CRT matches to NC_022752 (Salmonella phage SETP13, complete genome) position: , mismatch: 4, identity: 0.889 

aggagtttaatttccagattgagcgctggatagagt	CRISPR spacer
aagagtttaatttccagatagagcgctggatacagc	Protospacer
*.***************** ************ **.

20. spacer 6.14|2901625|36|CP025840|CRT matches to KY176369 (Salmonella phage STP03, complete genome) position: , mismatch: 4, identity: 0.889 

aggagtttaatttccagattgagcgctggatagagt	CRISPR spacer
aagagtttaatttccagatagagcgctggatacagc	Protospacer
*.***************** ************ **.

21. spacer 6.6|2901686|32|CP025840|PILER-CR,CRISPRCasFinder matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 5, identity: 0.844 

gcgatctcgcggaatacaccgacg-aggcgggc	CRISPR spacer
acgatctcgcggaatacgtcgacgtaggccgg-	Protospacer
.****************..***** **** **

22. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

23. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttgatgtcggatgcggcgtaaacgccttatccgaccta	Protospacer
* * *************.**************.***..

24. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

25. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

26. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

27. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 6, identity: 0.842 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
taactgccggatgcggcataaacgccttatccggccta	Protospacer
**.***.*************************..**..

28. spacer 6.14|2901625|36|CP025840|CRT matches to CP053410 (Salmonella enterica strain 2014K-0203 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.833 

aggagtttaatttccagattgagcgctggatagagt	CRISPR spacer
aagagtttaatttccagacagagcgctggatacaac	Protospacer
*.****************. ************ *..

29. spacer 7.10|2928891|32|CP025840|CRISPRCasFinder,CRT matches to NZ_CP007144 (Hymenobacter swuensis DY53 plasmid pHsw1, complete sequence) position: , mismatch: 6, identity: 0.812 

--acggcttcatgttcttggtgatggggttcacc	CRISPR spacer
tggcggc--cgtgttctgggtgatggggttgacc	Protospacer
  .****  *.****** ************ ***

30. spacer 7.14|2929135|32|CP025840|CRISPRCasFinder,CRT matches to NZ_AP018520 (Sphingobium sp. YG1 plasmid pYGP1, complete sequence) position: , mismatch: 6, identity: 0.812 

ggcgagtccgtcagcggtgcgccgctg-caaca	CRISPR spacer
gtcgagtaagtcagcggtgcgccgcgatcaac-	Protospacer
* *****  **************** . ****

31. spacer 7.9|2928830|32|CP025840|CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 7, identity: 0.781 

--ccgtcggcagcggcgttaaatggggcgcgctt	CRISPR spacer
tccagtc--cagcgtcgttaaatgcggcgcgcag	Protospacer
  * ***  ***** ********* *******

32. spacer 7.9|2928830|32|CP025840|CRISPRCasFinder,CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 7, identity: 0.781 

--ccgtcggcagcggcgttaaatggggcgcgctt	CRISPR spacer
tccagtc--cagcgtcgttaaatgcggcgcgcag	Protospacer
  * ***  ***** ********* *******

33. spacer 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT matches to MK455769 (Aeromonas phage MJG, complete genome) position: , mismatch: 7, identity: 0.781 

gacgcactggatgcgatgatggatatcacttg-	CRISPR spacer
gacgcactgtatgcaatgatgga-atcggaggc	Protospacer
********* ****.******** ***.   *

34. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

35. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

36. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

37. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 8, identity: 0.789 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
.*.***.**********.**************. **..

38. spacer 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040765 (Paracoccus sp. 2251 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

attattaattctggtggcgctggtcgccctgg	CRISPR spacer
gttgtacgatctggtggcgctggtggtcctgg	Protospacer
.**.*  . *************** *.*****

39. spacer 6.6|2901686|32|CP025840|PILER-CR,CRISPRCasFinder matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gcgatctcgcggaatacaccgacgaggcgggc	CRISPR spacer
gcctgctggcggaatacgccgacgaggcgacg	Protospacer
**   ** *********.***********.

40. spacer 6.9|2901869|32|CP025840|PILER-CR,CRISPRCasFinder matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75 

gagcctgacgagactactgaggccgttctgtc-	CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg	Protospacer
.***********.******.****.  * **

41. spacer 7.6|2929073|33|CP025840|PILER-CR matches to NC_018454 (Cronobacter phage phiES15, complete genome) position: , mismatch: 8, identity: 0.758 

gatccgccgccggttaacgctggaccagttccg	CRISPR spacer
ggcgtggccccggttaacgctggacacgttccg	Protospacer
*.. .* * ****************  ******

42. spacer 7.6|2929073|33|CP025840|PILER-CR matches to JQ780327 (Cronobacter phage phiES15, complete sequence) position: , mismatch: 8, identity: 0.758 

gatccgccgccggttaacgctggaccagttccg	CRISPR spacer
ggcgtggccccggttaacgctggacacgttccg	Protospacer
*.. .* * ****************  ******

43. spacer 7.13|2929074|32|CP025840|CRISPRCasFinder,CRT matches to NC_018454 (Cronobacter phage phiES15, complete genome) position: , mismatch: 8, identity: 0.75 

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

44. spacer 7.13|2929074|32|CP025840|CRISPRCasFinder,CRT matches to JQ780327 (Cronobacter phage phiES15, complete sequence) position: , mismatch: 8, identity: 0.75 

atccgccgccggttaacgctggaccagttccg	CRISPR spacer
gcgtggccccggttaacgctggacacgttccg	Protospacer
.. .* * ****************  ******

45. spacer 3.1|703685|43|CP025840|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.791 

caattgccggatgcggcacaagtttgtaggcacgataagacgc	CRISPR spacer
cggcctaccgatccggcacaagtttgtaggcatgataagacgc	Protospacer
*....  * *** *******************.**********

46. spacer 3.1|703685|43|CP025840|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.791 

caattgccggatgcggcacaagtttgtaggcacgataagacgc	CRISPR spacer
cggcctaccgatccggcacaagtttgtaggcatgataagacgc	Protospacer
*....  * *** *******************.**********

47. spacer 3.1|703685|43|CP025840|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.791 

caattgccggatgcggcacaagtttgtaggcacgataagacgc	CRISPR spacer
cggcctaccgatccggcacaagtttgtaggcatgataagacgc	Protospacer
*....  * *** *******************.**********

48. spacer 3.1|703685|43|CP025840|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.791 

caattgccggatgcggcacaagtttgtaggcacgataagacgc	CRISPR spacer
cggcctaccgatccggcacaagtttgtaggcatgataagacgc	Protospacer
*....  * *** *******************.**********

49. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tgattgccggatgcggcgtaaacgccttatccggccta	Protospacer
*...**.**********.**************..**..

50. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ctggtgccggatgcggcgtaaacgccttatccggccta	Protospacer
. * **.**********.**************..**..

51. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

52. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

53. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

54. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cgactgccggatgcggcgtaaacgccttatccggccta	Protospacer
...***.**********.**************..**..

55. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

56. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aaaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
 *. **.**********.**************..**..

57. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caagtgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

58. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caattgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*..**.**********.**************..**..

59. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ttcttgccggatgcggcgtaaacgccttatccggccta	Protospacer
*  .**.**********.**************..**..

60. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccactgccggatgcggcgtaaacgccttatccgtccta	Protospacer
. .***.**********.**************. **..

61. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
tttatgccggatgcggcgtaaacgccttatccggccta	Protospacer
*   **.**********.**************..**..

62. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to MT230112 (Escherichia coli strain DH5alpha plasmid pESBL112, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
atgttgccggatgcggcgtaaacgccttatccggccta	Protospacer
  *.**.**********.**************..**..

63. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023207 (Escherichia coli strain TUM18781 plasmid pMTY18781-2, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatccggccta	Protospacer
.*. **.**********.**************..**..

64. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
cggttgccggatgcggcgtaaacgccttatccggccta	Protospacer
..*.**.**********.**************..**..

65. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 9, identity: 0.763 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
gacttgccggatgcggcgtaaacgccttatccggccac	Protospacer
 * .**.**********.**************..**

66. spacer 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046574 (Rhodococcus sp. WAY2 plasmid pRWAY02, complete sequence) position: , mismatch: 9, identity: 0.719 

attattaattctggtggcgctggtcgccctgg	CRISPR spacer
ggtcggctttctggtcgcgctggtcgcgctgg	Protospacer
. *     ******* *********** ****

67. spacer 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 9, identity: 0.719 

attattaattctggtggcgctggtcgccctgg	CRISPR spacer
cgtccccactctggtcgccctggtcgccctgg	Protospacer
  * .. *.****** ** *************

68. spacer 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719 

attattaattctggtggcgctggtcgccctgg	CRISPR spacer
gattctgggtctggtggcgctggtggcgctgg	Protospacer
. * .*.. *************** ** ****

69. spacer 6.6|2901686|32|CP025840|PILER-CR,CRISPRCasFinder matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 9, identity: 0.719 

gcgatctcgcggaatacaccgacgaggcgggc	CRISPR spacer
cgcacgtcgcggattacatcgacgaggcggta	Protospacer
   *. ******* ****.***********

70. spacer 6.7|2901747|32|CP025840|PILER-CR,CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

taaggccgtcgccggatcagcctggctatgcc	CRISPR spacer
cggggccgtcgccggatcagccggtctgctgc	Protospacer
...******************* * **..  *

71. spacer 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT matches to NC_047954 (Pseudomonas phage Njord, complete genome) position: , mismatch: 9, identity: 0.719 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggccgaggc	Protospacer
******** ************** ..*.

72. spacer 11.3|5076160|33|CP025840|CRISPRCasFinder,CRT matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.727 

gttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
gttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
**************.* ******** ..*..

73. spacer 11.5|5076161|32|CP025840|PILER-CR matches to MN855903 (Myoviridae sp. isolate 490, partial genome) position: , mismatch: 9, identity: 0.719 

ttcgctgcaaccgctagccaagacggtaggtt	CRISPR spacer
ttcgctgcaaccgttcgccaagaccacaaagg	Protospacer
*************.* ******** ..*..

74. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP044308 (Escherichia coli strain C27A plasmid pC27A-3, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
ccattgccggatgcggcgtaaacgccttatccggccta	Protospacer
. ..**.**********.**************..**..

75. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP053046 (Escherichia fergusonii strain HNCF11W plasmid pHNCF11W-130kb, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
aggttgccggatgcggcgtaaacgccttatccggcata	Protospacer
 .*.**.**********.**************..* ..

76. spacer 4.1|949209|38|CP025840|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 10, identity: 0.737 

tagctgtcggatgcggcataaacgccttatccaacccg	CRISPR spacer
caaatgccggatgcggcgtaaacgccttatctggccta	Protospacer
.*. **.**********.*************...**..

77. spacer 5.2|2899848|32|CP025840|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 10, identity: 0.688 

attattaattctggtggcgctggtcgccctgg	CRISPR spacer
gctgacccatctgggggcgctggtcgcgctgg	Protospacer
..*. .   ***** ************ ****

78. spacer 7.12|2929013|32|CP025840|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggcacggaattgttatgctgttcccctgaccg	CRISPR spacer
tcttcggaattgccatgctgttccccttccat	Protospacer
  . ********..*************  *

79. spacer 7.14|2929135|32|CP025840|CRISPRCasFinder,CRT matches to NZ_CP021914 (Sagittula sp. P11 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ggcgagtccgtcagcggtgcgccgctgcaaca	CRISPR spacer
ttggagtccgacatcggtgcgccgcttttcga	Protospacer
   ******* ** ************ .   *

80. spacer 7.16|2929257|32|CP025840|CRISPRCasFinder,CRT matches to NC_047894 (Pseudomonas phage uligo, complete genome) position: , mismatch: 10, identity: 0.688 

gacgcactggatgcgatgatggatatcacttg	CRISPR spacer
gacgcactcgatgcgatgatggaggcagaagc	Protospacer
******** ************** .. .

81. spacer 6.2|2901442|32|CP025840|PILER-CR,CRISPRCasFinder matches to NZ_CP014527 (Haematospirillum jordaniae strain H5569 plasmid unnamed 2, complete sequence) position: , mismatch: 11, identity: 0.656 

gaccagagatgtcgtagccgtatttcgcagcc	CRISPR spacer
cctcagacgtgtcgtagccgtatttcttgaat	Protospacer
  .**** .***************** ... .

82. spacer 8.1|3466934|56|CP025840|CRISPRCasFinder matches to NZ_AP023208 (Escherichia coli strain TUM18781 plasmid pMTY18781-3, complete sequence) position: , mismatch: 11, identity: 0.804 

tgcatccggtacccggagcctgatgcgacgctggcgcgtcttatcaggcctacaaa	CRISPR spacer
aggctccgacgttcggtgcctgatgcgacgctggcgcgtcttatcaggcctacgag	Protospacer
 *  ****.....*** ************************************.*.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage