1. spacer 1.1|338424|40|CP025920|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 4.1|1466878|42|CP025920|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0
tgtcacacgcagataaatccaactttcaatattgttaagttc CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc Protospacer
******************************************
3. spacer 4.2|1466937|40|CP025920|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0
catggcgtagaaaaaagaaattttcaatattgctttatgg CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg Protospacer
****************************************
4. spacer 8.1|4652048|38|CP025920|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
5. spacer 7.5|3465486|32|CP025920|CRT matches to LC542972 (Escherichia coli IOMTU792 plasmid pIOMTU792 DNA, complete sequence) position: , mismatch: 3, identity: 0.906
ggcgcactggatgcgatgatggatatcactta CRISPR spacer
gacgcactggatgcgatgatggacatcacttg Protospacer
*.*********************.*******.
6. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 5, identity: 0.844
--tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
agtcg--gcggtgagcgcggcgtcgctcaggatg Protospacer
*** ******.***********.*******
7. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 6, identity: 0.812
tcggtg-cggtgggcgcggcgtcgttcaggatc CRISPR spacer
-cgtcgtcggtggtctcggcgtcgttcaggatg Protospacer
** .* ****** * ****************
8. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 7, identity: 0.781
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
tggcgacggtgggcgcggcctcgtccaggagc Protospacer
* * .************* ****.***** *
9. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 7, identity: 0.781
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
ccagtccggcgggcgcggcgtcgttctcgaac Protospacer
.*.** ***.**************** ** *
10. spacer 6.8|3439308|32|CP025920|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
gacgccggcgccgcgatgccgttcgccgggtt Protospacer
******* ******** ******. * . ***
11. spacer 6.14|3439186|34|CP025920|PILER-CR matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 7, identity: 0.794
tcggtgcggtgggcgcggcgtcgttcaggatcgt-- CRISPR spacer
gcggtgcggtgggcgcgtcgtcgctc--tatcatct Protospacer
**************** *****.** ***.*
12. spacer 7.5|3465486|32|CP025920|CRT matches to NZ_CP015038 (Burkholderia cenocepacia strain 895 plasmid pBcp895-1, complete sequence) position: , mismatch: 7, identity: 0.781
ggcgcactggatgcgatgatggat-atcactta CRISPR spacer
ggcgcactggctgcgatgaaggacgatcaacc- Protospacer
********** ******** ***. **** ..
13. spacer 6.1|3438881|32|CP025920|CRISPRCasFinder,CRT matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 8, identity: 0.75
acaaatgacactgagtgaaaagcagcagcgat CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt Protospacer
***** ************.*****.* *
14. spacer 6.1|3438881|32|CP025920|CRISPRCasFinder,CRT matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 8, identity: 0.75
acaaatgacactgagtgaaaagcagcagcgat CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt Protospacer
***** ************.*****.* *
15. spacer 6.1|3438881|32|CP025920|CRISPRCasFinder,CRT matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 8, identity: 0.75
acaaatgacactgagtgaaaagcagcagcgat CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttt Protospacer
***** ************.*****.* *
16. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 8, identity: 0.75
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttc Protospacer
* *. ******** *********** ***
17. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP029831 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed7, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
18. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
tcgccgcggtgggcgcggcgtcgtatcggtcg Protospacer
*** .******************* . ** .
19. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg Protospacer
*.* ***.*** *************** *
20. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
tgggtgcgctgggcgcggcctcgttgtcggtg Protospacer
* ****** ********** ***** *.*
21. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcaag Protospacer
*.*.***.*** *************** *
22. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg Protospacer
*.* ***.*** *************** *
23. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg Protospacer
*.* ***.*** *************** *
24. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP040820 (Paraoceanicella profunda strain D4M1 plasmid pD4M1B, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
25. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
26. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NC_013857 (Azospirillum sp. B510 plasmid pAB510c, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagggcgatggccgcggcgtcgttcagcagg Protospacer
*.* ***.*** *************** *
27. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
28. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP054616 (Azospirillum oryzae strain KACC 14407 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
29. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
30. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
acagcgcgatggccgcggcgtcgttcagcagg Protospacer
*.*.***.*** *************** *
31. spacer 6.7|3439247|32|CP025920|CRISPRCasFinder,CRT matches to MK814759 (Gordonia phage Reyja, complete genome) position: , mismatch: 8, identity: 0.75
gagcctgacgagactactgaggccgttctgtc- CRISPR spacer
aagcctgacgaggctactggggcca-gcggtgg Protospacer
.***********.******.****. * **
32. spacer 6.8|3439308|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
gtcgccgccgccgcgcagccctttccacagcc Protospacer
* ************* **** *****. *..
33. spacer 6.14|3439186|34|CP025920|PILER-CR matches to NZ_CP044424 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN1, complete sequence) position: , mismatch: 8, identity: 0.765
tcggtg-cggtgggcgcggcgtcgttcaggatcgt CRISPR spacer
-cgtcgtcggtggtctcggcgtcgttcaggatgtc Protospacer
** .* ****** * **************** .
34. spacer 7.1|3465242|32|CP025920|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 8, identity: 0.75
gtttaccgccccgcagaggcgctggcagatcc CRISPR spacer
catcatcctcccgcagatgcgctggccgatcc Protospacer
*.*.* .******** ******** *****
35. spacer 7.3|3465364|32|CP025920|PILER-CR,CRISPRCasFinder,CRT matches to MK448454 (Streptococcus satellite phage Javan361, complete genome) position: , mismatch: 8, identity: 0.75
tccgtttggtccaccaaatgtttgatgcttca CRISPR spacer
tcttatcaatccaccaaatttttgattcttca Protospacer
**. *...********** ****** *****
36. spacer 7.5|3465486|32|CP025920|CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 8, identity: 0.75
ggcgcactggatgcgatgatggata---tcactta CRISPR spacer
ggcgcactggaagcggtgatggaggggcgcac--- Protospacer
*********** ***.******* . ***
37. spacer 6.3|3439003|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ccgatcacacgctcccacgggccgtaccagtc CRISPR spacer
ttcggcagccgctcccaccggccggaccagtc Protospacer
.. . ** ********* ***** *******
38. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
39. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
40. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
41. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
42. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
43. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
44. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
45. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
46. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
47. spacer 6.4|3439064|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 9, identity: 0.719
atgatttttgcacgacgttcaaccggcgtttc CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttc Protospacer
*. ******** *********** ***
48. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
gcggtgcggtgggcgcgtcgtcgctctatcat Protospacer
**************** *****.** . .
49. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
tcggtgcggtgtgcgcggcggcggcggcggac Protospacer
*********** ******** ** . . *. *
50. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to AP021850 (Deinococcus grandis ATCC 43672 plasmid: pDEGR-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
aggtcgtggtgggcgcggcgtcctgcaggaag Protospacer
* .*.*************** * *****
51. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP020539 (Sphingobium herbicidovorans strain MH plasmid pMSHV, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
ggggtgcgggcggcgcggcgtcgttggtgact Protospacer
******* ************** . **..
52. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP014519 (Sinomonas atrocyanea strain KCTC 3377 plasmid pSA01, complete sequence) position: , mismatch: 9, identity: 0.719
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
gcaatgccgtgggcgcgccgtcgttcatggga Protospacer
*..*** ********* ********* *.
53. spacer 6.6|3439186|32|CP025920|CRISPRCasFinder,CRT matches to MH834603 (Arthrobacter phage Bridgette, complete genome) position: , mismatch: 9, identity: 0.719
tcggtgcggtgggcgcggcgtcgttcaggatc CRISPR spacer
tcgcttcggtgggcgcggcgtcgagggggccg Protospacer
*** * ***************** .** .
54. spacer 6.8|3439308|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
gaagccgccgccgcgaacccgtttttcccggg Protospacer
** ************** ******.. .*
55. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_KY433363 (Proteus mirabilis strain R997 plasmid pR997, complete sequence) position: , mismatch: 9, identity: 0.735
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
ctccatcatgcacgaccttcaaccggcggttcga Protospacer
* *. ******** *********** ****
56. spacer 6.14|3439186|34|CP025920|PILER-CR matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.735
tcggtgcggtgggcgcggcgtcgttcaggatcgt CRISPR spacer
tggcgacggtgggcgcggcctcgtccaggagctg Protospacer
* * .************* ****.***** *
57. spacer 6.14|3439186|34|CP025920|PILER-CR matches to MH155873 (Microbacterium phage Paschalis, complete genome) position: , mismatch: 9, identity: 0.735
tcggtgcggtgggcgcggcgtcgttcaggatcgt CRISPR spacer
tcgccgcggtgggcgcggcgtcgtatcggtcgct Protospacer
*** .******************* . ** . *
58. spacer 7.1|3465242|32|CP025920|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040723 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
gtttaccgccccgcagaggcgctggcagatcc CRISPR spacer
cgagaccgcctcgccgaggcgctggcagcgac Protospacer
******.*** ************* *
59. spacer 7.5|3465486|32|CP025920|CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
ggcgcactggatgcgatgatggatatcactta CRISPR spacer
ggcgcactggaaccgatgatggatgcgatgag Protospacer
*********** ***********.. *. .
60. spacer 6.8|3439308|32|CP025920|CRISPRCasFinder,CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgccgccgccgcgaagccgtttccgatgtt CRISPR spacer
ttgcccgccgcggcgaagccgcttccgtcctc Protospacer
******* *********.***** . *.
61. spacer 6.9|3438881|34|CP025920|PILER-CR matches to MK972713 (Salmonella phage SW5, complete genome) position: , mismatch: 10, identity: 0.706
acaaatgacactgagtgaaaagcagcagcgatgt CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc Protospacer
***** ************.*****.* * .
62. spacer 6.9|3438881|34|CP025920|PILER-CR matches to MK972714 (Salmonella phage SW3, complete genome) position: , mismatch: 10, identity: 0.706
acaaatgacactgagtgaaaagcagcagcgatgt CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc Protospacer
***** ************.*****.* * .
63. spacer 6.9|3438881|34|CP025920|PILER-CR matches to NC_049460 (Salmonella phage SI7, complete genome) position: , mismatch: 10, identity: 0.706
acaaatgacactgagtgaaaagcagcagcgatgt CRISPR spacer
cgcaatgaaactgagtgaaaaacagcaacttttc Protospacer
***** ************.*****.* * .
64. spacer 6.11|3439003|34|CP025920|PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
ccgatcacacgctcccacgggccgtaccagtcgt CRISPR spacer
ttcggcagccgctcccaccggccggaccagtcga Protospacer
.. . ** ********* ***** ********
65. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP018638 (Salmonella enterica subsp. enterica serovar Enteritidis strain 69-3861 plasmid pSE69-3861-1, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
66. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP045203 (Citrobacter sp. NMI7904_11 plasmid pCTEL-2, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
67. spacer 6.12|3439064|34|CP025920|PILER-CR matches to CP033526 (Acinetobacter pittii strain 2014N05-125 plasmid p2014N05-125-1, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
68. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_KX528687 (Acinetobacter lwoffii strain ED9-5a plasmid pALWED3.1, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
69. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP031977 (Acinetobacter haemolyticus strain AN43 plasmid pAhaemAN43b, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
70. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP031973 (Acinetobacter haemolyticus strain AN59 plasmid pAhaemAN59c, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
71. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP021429 (Acinetobacter pittii strain HUMV-6483 plasmid p11, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
72. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP040913 (Acinetobacter pittii strain AB17H194 plasmid pAB17H194-2, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
73. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP030755 (Acinetobacter schindleri strain H3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
caccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
74. spacer 6.12|3439064|34|CP025920|PILER-CR matches to NZ_CP025619 (Acinetobacter schindleri strain SGAir0122 plasmid pSGAir0122, complete sequence) position: , mismatch: 10, identity: 0.706
atgatttttgcacgacgttcaaccggcgtttcgt CRISPR spacer
cgccgtcatgcacgaccttcaaccggcggttcga Protospacer
*. ******** *********** ****
