Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025859 Escherichia coli strain 504239 chromosome, complete genome 6 crisprs NA 0 22 0 0
CP025860 Escherichia coli strain 504239 plasmid p504239_101, complete sequence 0 crisprs NA 0 0 0 0
CP025861 Escherichia coli strain 504239 plasmid p504239_155, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP025859
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025859_1 1705673-1706372 Orphan I-E
11 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025859_2 1728031-1728304 Orphan I-E
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025859_3 2172532-2172671 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025859_4 3707562-3707691 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025859_5 4639167-4639315 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025859_6 4781658-4781749 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11835-11866 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42178 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36520-36551 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1588 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9506-9537 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94787 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65534-65565 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61947 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64165-64196 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20317 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119284-119315 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85099-85130 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46719 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42116-42147 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87237-87268 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81884 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70500-70531 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47892 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62997-63028 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 MH422554 Escherichia phage P1, complete genome 87194-87225 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NC_050152 Enterobacteria phage P7, complete genome 93995-94026 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58645-58676 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NC_031129 Salmonella phage SJ46, complete genome 77363-77394 0 1.0
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 MH445381 Escherichia virus P1, complete genome 56870-56901 0 1.0
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP038506 Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence 11833-11866 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 CP042641 Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence 36518-36551 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP027443 Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence 9504-9537 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP027223 Escherichia coli strain 2015C-3101 plasmid unnamed2 65532-65565 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP027590 Escherichia coli strain 2014C-3011 plasmid unnamed2 64163-64196 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP033632 Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence 119282-119315 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_AP018798 Escherichia coli strain E2855 plasmid pE2855-2, complete sequence 85097-85130 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 CP027320 Escherichia coli strain 2014C-3084 plasmid unnamed1 42114-42147 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NC_013370 Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence 87235-87268 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 MN510445 Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence 70498-70531 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP012491 Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence 62995-63028 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 MH422554 Escherichia phage P1, complete genome 87192-87225 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NC_050152 Enterobacteria phage P7, complete genome 93993-94026 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 MH445380 Escherichia virus P1 isolate transconjugant 2(L-II), complete genome 58643-58676 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 MH445381 Escherichia virus P1, complete genome 56868-56901 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP019283 Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence 42147-42180 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP034821 Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence 1557-1590 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP027575 Escherichia coli strain 2013C-4081 plasmid unnamed2 94756-94789 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP030188 Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence 61916-61949 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP039862 Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence 20286-20319 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 CP012494 Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence 46688-46721 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP026475 Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence 81853-81886 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 MN510447 Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence 47861-47894 1 0.971
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NC_031129 Salmonella phage SJ46, complete genome 77363-77396 1 0.971
CP025859_6 6.1|4781684|40|CP025859|CRISPRCasFinder 4781684-4781723 40 NZ_CP041417 Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence 47951-47990 1 0.975
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17440-17471 2 0.938
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122310-122341 2 0.938
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6029-6060 2 0.938
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15152 2 0.938
CP025859_1 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder 1705702-1705733 32 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131402-131433 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP023851 Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence 71166-71197 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP048306 Escherichia coli strain 9 plasmid p009_B, complete sequence 71579-71610 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP041423 Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence 57771-57802 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP019013 Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence 49237-49268 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP022167 Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence 80644-80675 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP019027 Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence 43940-43971 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP031136 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence 30387-30418 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_MH257954 Escherichia coli strain 104 plasmid pHXH-2, complete sequence 71853-71884 2 0.938
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 CP053388 Escherichia phage CMS-2020a, complete sequence 69160-69191 2 0.938
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_KP453775 Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence 17438-17471 3 0.912
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP017632 Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence 122308-122341 3 0.912
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP030285 Escherichia coli strain E308 plasmid pLKSZ04, complete sequence 6027-6060 3 0.912
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 MN510446 Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence 131400-131433 3 0.912
CP025859_1 1.12|1705700|34|CP025859|CRT 1705700-1705733 34 NZ_CP036204 Escherichia coli strain L725 plasmid punnamed2, complete sequence 15121-15154 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP041423 Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence 57769-57802 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP019013 Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence 49235-49268 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP031136 Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence 30385-30418 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP023851 Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence 71166-71199 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP048306 Escherichia coli strain 9 plasmid p009_B, complete sequence 71579-71612 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP022167 Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence 80644-80677 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_CP019027 Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence 43940-43973 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 NZ_MH257954 Escherichia coli strain 104 plasmid pHXH-2, complete sequence 71853-71886 3 0.912
CP025859_1 1.13|1705761|34|CP025859|CRT 1705761-1705794 34 CP053388 Escherichia phage CMS-2020a, complete sequence 69160-69193 3 0.912
CP025859_1 1.4|1705885|32|CP025859|PILER-CR,CRISPRCasFinder 1705885-1705916 32 NZ_CP011408 Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence 35508-35539 5 0.844
CP025859_1 1.9|1706190|32|CP025859|PILER-CR,CRISPRCasFinder 1706190-1706221 32 KY709687 Salmonella phage 29485, complete genome 35709-35740 5 0.844
CP025859_1 1.4|1705885|32|CP025859|PILER-CR,CRISPRCasFinder 1705885-1705916 32 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 31692-31723 6 0.812
CP025859_1 1.15|1705883|34|CP025859|CRT 1705883-1705916 34 NZ_CP011408 Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence 35508-35541 6 0.824
CP025859_1 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder 1705824-1705855 32 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 897526-897557 7 0.781
CP025859_1 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder 1705824-1705855 32 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 585720-585751 7 0.781
CP025859_1 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder 1705824-1705855 32 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 89866-89897 7 0.781
CP025859_1 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder 1705824-1705855 32 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 97239-97270 7 0.781
CP025859_1 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder 1705824-1705855 32 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 75914-75945 7 0.781
CP025859_1 1.6|1706007|32|CP025859|PILER-CR,CRISPRCasFinder 1706007-1706038 32 NC_010625 Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence 591278-591309 7 0.781
CP025859_2 2.1|1728060|32|CP025859|CRISPRCasFinder 1728060-1728091 32 KR080197 Mycobacterium phage FlagStaff, complete genome 15476-15507 7 0.781
CP025859_2 2.5|1728061|31|CP025859|CRT 1728061-1728091 31 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15448 7 0.774
CP025859_2 2.5|1728061|31|CP025859|CRT 1728061-1728091 31 KR080197 Mycobacterium phage FlagStaff, complete genome 15477-15507 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 127434-127464 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 59382-59412 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 601367-601397 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 461796-461826 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 186549-186579 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 108756-108786 7 0.774
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 118435-118465 7 0.774
CP025859_3 3.1|2172581|42|CP025859|CRISPRCasFinder 2172581-2172622 42 NZ_CP010208 Escherichia coli strain M11 plasmid B, complete sequence 30214-30255 7 0.833
CP025859_1 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder 1705824-1705855 32 NZ_CP011054 Halomonas sp. KO116 plasmid unnamed2, complete sequence 177867-177898 8 0.75
CP025859_1 1.5|1705946|32|CP025859|PILER-CR,CRISPRCasFinder 1705946-1705977 32 MK448716 Streptococcus phage Javan249, complete genome 4713-4744 8 0.75
CP025859_1 1.6|1706007|32|CP025859|PILER-CR,CRISPRCasFinder 1706007-1706038 32 NZ_CP013104 Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence 1996455-1996486 8 0.75
CP025859_1 1.6|1706007|32|CP025859|PILER-CR,CRISPRCasFinder 1706007-1706038 32 NZ_CP012748 Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence 265562-265593 8 0.75
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 NC_021623 Borrelia hermsii strain HS1 plasmid lp174, complete sequence 13769-13800 8 0.75
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 NZ_CP014350 Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence 13895-13926 8 0.75
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250026 Prevotella phage Lak-B7, complete genome 196640-196671 8 0.75
CP025859_1 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder 1706312-1706343 32 AP014205 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C77-MedDCM-OCT-S35-C75, *** SEQUENCING IN PROGRESS *** 7009-7040 8 0.75
CP025859_1 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder 1706312-1706343 32 MT446405 UNVERIFIED: Escherichia virus TH32, complete genome 32230-32261 8 0.75
CP025859_1 1.15|1705883|34|CP025859|CRT 1705883-1705916 34 NZ_CP054046 Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence 31692-31725 8 0.765
CP025859_2 2.1|1728060|32|CP025859|CRISPRCasFinder 1728060-1728091 32 NZ_CP014600 Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence 15418-15449 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NC_004808 Streptomyces rochei plasmid pSLA2-L DNA, complete sequence 127433-127464 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP013856 Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence 59381-59412 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP024427 Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence 108756-108787 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP020443 Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence 118435-118466 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_AP014579 Burkholderia sp. RPE67 plasmid p1, complete sequence 601366-601397 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 MN842294 Leclercia adecarboxylata strain G426 plasmid pG426-FII, complete sequence 41427-41458 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NC_016626 Burkholderia sp. YI23 plasmid byi_1p, complete sequence 461795-461826 8 0.75
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP044079 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence 186548-186579 8 0.75
CP025859_2 2.5|1728061|31|CP025859|CRT 1728061-1728091 31 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139211-139241 8 0.742
CP025859_2 2.5|1728061|31|CP025859|CRT 1728061-1728091 31 NZ_CP020540 Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence 4021-4051 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_AP022339 Mameliella alba strain KU6B plasmid pKUB112, complete sequence 34769-34799 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 226168-226198 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 34930-34960 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 717467-717497 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 73269-73299 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 MN842294 Leclercia adecarboxylata strain G426 plasmid pG426-FII, complete sequence 41428-41458 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 279376-279406 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 389308-389338 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 523058-523088 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1790429-1790459 8 0.742
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1743056-1743086 8 0.742
CP025859_3 3.1|2172581|42|CP025859|CRISPRCasFinder 2172581-2172622 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24899-24940 8 0.81
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 NZ_CP011009 Bacillus simplex strain SH-B26 plasmid pSHB26, complete sequence 147371-147402 9 0.719
CP025859_1 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder 1705763-1705794 32 MN693961 Marine virus AFVG_250M531, complete genome 39943-39974 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 NZ_CP031818 Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence 213555-213586 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 NZ_CP026186 Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence 231247-231278 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250021 Prevotella phage Lak-B2, complete genome 197456-197487 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250024 Prevotella phage Lak-B5, complete genome 191466-191497 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250028 Prevotella phage Lak-B9, complete genome 196349-196380 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250023 Prevotella phage Lak-B4, complete genome 197358-197389 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250025 Prevotella phage Lak-B6, complete genome 194659-194690 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250022 Prevotella phage Lak-B3, complete genome 194674-194705 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250027 Prevotella phage Lak-B8, complete genome 197569-197600 9 0.719
CP025859_1 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder 1706251-1706282 32 MK250020 Prevotella phage Lak-B1, complete genome 196329-196360 9 0.719
CP025859_1 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder 1706312-1706343 32 MN694097 Marine virus AFVG_250M464, complete genome 14848-14879 9 0.719
CP025859_1 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder 1706312-1706343 32 NZ_CP033873 Caulobacter sp. FWC26 plasmid p1, complete sequence 227045-227076 9 0.719
CP025859_1 1.14|1705822|34|CP025859|CRT 1705822-1705855 34 NC_009620 Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence 897526-897559 9 0.735
CP025859_1 1.14|1705822|34|CP025859|CRT 1705822-1705855 34 NZ_LR594660 Variovorax sp. PBL-H6 plasmid 2 585718-585751 9 0.735
CP025859_1 1.14|1705822|34|CP025859|CRT 1705822-1705855 34 NZ_CP021367 Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence 89864-89897 9 0.735
CP025859_1 1.14|1705822|34|CP025859|CRT 1705822-1705855 34 NZ_CP021649 Acidovorax sp. T1 plasmid p1-T1, complete sequence 97237-97270 9 0.735
CP025859_1 1.14|1705822|34|CP025859|CRT 1705822-1705855 34 NZ_CP021363 Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence 75912-75945 9 0.735
CP025859_1 1.16|1705944|34|CP025859|CRT 1705944-1705977 34 MK448716 Streptococcus phage Javan249, complete genome 4713-4746 9 0.735
CP025859_1 1.22|1706310|34|CP025859|CRT 1706310-1706343 34 AP014205 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C77-MedDCM-OCT-S35-C75, *** SEQUENCING IN PROGRESS *** 7009-7042 9 0.735
CP025859_2 2.1|1728060|32|CP025859|CRISPRCasFinder 1728060-1728091 32 NZ_CP009292 Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence 139210-139241 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP040819 Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence 226168-226199 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP018077 Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence 34930-34961 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 523058-523089 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NC_014309 Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome 1790429-1790460 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP026093 Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence 717466-717497 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 126189-126220 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP011523 Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence 73268-73299 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP032340 Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence 1743056-1743087 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP054621 Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence 279375-279406 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP012915 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence 389307-389338 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 MN369739 Mycobacterium phage Kenuha5, complete genome 42566-42597 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 KU935731 Mycobacterium phage Phrann, complete genome 38757-38788 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 KT309034 Mycobacterium phage Dante, complete genome 45038-45069 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NC_021538 Mycobacterium phage Job42, complete genome 45995-46026 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 KM083128 Mycobacterium phage Sparky, complete genome 46706-46737 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 KM347889 Mycobacterium phage BuzzLyseyear, complete genome 44876-44907 9 0.719
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 KX808131 Mycobacterium phage SuperGrey, complete genome 45743-45774 9 0.719
CP025859_2 2.5|1728061|31|CP025859|CRT 1728061-1728091 31 NZ_CP020910 Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence 44721-44751 9 0.71
CP025859_2 2.5|1728061|31|CP025859|CRT 1728061-1728091 31 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14131-14161 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1469220-1469250 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 MN369739 Mycobacterium phage Kenuha5, complete genome 42567-42597 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 KU935731 Mycobacterium phage Phrann, complete genome 38758-38788 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 KT309034 Mycobacterium phage Dante, complete genome 45039-45069 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NC_021538 Mycobacterium phage Job42, complete genome 45996-46026 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 KM083128 Mycobacterium phage Sparky, complete genome 46707-46737 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 KM347889 Mycobacterium phage BuzzLyseyear, complete genome 44877-44907 9 0.71
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 KX808131 Mycobacterium phage SuperGrey, complete genome 45744-45774 9 0.71
CP025859_3 3.1|2172581|42|CP025859|CRISPRCasFinder 2172581-2172622 42 NZ_CP048307 Escherichia coli strain 9 plasmid p009_C, complete sequence 24786-24827 9 0.786
CP025859_1 1.7|1706068|32|CP025859|PILER-CR,CRISPRCasFinder 1706068-1706099 32 NZ_CP043499 Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence 370002-370033 10 0.688
CP025859_1 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder 1706312-1706343 32 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 13607-13638 10 0.688
CP025859_1 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder 1706312-1706343 32 NZ_CP014853 Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence 224128-224159 10 0.688
CP025859_1 1.22|1706310|34|CP025859|CRT 1706310-1706343 34 MN694097 Marine virus AFVG_250M464, complete genome 14848-14881 10 0.706
CP025859_2 2.1|1728060|32|CP025859|CRISPRCasFinder 1728060-1728091 32 NZ_CP012383 Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence 14130-14161 10 0.688
CP025859_2 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR 1728243-1728274 32 NZ_CP054028 Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence 1469219-1469250 10 0.688
CP025859_2 2.8|1728244|31|CP025859|CRT 1728244-1728274 31 NZ_CP040764 Paracoccus sp. 2251 plasmid unnamed3, complete sequence 126190-126220 10 0.677
CP025859_1 1.22|1706310|34|CP025859|CRT 1706310-1706343 34 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 13607-13640 12 0.647

1. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

2. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

3. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

4. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

5. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

6. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

7. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

8. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

9. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

10. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

11. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

12. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

13. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

14. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

15. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

16. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

17. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

18. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

19. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

20. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

21. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

22. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

23. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

24. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 0, identity: 1.0 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaccgtgtttttacc	Protospacer
********************************

25. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP038506 (Escherichia coli strain 28Eco12 plasmid p28Eco12, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

26. spacer 1.12|1705700|34|CP025859|CRT matches to CP042641 (Escherichia coli strain NCYU-24-74 plasmid pNCYU-24-74-3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

27. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP027443 (Escherichia coli strain 2013C-3252 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

28. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP027223 (Escherichia coli strain 2015C-3101 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

29. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP027590 (Escherichia coli strain 2014C-3011 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

30. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP033632 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb1, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

31. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_AP018798 (Escherichia coli strain E2855 plasmid pE2855-2, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

32. spacer 1.12|1705700|34|CP025859|CRT matches to CP027320 (Escherichia coli strain 2014C-3084 plasmid unnamed1) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

33. spacer 1.12|1705700|34|CP025859|CRT matches to NC_013370 (Escherichia coli O111:H- str. 11128 plasmid pO111_2, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

34. spacer 1.12|1705700|34|CP025859|CRT matches to MN510445 (Escherichia coli strain JIE250 plasmid pJIE250_3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

35. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP012491 (Escherichia coli strain CFSAN004176 plasmid pCFSAN004176P_03, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

36. spacer 1.12|1705700|34|CP025859|CRT matches to MH422554 (Escherichia phage P1, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

37. spacer 1.12|1705700|34|CP025859|CRT matches to NC_050152 (Enterobacteria phage P7, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

38. spacer 1.12|1705700|34|CP025859|CRT matches to MH445380 (Escherichia virus P1 isolate transconjugant 2(L-II), complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

39. spacer 1.12|1705700|34|CP025859|CRT matches to MH445381 (Escherichia virus P1, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

40. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP019283 (Escherichia coli strain 13P484A plasmid p13P484A-3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

41. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP034821 (Salmonella sp. SSDFZ54 plasmid pTB502, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

42. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP027575 (Escherichia coli strain 2013C-4081 plasmid unnamed2) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

43. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP030188 (Salmonella enterica strain SA20094620 plasmid pSA20094620.3, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

44. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP039862 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.2, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

45. spacer 1.12|1705700|34|CP025859|CRT matches to CP012494 (Escherichia coli strain CFSAN004177 plasmid pCFSAN004177G_03, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

46. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP026475 (Escherichia coli strain KBN10P04869 plasmid pKBN10P04869B, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

47. spacer 1.12|1705700|34|CP025859|CRT matches to MN510447 (Escherichia coli strain TZ20_1P plasmid pTZ20_1P, complete sequence) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

48. spacer 1.12|1705700|34|CP025859|CRT matches to NC_031129 (Salmonella phage SJ46, complete genome) position: , mismatch: 1, identity: 0.971 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaccgtgtttttacc	Protospacer
* ********************************

49. spacer 6.1|4781684|40|CP025859|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 1, identity: 0.975 

acagcacagcggggggaatttcaagaatgacccgcagcgc	CRISPR spacer
acagcacagcgggggtaatttcaagaatgacccgcagcgc	Protospacer
*************** ************************

50. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

51. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcagaacgtgttttcacc	Protospacer
******************* ********.***

52. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

53. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgacggtttagaccgtgtttttacc	Protospacer
********* *****.****************

54. spacer 1.1|1705702|32|CP025859|PILER-CR,CRISPRCasFinder matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 2, identity: 0.938 

acatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
acatgaatgtcggttcataacgtgtttttacc	Protospacer
***************** * ************

55. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP023851 (Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

56. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP048306 (Escherichia coli strain 9 plasmid p009_B, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

57. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP041423 (Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

58. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP019013 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

59. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP022167 (Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

60. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP019027 (Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

61. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP031136 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

62. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_MH257954 (Escherichia coli strain 104 plasmid pHXH-2, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

63. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to CP053388 (Escherichia phage CMS-2020a, complete sequence) position: , mismatch: 2, identity: 0.938 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
tttaaaagcatcagctaaataattgtagaaat	Protospacer
************************. ******

64. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_KP453775 (Klebsiella pneumoniae strain ST11 plasmid pKP12226, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaacgtgttttcacc	Protospacer
* ******************* ********.***

65. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP017632 (Escherichia coli strain SLK172 plasmid pSLK172-1, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcagaacgtgttttcacc	Protospacer
* ******************* ********.***

66. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP030285 (Escherichia coli strain E308 plasmid pLKSZ04, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgacggtttagaccgtgtttttacc	Protospacer
* ********* *****.****************

67. spacer 1.12|1705700|34|CP025859|CRT matches to MN510446 (Escherichia coli strain SvETEC plasmid pSvP1_F, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgtcggttcataacgtgtttttacc	Protospacer
* ***************** * ************

68. spacer 1.12|1705700|34|CP025859|CRT matches to NZ_CP036204 (Escherichia coli strain L725 plasmid punnamed2, complete sequence) position: , mismatch: 3, identity: 0.912 

acacatgaatgtcggttcagaccgtgtttttacc	CRISPR spacer
aaacatgaatgacggtttagaccgtgtttttacc	Protospacer
* ********* *****.****************

69. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP041423 (Escherichia coli strain STEC409 plasmid pSTEC409_1, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

70. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP019013 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_2, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

71. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP031136 (Escherichia coli strain CFSAN064035 plasmid pGMI17-003_2, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

72. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP023851 (Escherichia coli strain 4/0 plasmid p4_0.2, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

73. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP048306 (Escherichia coli strain 9 plasmid p009_B, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

74. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP022167 (Escherichia coli strain M160133 plasmid pM160133_p3, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

75. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_CP019027 (Escherichia coli strain Ecol_881 plasmid pEC881_2, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

76. spacer 1.13|1705761|34|CP025859|CRT matches to NZ_MH257954 (Escherichia coli strain 104 plasmid pHXH-2, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

77. spacer 1.13|1705761|34|CP025859|CRT matches to CP053388 (Escherichia phage CMS-2020a, complete sequence) position: , mismatch: 3, identity: 0.912 

actttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
gctttaaaagcatcagctaaataattgtagaaat	Protospacer
.*************************. ******

78. spacer 1.4|1705885|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP011408 (Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence) position: , mismatch: 5, identity: 0.844 

ttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
actccgaccgcgaaagactggaaaaccaatct	Protospacer
 . **.***** ********************

79. spacer 1.9|1706190|32|CP025859|PILER-CR,CRISPRCasFinder matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 5, identity: 0.844 

tcacgccta---aatgcccggcaaatacatctgca	CRISPR spacer
---tgcctacacaatgccaggcaaatacatctgca	Protospacer
   .*****   ****** ****************

80. spacer 1.4|1705885|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812 

ttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
aacccgaccgccaaagactggaaaaccaactt	Protospacer
   **.***********************..*

81. spacer 1.15|1705883|34|CP025859|CRT matches to NZ_CP011408 (Vibrio parahaemolyticus strain FORC_014 plasmid pFORC14, complete sequence) position: , mismatch: 6, identity: 0.824 

acttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
tcactccgaccgcgaaagactggaaaaccaatct	Protospacer
 * . **.***** ********************

82. spacer 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
tcggctgaacagggagcgggataccggcgtaa	Protospacer
  ************** *** *******..*.

83. spacer 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

84. spacer 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

85. spacer 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

86. spacer 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 7, identity: 0.781 

gaggctgaacagggagggggctaccggcacag	CRISPR spacer
gggttcgcacagggaggtggccaccggcacag	Protospacer
*.* ..* ********* ***.**********

87. spacer 1.6|1706007|32|CP025859|PILER-CR,CRISPRCasFinder matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 7, identity: 0.781 

atcactc-tgactatcggcggcgtggatgtggt	CRISPR spacer
-ccacacatgactgtcgtcggcgtggatgtgac	Protospacer
 .*** * *****.*** *************..

88. spacer 2.1|1728060|32|CP025859|CRISPRCasFinder matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.781 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aacccggcgaacggcatcgcggcgccggcgtc	Protospacer
*** . * .****** ******** *******

89. spacer 2.5|1728061|31|CP025859|CRT matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.774 

acatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gctgtggaaagggctgcgcggcggcggcgac	Protospacer
.*  .***** **** ************* *

90. spacer 2.5|1728061|31|CP025859|CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 7, identity: 0.774 

acatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
acccggcgaacggcatcgcggcgccggcgtc	Protospacer
** . * .****** ******** *******

91. spacer 2.8|1728244|31|CP025859|CRT matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 7, identity: 0.774 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gcgacgacgccgagcccggtgacggccgcgc	Protospacer
.*. * ****** *********.*******

92. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 7, identity: 0.774 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgccgcgccgcgaccggtgatggccaccc	Protospacer
**  **.******* ************.*

93. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.774 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
atttccacgccgcgcacggcgatggcgacgg	Protospacer
*. ************ ***.****** .**.

94. spacer 2.8|1728244|31|CP025859|CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 7, identity: 0.774 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
atttccacgccgcgcacggcgatggcgacgg	Protospacer
*. ************ ***.****** .**.

95. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.774 

----acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cgcgacgt----gccgcgcccggcgctggccgcga	Protospacer
    **.*    ***********.* *********

96. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 7, identity: 0.774 

----acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cgcgacgt----gccgcgcccggcgctggccgcga	Protospacer
    **.*    ***********.* *********

97. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.774 

----acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cgcgacgt----gccgcgcccggcgctggccgcga	Protospacer
    **.*    ***********.* *********

98. spacer 3.1|2172581|42|CP025859|CRISPRCasFinder matches to NZ_CP010208 (Escherichia coli strain M11 plasmid B, complete sequence) position: , mismatch: 7, identity: 0.833 

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
gcgtaggccagataaggcgtttacgccgcatccggcatttgt	Protospacer
.******.*********.****************.*  .***

99. spacer 1.3|1705824|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP011054 (Halomonas sp. KO116 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggctgaacagggagggggctaccg---gcacag	CRISPR spacer
agagctgaacagggtgggggttaccgctcgca---	Protospacer
...*********** *****.*****   ***

100. spacer 1.5|1705946|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK448716 (Streptococcus phage Javan249, complete genome) position: , mismatch: 8, identity: 0.75 

ccacaatacaaaataacccagcg----accaggatt	CRISPR spacer
ccacaatacaaaatgatccagcgcaaagccaa----	Protospacer
**************.*.******    .***.

101. spacer 1.6|1706007|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75 

atcactctgactatcggcggcgtggatgtggt	CRISPR spacer
ggcgcggtgaagatcggcggcgtggatgtgtt	Protospacer
. *.*  ***  ****************** *

102. spacer 1.6|1706007|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75 

atcactctgactatcggcggcgtggatgtggt	CRISPR spacer
ggcgcggtgaagatcggcggcgtggatgtgct	Protospacer
. *.*  ***  ****************** *

103. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to NC_021623 (Borrelia hermsii strain HS1 plasmid lp174, complete sequence) position: , mismatch: 8, identity: 0.75 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
tatattgagtatgtgtttaatattatcagttt	Protospacer
 * *****.****** **********...**

104. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP014350 (Borrelia hermsii HS1 isolate Browne Mountain plasmid megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
tatattgagtatgtgtttaatattatcagttt	Protospacer
 * *****.****** **********...**

105. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250026 (Prevotella phage Lak-B7, complete genome) position: , mismatch: 8, identity: 0.75 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaagaaaagtatgttgttgatattattgattg	Protospacer
.**.  .*.***** ***.*************

106. spacer 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder matches to AP014205 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C77-MedDCM-OCT-S35-C75, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75 

aagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
ggaagggttttgtataagtaaagcattatttc	Protospacer
... * * ****** *** *************

107. spacer 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder matches to MT446405 (UNVERIFIED: Escherichia virus TH32, complete genome) position: , mismatch: 8, identity: 0.75 

aagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
gaaagagatttgtaaaaggcacgcattatttg	Protospacer
.*. * *.*********** * *********

108. spacer 1.15|1705883|34|CP025859|CRT matches to NZ_CP054046 (Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765 

acttgccaaccgccaaagactggaaaaccaatct	CRISPR spacer
ttaacccgaccgccaaagactggaaaaccaactt	Protospacer
 .   **.***********************..*

109. spacer 2.1|1728060|32|CP025859|CRISPRCasFinder matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ggctgtggaaagggctgcgcggcggcggcgac	Protospacer
..*  .***** **** ************* *

110. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NC_004808 (Streptomyces rochei plasmid pSLA2-L DNA, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ggcgacgacgccgagcccggtgacggccgcgc	Protospacer
..*. * ****** *********.*******

111. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP013856 (Pseudonocardia sp. HH130630-07 plasmid pLS2-2, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
caccgccgcgccgcgaccggtgatggccaccc	Protospacer
 **  **.******* ************.*

112. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP024427 (Paracoccus yeei strain TT13 plasmid pTT13-5, complete sequence) position: , mismatch: 8, identity: 0.75 

----aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgcgacgt----gccgcgcccggcgctggccgcga	Protospacer
    .**.*    ***********.* *********

113. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP020443 (Paracoccus yeei strain FDAARGOS_252 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75 

----aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgcgacgt----gccgcgcccggcgctggccgcga	Protospacer
    .**.*    ***********.* *********

114. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gatttccacgccgcgcacggcgatggcgacgg	Protospacer
.*. ************ ***.****** .**.

115. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to MN842294 (Leclercia adecarboxylata strain G426 plasmid pG426-FII, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
atgcgcaacgccgcgcccggcaatggccgcaa	Protospacer
*    * *************..********.*

116. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 8, identity: 0.75 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gatttccacgccgcgcacggcgatggcgacgg	Protospacer
.*. ************ ***.****** .**.

117. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75 

----aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgcgacgt----gccgcgcccggcgctggccgcga	Protospacer
    .**.*    ***********.* *********

118. spacer 2.5|1728061|31|CP025859|CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 8, identity: 0.742 

acatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
ccgggaaaaacgggttcgcggcggcggcttc	Protospacer
 *.  ..****** ************** **

119. spacer 2.5|1728061|31|CP025859|CRT matches to NZ_CP020540 (Sphingobium herbicidovorans strain MH plasmid pSHV1, complete sequence) position: , mismatch: 8, identity: 0.742 

acatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
actgtcgaaacggcttcgcggcagcggctga	Protospacer
**  . ****************.*****

120. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_AP022339 (Mameliella alba strain KU6B plasmid pKUB112, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cgatccacgccgcgcccggtcatgtcaggtc	Protospacer
  ****************** *** * *

121. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccatgcgcgccgcgcccggtgatggtgatgt	Protospacer
 *** *.******************. ..*

122. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gctgtcatgccgcgcccggtgatagccgcag	Protospacer
.*  .**.***************.*****..

123. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
agccgctcgccgcgcccggtgtcggccgcgc	Protospacer
*  . * ************** .*******

124. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gcctgggcgccgtgcccggtgatcgccgcgg	Protospacer
.* *  .*****.********** ******.

125. spacer 2.8|1728244|31|CP025859|CRT matches to MN842294 (Leclercia adecarboxylata strain G426 plasmid pG426-FII, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
tgcgcaacgccgcgcccggcaatggccgcaa	Protospacer
    * *************..********.*

126. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
agggcgacgccgagcccggcgatggccgcct	Protospacer
* . * ****** ******.*********

127. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgcgcacgccgcgcccggtgagcgccgaca	Protospacer
 *.. *****************  ****  *

128. spacer 2.8|1728244|31|CP025859|CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
aggcccgcgccgcgcccggtgatgtccaggg	Protospacer
* ..**.***************** **. *.

129. spacer 2.8|1728244|31|CP025859|CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
agccgctcgccgcgcccggtgtcggccgcgc	Protospacer
*  . * ************** .*******

130. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.742 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgcgcacgccgcgcccggtgagcgccgaca	Protospacer
 *.. *****************  ****  *

131. spacer 3.1|2172581|42|CP025859|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 8, identity: 0.81 

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaat	Protospacer
 .*******.*******.******************  * .*

132. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP011009 (Bacillus simplex strain SH-B26 plasmid pSHB26, complete sequence) position: , mismatch: 9, identity: 0.719 

tttaaaagcatcagctaaataattaaagaaat	CRISPR spacer
atgcggagcatcatctcaataattaaagataa	Protospacer
 *  ..******* ** ************ *

133. spacer 1.2|1705763|32|CP025859|PILER-CR,CRISPRCasFinder matches to MN693961 (Marine virus AFVG_250M531, complete genome) position: , mismatch: 9, identity: 0.719 

tttaaaagcatcagctaaataatt-----aaagaaat	CRISPR spacer
cttaactgcatcagctaaataattctttcata-----	Protospacer
.****  *****************     * *

134. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP031818 (Klebsiella pneumoniae strain INF235-sc-2280127 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
ctaacaccatatgtggttgatataattgatta	Protospacer
  **.   **********.**** *******.

135. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP026186 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-3967, complete sequence) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
ctaacaccatatgtggttgatataattgatta	Protospacer
  **.   **********.**** *******.

136. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250021 (Prevotella phage Lak-B2, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

137. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250024 (Prevotella phage Lak-B5, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

138. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250028 (Prevotella phage Lak-B9, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

139. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250023 (Prevotella phage Lak-B4, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

140. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250025 (Prevotella phage Lak-B6, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

141. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250022 (Prevotella phage Lak-B3, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

142. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250027 (Prevotella phage Lak-B8, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

143. spacer 1.10|1706251|32|CP025859|PILER-CR,CRISPRCasFinder matches to MK250020 (Prevotella phage Lak-B1, complete genome) position: , mismatch: 9, identity: 0.719 

gaaattgaatatgtggttaatattattgattg	CRISPR spacer
aaggaaaagtatgttgttgatattattgattg	Protospacer
.*..  .*.***** ***.*************

144. spacer 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder matches to MN694097 (Marine virus AFVG_250M464, complete genome) position: , mismatch: 9, identity: 0.719 

aagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
gagcgcggtttggaaaaggaaatcaatcccct	Protospacer
.*********** ********* ** * ....

145. spacer 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

aagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
atgggcgctttgcaaaaggaaagcattcagca	Protospacer
* * *** ****.**************   .

146. spacer 1.14|1705822|34|CP025859|CRT matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
ggtcggctgaacagggagcgggataccggcgtaa	Protospacer
.   ************** *** *******..*.

147. spacer 1.14|1705822|34|CP025859|CRT matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

148. spacer 1.14|1705822|34|CP025859|CRT matches to NZ_CP021367 (Acidovorax carolinensis strain P4 plasmid pACP4.1, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

149. spacer 1.14|1705822|34|CP025859|CRT matches to NZ_CP021649 (Acidovorax sp. T1 plasmid p1-T1, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

150. spacer 1.14|1705822|34|CP025859|CRT matches to NZ_CP021363 (Acidovorax carolinensis strain P3 plasmid pACP3.1, complete sequence) position: , mismatch: 9, identity: 0.735 

acgaggctgaacagggagggggctaccggcacag	CRISPR spacer
cagggttcgcacagggaggtggccaccggcacag	Protospacer
  *.* ..* ********* ***.**********

151. spacer 1.16|1705944|34|CP025859|CRT matches to MK448716 (Streptococcus phage Javan249, complete genome) position: , mismatch: 9, identity: 0.735 

tcccacaatacaaaataacccagcg----accaggatt	CRISPR spacer
ccccacaatacaaaatgatccagcgcaaagccaa----	Protospacer
.***************.*.******    .***.

152. spacer 1.22|1706310|34|CP025859|CRT matches to AP014205 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C77-MedDCM-OCT-S35-C75, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.735 

tcaagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
ttggaagggttttgtataagtaaagcattatttc	Protospacer
*.... * * ****** *** *************

153. spacer 2.1|1728060|32|CP025859|CRISPRCasFinder matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
cccgggaaaaacgggttcgcggcggcggcttc	Protospacer
  *.  ..****** ************** **

154. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gccatgcgcgccgcgcccggtgatggtgatgt	Protospacer
. *** *.******************. ..*

155. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP018077 (Sulfitobacter sp. AM1-D1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ggctgtcatgccgcgcccggtgatagccgcag	Protospacer
..*  .**.***************.*****..

156. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
caggcccgcgccgcgcccggtgatgtccaggg	Protospacer
 * ..**.***************** **. *.

157. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gagccgctcgccgcgcccggtgtcggccgcgc	Protospacer
.*  . * ************** .*******

158. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gagccgctcgccgcgcccggtgtcggccgcgc	Protospacer
.*  . * ************** .*******

159. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719 

-----aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
gttgaagc-----cgccgatcccggtgatggccgcgt	Protospacer
     *.*     *****  ****************

160. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP011523 (Streptomyces sp. CFMR 7 strain CFMR-7 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ggcctgggcgccgtgcccggtgatcgccgcgg	Protospacer
..* *  .*****.********** ******.

161. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cccgcgcacgccgcgcccggtgagcgccgaca	Protospacer
  *.. *****************  ****  *

162. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cagggcgacgccgagcccggcgatggccgcct	Protospacer
 * . * ****** ******.*********

163. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
cccgcgcacgccgcgcccggtgagcgccgaca	Protospacer
  *.. *****************  ****  *

164. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

165. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to KU935731 (Mycobacterium phage Phrann, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

166. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

167. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

168. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

169. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to KM347889 (Mycobacterium phage BuzzLyseyear, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

170. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to KX808131 (Mycobacterium phage SuperGrey, complete genome) position: , mismatch: 9, identity: 0.719 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
accgaccacgccgcgcacggtgagggccagat	Protospacer
* *. *********** ****** ****. .

171. spacer 2.5|1728061|31|CP025859|CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 9, identity: 0.71 

acatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
acatcggaaacggcttcgccgccttgagaga	Protospacer
******************* **  .*. .

172. spacer 2.5|1728061|31|CP025859|CRT matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 9, identity: 0.71 

acatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
aggacggaagcggcttcgccgcggcgggcaa	Protospacer
* . *****.********* *******

173. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
tgacggacgacgcgcccggtggtggccgcag	Protospacer
  *.  *** ***********.*******..

174. spacer 2.8|1728244|31|CP025859|CRT matches to MN369739 (Mycobacterium phage Kenuha5, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

175. spacer 2.8|1728244|31|CP025859|CRT matches to KU935731 (Mycobacterium phage Phrann, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

176. spacer 2.8|1728244|31|CP025859|CRT matches to KT309034 (Mycobacterium phage Dante, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

177. spacer 2.8|1728244|31|CP025859|CRT matches to NC_021538 (Mycobacterium phage Job42, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

178. spacer 2.8|1728244|31|CP025859|CRT matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

179. spacer 2.8|1728244|31|CP025859|CRT matches to KM347889 (Mycobacterium phage BuzzLyseyear, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

180. spacer 2.8|1728244|31|CP025859|CRT matches to KX808131 (Mycobacterium phage SuperGrey, complete genome) position: , mismatch: 9, identity: 0.71 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ccgaccacgccgcgcacggtgagggccagat	Protospacer
 *. *********** ****** ****. .

181. spacer 3.1|2172581|42|CP025859|CRISPRCasFinder matches to NZ_CP048307 (Escherichia coli strain 9 plasmid p009_C, complete sequence) position: , mismatch: 9, identity: 0.786 

acgtaggtcagataaggtgtttacgccgcatccgactgctgt	CRISPR spacer
ttgtaggtcggataaggcgtttacgccgcatccgacatcaac	Protospacer
 .*******.*******.******************  * ..

182. spacer 1.7|1706068|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgcgcctgtaataacgttgagtgcggtcata	CRISPR spacer
gcaaacctgtatcaacgttgagtgcggtaagt	Protospacer
 .. .****** .*************** *

183. spacer 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 10, identity: 0.688 

aagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
gtagccggtttgtaaaaggaaagcctcatgaa	Protospacer
. .  ******************* *.**

184. spacer 1.11|1706312|32|CP025859|PILER-CR,CRISPRCasFinder matches to NZ_CP014853 (Bacillus thuringiensis strain HD12 plasmid pHD120345, complete sequence) position: , mismatch: 10, identity: 0.688 

aagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
tcaagaaatttgtaaaagaaatgcattatttt	Protospacer
  . * ..**********.** *********.

185. spacer 1.22|1706310|34|CP025859|CRT matches to MN694097 (Marine virus AFVG_250M464, complete genome) position: , mismatch: 10, identity: 0.706 

tcaagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
tggagcgcggtttggaaaaggaaatcaatcccct	Protospacer
* .*********** ********* ** * ....

186. spacer 2.1|1728060|32|CP025859|CRISPRCasFinder matches to NZ_CP012383 (Streptomyces ambofaciens ATCC 23877 plasmid pSAM1, complete sequence) position: , mismatch: 10, identity: 0.688 

aacatcggaaacggcttcgcggcggcggcgtc	CRISPR spacer
gaggacggaagcggcttcgccgcggcgggcaa	Protospacer
.* . *****.********* *******

187. spacer 2.4|1728243|32|CP025859|CRISPRCasFinder,PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.688 

aacatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ctgacggacgacgcgcccggtggtggccgcag	Protospacer
   *.  *** ***********.*******..

188. spacer 2.8|1728244|31|CP025859|CRT matches to NZ_CP040764 (Paracoccus sp. 2251 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.677 

acatccacgccgcgcccggtgatggccgcga	CRISPR spacer
ttgaagccgccgatcccggtgatggccgcgt	Protospacer
 ..    *****  ****************

189. spacer 1.22|1706310|34|CP025859|CRT matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 12, identity: 0.647 

tcaagcgcggtttgtaaaaggaaagcattatttc	CRISPR spacer
cagtagccggtttgtaaaaggaaagcctcatgaa	Protospacer
. . .  ******************* *.**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage