1. spacer 1.1|662747|40|CP025865|CRISPRCasFinder matches to NZ_CP041417 (Escherichia coli strain STEC711 plasmid pSTEC711_1, complete sequence) position: , mismatch: 0, identity: 1.0
gcgctgcgggtcattcttgaaattacccccgctgtgctgt CRISPR spacer
gcgctgcgggtcattcttgaaattacccccgctgtgctgt Protospacer
****************************************
2. spacer 5.1|1752462|42|CP025865|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 0, identity: 1.0
tgtcacacgcagataaatccaactttcaatattgttaagttc CRISPR spacer
tgtcacacgcagataaatccaactttcaatattgttaagttc Protospacer
******************************************
3. spacer 5.2|1752521|40|CP025865|PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 1, identity: 0.975
catggcgtagcaaaaagaaattttcaatattgctttatgg CRISPR spacer
catggcgtagaaaaaagaaattttcaatattgctttatgg Protospacer
********** *****************************
4. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 2, identity: 0.938
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
aacatgatgtgatcggcgtcttccggccacca Protospacer
**************.** **************
5. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 2, identity: 0.938
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
aacatgatgtgatcggcgtcttccggccacca Protospacer
**************.** **************
6. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 2, identity: 0.938
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
aacatgatgtgatcggcgtcttccggccacca Protospacer
**************.** **************
7. spacer 2.22|803908|32|CP025865|PILER-CR matches to NC_004313 (Salmonella phage ST64B, complete genome) position: , mismatch: 2, identity: 0.938
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
aacatgatgtgatcggcgtcttccggccacca Protospacer
**************.** **************
8. spacer 2.22|803908|32|CP025865|PILER-CR matches to KU927493 (Salmonella phage 118970_sal3, complete genome) position: , mismatch: 2, identity: 0.938
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
aacatgatgtgatcggcgtcttccggccacca Protospacer
**************.** **************
9. spacer 2.22|803908|32|CP025865|PILER-CR matches to AY055382 (Salmonella typhimurium phage ST64B complete sequence) position: , mismatch: 2, identity: 0.938
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
aacatgatgtgatcggcgtcttccggccacca Protospacer
**************.** **************
10. spacer 9.1|4776323|38|CP025865|CRISPRCasFinder matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 2, identity: 0.947
cggacgcaggatggtgcgttcaattggactcgaaccaa CRISPR spacer
cagacgcagaatggtgcgttcaattggactcgaaccaa Protospacer
*.*******.****************************
11. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
12. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
13. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
14. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KR091915 (Klebsiella pneumoniae strain KPC-DK05 plasmid pKPC-DK05, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
15. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
16. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
17. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
18. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP025915 (Escherichia coli strain 203740 plasmid p203740_35, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
19. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
20. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
21. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
22. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
23. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
24. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
25. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
26. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
27. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
28. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP054370 (Escherichia coli strain SCU-115 plasmid pSCU-115-2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
29. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
30. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
31. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
32. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP006640 (Escherichia coli PCN061 plasmid PCN061p4, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
33. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
34. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
35. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
36. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
37. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
38. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
39. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
40. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
41. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
42. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
43. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
44. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
45. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
46. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
47. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
48. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985287 (Escherichia coli strain RPC3 plasmid RCS69_pI, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
49. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
50. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
51. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
52. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
53. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
54. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027258 (Escherichia coli strain EC11 plasmid unnamed3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
55. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
56. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
57. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
58. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
59. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
60. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
61. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
62. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
63. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
64. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
65. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
66. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
67. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
68. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
69. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
70. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
71. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
72. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
73. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
74. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
75. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
76. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
77. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
78. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
79. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
80. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
81. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
82. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgcc Protospacer
* * ***************************.
83. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to LR134252 (Klebsiella aerogenes strain NCTC9997 genome assembly, plasmid: 2) position: , mismatch: 3, identity: 0.906
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaagggcagagacagcttgct Protospacer
* *************** *************
84. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LS999564 (Escherichia coli isolate EC-TO143 plasmid 5, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
85. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LN824136 (Klebsiella pneumoniae genome assembly MS6671.v1, plasmid : _Plasmid_C_Kpneumoniae_MS6671) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc Protospacer
* * ** ************************.
86. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP029801 (Salmonella enterica subsp. enterica serovar Anatum strain R16.0676 plasmid pR16.0676_34k, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
87. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015505 (Klebsiella pneumoniae strain SKGH01 plasmid unnamed 5, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc Protospacer
* * ** ************************.
88. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026060 (Proteus mirabilis strain FDAARGOS_80 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc Protospacer
* * ** ************************.
89. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024853 (Escherichia coli strain AR_0006 plasmid tig00000176, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc Protospacer
* * ** ************************.
90. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP028999 (Klebsiella pneumoniae strain AR_0079 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc Protospacer
* * ** ************************.
91. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccgaaggggcgagacagcttgtc Protospacer
* * **************************..
92. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP019200 (Salmonella enterica subsp. enterica serovar Muenster str. 0315 plasmid pCFSAN001297_01, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
93. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_020122 (Citrobacter freundii strain CFSTE plasmid pN-Cit, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
94. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP023823 (Escherichia coli strain 7/2 plasmid p7_2.3, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgacgcccgaaggggcgagacagcttgcc Protospacer
* * ** ************************.
95. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026025 (Klebsiella pneumoniae strain 11420 plasmid p11420-KPC, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
96. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP018988 (Escherichia coli strain Ecol_AZ146 plasmid pECAZ146_3, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
97. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033500 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj58k plasmid pConj58k, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
98. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033501 (Salmonella enterica subsp. enterica serovar Anatum strain R13.0957_pConj83k plasmid pConj83k, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
99. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MK033499 (Escherichia coli strain C600_pConj125k plasmid pConj125k, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
100. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MG557999 (Escherichia coli strain Eco-36682cz plasmid pEco-36682cz, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
101. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_MF497781 (Citrobacter freundii strain Cfr-36049cz plasmid pCrf-36049cz, complete sequence) position: , mismatch: 4, identity: 0.875
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgaagcccggaggggcgagacagcttgcc Protospacer
* * ********.******************.
102. spacer 7.4|3587473|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to DQ372923 (Bacteriophage mu1/6, complete genome) position: , mismatch: 4, identity: 0.875
gcggcagc-gcccgccgggtacgacggcagcac CRISPR spacer
-tggcagctgcccgcctggtacgacggccgcac Protospacer
.****** ******* *********** ****
103. spacer 7.4|3587473|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_007967 (Streptomyces phage mu1/6, complete genome) position: , mismatch: 4, identity: 0.875
gcggcagc-gcccgccgggtacgacggcagcac CRISPR spacer
-tggcagctgcccgcctggtacgacggccgcac Protospacer
.****** ******* *********** ****
104. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
105. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026279 (Klebsiella oxytoca strain KONIH2 plasmid pKOR-b08d, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
106. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
107. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KX784503 (Citrobacter freundii strain 17285 plasmid p17285-IMP, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
108. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
109. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KX784502 (Klebsiella oxytoca strain 7121 plasmid p7121-IMP, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
110. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
111. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015078 (Escherichia coli strain Ecol_448 plasmid pEC448_OXA163, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
112. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
113. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KT148595 (Klebsiella pneumoniae subsp. pneumoniae strain GN1006 plasmid pKPC-SMH, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
114. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
115. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KT345947 (Klebsiella pneumoniae strain 2013050801 plasmid p0801-IMP, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
116. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
117. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP034403 (Escherichia coli strain CRE10 plasmid pCRE10.4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
118. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
119. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP010378 (Enterobacter hormaechei subsp. hormaechei strain 34983 plasmid p34983-59.134kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
120. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
121. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_EF219134 (Klebsiella pneumoniae isolate JIE137 plasmid pJIE137, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
122. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
123. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MN967025 (Klebsiella pneumoniae strain KP2611 plasmid pKP2611-N, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
124. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
125. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022277 (Citrobacter freundii strain 18-1 plasmid pD18-1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
126. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
127. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MK368725 (Escherichia coli strain JN24 plasmid pJN24NDM1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
128. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
129. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_019163 (Klebsiella pneumoniae plasmid pTR4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
130. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
131. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026274 (Klebsiella oxytoca strain KONIH4 plasmid pKPC-4b66, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
132. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP050010 (Citrobacter sp. Y3 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
133. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
134. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027617 (Klebsiella pneumoniae subsp. ozaenae strain AR_0096 plasmid unnamed5, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
135. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024879 (Klebsiella pneumoniae strain NH25 plasmid pNH25.5, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
136. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
137. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP029112 (Escherichia coli strain AR436 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
138. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
139. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP043856 (Enterobacter hormaechei strain EB_P6_L3_02.19 plasmid pIMPIncN3_52kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
140. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
141. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026205 (Escherichia coli strain ECONIH5 plasmid pKPC-e3ee, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
142. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
143. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985223 (Escherichia coli strain 711 plasmid RCS25_p, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
144. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
145. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026184 (Klebsiella pneumoniae strain KPNIH49 plasmid pKPN-af73, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
146. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
147. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP035471 (Escherichia coli strain U12A plasmid pU12A_D, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
148. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
149. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP034398 (Escherichia coli strain CRE1 plasmid pCRE1.4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
150. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
151. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP042548 (Klebsiella michiganensis strain C52 plasmid pC52_003, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
152. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
153. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP011646 (Klebsiella pneumoniae strain CAV1596 plasmid pKPC_CAV1596-97, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
154. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
155. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP040826 (Enterobacter cloacae strain NH77 plasmid pEcloNH77, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
156. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
157. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP043516 (Enterobacter kobei strain EB_P8_L5_01.19 plasmid pIMPIncN3_57kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
158. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
159. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027137 (Escherichia coli strain AR_0369 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
160. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
161. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP026232 (Citrobacter freundii complex sp. CFNIH4 plasmid pKPC-c9fd, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
162. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
163. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MN583554 (Escherichia coli strain M17224 plasmid p17511_70, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
164. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
165. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP019907 (Escherichia coli strain MDR_56 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
166. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
167. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to KX863569 (Uncultured bacterium plasmid pTRE-131 clone TRE-131, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
168. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
169. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LT985250 (Escherichia coli strain 170 plasmid RCS38_p, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
170. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
171. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_024954 (Escherichia coli strain ECS01 plasmid pNDM-ECS01, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
172. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
173. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP027125 (Escherichia coli strain AR_0374 plasmid unnamed3) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
174. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP010382 (Enterobacter hormaechei subsp. steigerwaltii strain 34998 plasmid p34998-53.129kb, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagacagcaaggc Protospacer
* ************************* * .
175. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP048224 (Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
176. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
177. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021658 (Aeromonas salmonicida strain O23A plasmid pO23AP4, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
178. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022182 (Aeromonas salmonicida strain S68 plasmid pS68-1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
179. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022182 (Aeromonas salmonicida strain S68 plasmid pS68-1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
180. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021020 (Xanthomonas citri pv. phaseoli var. fuscans strain CFBP6167 plasmid pC, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct- CRISPR spacer
gatggaagcccgaaggggcgagaca-cgcgcag Protospacer
* *********************** * .**
181. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_009350 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
182. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
183. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP038104 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa9-like, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
184. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP017144 (Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
185. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP017144 (Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
186. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022177 (Aeromonas salmonicida strain S44 plasmid pS44-2, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
187. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022177 (Aeromonas salmonicida strain S44 plasmid pS44-2, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
188. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022171 (Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
189. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP022171 (Aeromonas salmonicida strain S121 plasmid pS121-2, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
190. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KY555070 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa9, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
191. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KY555069 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacagcatctt Protospacer
* *****.******************* * .*
192. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024681 (Citrobacter freundii strain UMH14 plasmid pUMH14_1, complete sequence) position: , mismatch: 5, identity: 0.844
gctggaagcccgaaggggcgagacagct-tgct CRISPR spacer
gatggaagcccgaagggcagagacagccgtgc- Protospacer
* *************** ********. ***
193. spacer 8.5|3604037|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_028662 (Mycobacterium phage Phlei, complete genome) position: , mismatch: 5, identity: 0.844
acgaccaaatgatctacgcgtattgccacctc- CRISPR spacer
acgaccaaacgctctacgcgta-tgcgagctct Protospacer
*********.* ********** *** * ***
194. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP018471 (Xanthomonas vesicatoria strain LM159 plasmid pLM159.2, complete sequence) position: , mismatch: 6, identity: 0.812
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gctggaagcccgtaggggcgagacgggcggcc Protospacer
************ ***********.* . **.
195. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to MN386974 (Pseudomonas aeruginosa strain 1943 plasmid pPaeBURNS1, complete sequence) position: , mismatch: 6, identity: 0.812
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gctggaagcccgtaggggcgagacgggcggcc Protospacer
************ ***********.* . **.
196. spacer 7.4|3587473|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029832 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
gcggcag-cgcccgccgggtacgacggcagcac CRISPR spacer
-caccagccgcccgccgggtccgacagcagcag Protospacer
*. *** ************ ****.******
197. spacer 7.7|3587656|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MG592456 (Vibrio phage 1.081.O._10N.286.52.C2, partial genome) position: , mismatch: 6, identity: 0.812
attcttgatcacgcttttaccgaagt--aatggt CRISPR spacer
attgttgatcacgcttttactgaagttcgacg-- Protospacer
*** ****************.***** .*.*
198. spacer 8.1|3603793|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
-gcattcaatattcggtttttaactgcggattc CRISPR spacer
aacatttga-atttggtgtttaactgcggattc Protospacer
.****..* ***.*** ***************
199. spacer 8.12|3604466|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050442 (Tolypothrix sp. PCC 7910 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
cggctatggaatttatggagaagtttggtttt CRISPR spacer
ctcctatggaatttatgcagaagtttagtaat Protospacer
* ************** ********.** *
200. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagaccgcgcagc Protospacer
* ********************** ** .. .
201. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagaccgcgcagc Protospacer
* ********************** ** .. .
202. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccgaaggggcgagaccgcgcagc Protospacer
* ********************** ** .. .
203. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP012641 (Massilia sp. WG5 plasmid unnamed 1, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaagcccggaggggcgagaccgcgcggc Protospacer
* **********.*********** ** .* .
204. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP048224 (Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag Protospacer
* *****.****************.** *
205. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NC_009350 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag Protospacer
* *****.****************.** *
206. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag Protospacer
* *****.****************.** *
207. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_KY555069 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatggaaacccgaaggggcgagacggcatcag Protospacer
* *****.****************.** *
208. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP010894 (Pseudomonas sp. MRSN12121 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gattgatgcccgaaggggcgagactgccggca Protospacer
* * ** ***************** **. **
209. spacer 2.2|803546|32|CP025865|CRISPRCasFinder,CRT matches to MH460460 (Dickeya phage vB_DsoM_JA13, complete genome) position: , mismatch: 7, identity: 0.781
gccgggcgt-atttgaaataacctgatcaatgt CRISPR spacer
-cagattgtgatttgaaacaagctgatcaatgt Protospacer
* *. .** ********.** ***********
210. spacer 2.16|803548|32|CP025865|PILER-CR matches to MH460460 (Dickeya phage vB_DsoM_JA13, complete genome) position: , mismatch: 7, identity: 0.781
gccgggcgt-atttgaaataacctgatcaatgt CRISPR spacer
-cagattgtgatttgaaacaagctgatcaatgt Protospacer
* *. .** ********.** ***********
211. spacer 3.11|816036|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032893 (Enterobacter kobei strain WCHEK045523 plasmid p1_045523, complete sequence) position: , mismatch: 7, identity: 0.781
gcgcaaccgttcatgatctgaaatatctggca CRISPR spacer
cttcgaccatttatgatctgaaatatctggct Protospacer
. *.***.**.*******************
212. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_018516 (Bacillus thuringiensis HD-789 plasmid pBTHD789-1, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
213. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053970 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
214. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053979 (Bacillus thuringiensis strain FDAARGOS_795 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
215. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013277 (Bacillus thuringiensis serovar israelensis strain AM65-52 plasmid pAM65-52-2-350K, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
216. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039723 (Bacillus thuringiensis strain BT-59 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
217. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009348 (Bacillus thuringiensis HD1002 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
218. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009334 (Bacillus thuringiensis strain HD1011 plasmid 2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
219. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045024 (Bacillus thuringiensis strain JW-1 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
atccggctatatctttgagcattacagaaata CRISPR spacer
ttatagctatatctttgtgcattagagaaatc Protospacer
* ..************ ****** ******
220. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP015092 (Pelagibaca abyssi strain JLT2014 plasmid pPABY3, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gctggaagcccgcacgggcgagacccgttttg Protospacer
************ * ********* ** .
221. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LR699555 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct--- CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgccagg Protospacer
****.************ ***** *..**.
222. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LR699555 (Paraburkholderia sp. Msb3 isolate PDMSB31 plasmid pI) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct--- CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgccagg Protospacer
****.************ ***** *..**.
223. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct--- CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgcaagg Protospacer
****.************ ***** *..**
224. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP014581 (Burkholderia sp. OLGA172 plasmid pOLGA2, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct--- CRISPR spacer
gctgaaagcccgaagggtcgaga---cccgcaagg Protospacer
****.************ ***** *..**
225. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LR027556 (Epibacterium mobile isolate EPIB1 plasmid 4, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gctggaagcccgcacgggcgagacccgttttg Protospacer
************ * ********* ** .
226. spacer 2.1|803486|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP039912 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625a, complete sequence) position: , mismatch: 8, identity: 0.75
gctggaagcccgaaggggcgagacagcttgct CRISPR spacer
gatcgtcacccgaatgggcgagaccgcttgcg Protospacer
* * * .****** ********* ******
227. spacer 2.14|804266|32|CP025865|CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
ccccacgacgccgcgcaggcgcttatcgacaa Protospacer
******.********* ******** * .
228. spacer 2.28|804268|32|CP025865|PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
ccccacgacgccgcgcaggcgcttatcgacaa Protospacer
******.********* ******** * .
229. spacer 3.2|815496|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.75
agttcattcagcacgagcacccactcggtgaa CRISPR spacer
ggcactctcagcaccagcacctactcggtgag Protospacer
.*. * .******* ******.*********.
230. spacer 3.3|815556|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 8, identity: 0.75
cgaaaactcccgaatcgcccggatcgcgttca CRISPR spacer
cgtgaacctccgaatcgcccggatcgccgccg Protospacer
** .***..****************** .*.
231. spacer 3.7|815796|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP023206 (Escherichia coli strain TUM18781 plasmid pMTY18781-1_lncX3, complete sequence) position: , mismatch: 8, identity: 0.75
ttttaactgccgtaagggtgtgccctacgatt CRISPR spacer
tccaaactaccgtaatggtgtgccctatcatg Protospacer
*.. ****.****** ***********. **
232. spacer 3.9|815916|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75
--ttgaatcccttgcgcgtgacgataccgatgac CRISPR spacer
ggtgcgat--cttgctcgtgacgacaccgatgag Protospacer
* .** ***** ********.********
233. spacer 3.13|816156|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NC_021067 (Vibrio phage helene 12B3 genomic sequence) position: , mismatch: 8, identity: 0.75
tttctccattagcgcgaccggtttttctgccg CRISPR spacer
gtactccattagagcgactggtttttgggttg Protospacer
* ********* *****.******* *..*
234. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038236 (Leisingera sp. NJS201 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
tcgagcccgatcatcggcatcagcagttccgg Protospacer
.**********.******** ***..* * *.
235. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
tcgaccccgattatcgggatgagctcggcgtg Protospacer
.*** ************ ****** *** .
236. spacer 7.4|3587473|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75
gcggcagcgcccgccgggtacgacggcagcac CRISPR spacer
gcggaagcgcccgccgggcacgacataggggc Protospacer
**** *************.*****. .* .*
237. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MN434096 (Klebsiella phage JIPh_Kp127, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
238. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MK630230 (Klebsiella phage Spivey, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
239. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MN434094 (Klebsiella phage AmPh_EK80, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
240. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MG459987 (Klebsiella phage Sugarland, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
241. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MT380195 (Klebsiella phage KP_LZD_B01, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
242. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
243. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to KX845404 (Klebsiella phage vB_Kpn_IME260, complete genome) position: , mismatch: 8, identity: 0.75
atccggctatatctttgagcattacagaaata CRISPR spacer
atccggctatgcctttgagcattgccgtgact Protospacer
**********..***********.* * .*.
244. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040783 (Bacillus thuringiensis strain HM-311 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcttacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
245. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
246. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053952 (Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
247. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to CP020755 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-16, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
248. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
249. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_020385 (Bacillus thuringiensis serovar thuringiensis str. IS5056 plasmid pIS56-328, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
250. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021062 (Bacillus thuringiensis strain ATCC 10792 plasmid poh1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
251. spacer 7.6|3587595|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053949 (Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctattgctttcgtacagattttcagtggtgct CRISPR spacer
tatttgctttcctacagattttctgtcttgtt Protospacer
. ******** *********** ** **.*
252. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_010180 (Bacillus mycoides KBAB4 plasmid pBWB401, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
253. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015592 (Bacillus cereus strain AR156 plasmid pAR460, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
254. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
255. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040345 (Bacillus albus strain DLOU-Yingkou plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
256. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009368 (Bacillus cereus strain FM1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
257. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009691 (Bacillus mycoides strain ATCC 6462 plasmid pBMX_1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
258. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009336 (Bacillus thuringiensis strain HD1011 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
259. spacer 7.9|3587778|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.75
cgttctg---aatccgatattcttcagcaccttca CRISPR spacer
---tccaaacaatccgatattcttcctcaccttct Protospacer
**.. *************** *******
260. spacer 7.10|3587839|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75
agcgtcaatcagcgcgtctatcgcgtcacttt CRISPR spacer
ggcgtcaatgagcgcgtcgatcgcggcgggat Protospacer
.******** ******** ****** *. *
261. spacer 8.10|3604344|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75
cagctcgcagcgctcggaacgtggcgctatag CRISPR spacer
gagatcgcagcgctcggaccgtggttccacaa Protospacer
** ************** *****. *.*.*.
262. spacer 2.2|803546|32|CP025865|CRISPRCasFinder,CRT matches to NC_005017 (Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719
-gccgggcgtatttgaaataacctgatcaatgt CRISPR spacer
caacaag-atattggaaataaccagatcaatga Protospacer
. *..* .**** ********* ********
263. spacer 2.2|803546|32|CP025865|CRISPRCasFinder,CRT matches to NC_008791 (Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719
-gccgggcgtatttgaaataacctgatcaatgt CRISPR spacer
caacaag-atattggaaataaccagatcaatga Protospacer
. *..* .**** ********* ********
264. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
265. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
266. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
267. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
268. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
269. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
270. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
271. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
272. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to KM389261 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000621 genomic sequence) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
273. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
274. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
275. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
276. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
277. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
278. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
279. spacer 2.9|803966|32|CP025865|CRISPRCasFinder,CRT matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
280. spacer 2.10|804026|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 9, identity: 0.719
attggcagtcgttggggttttgaaatattaga CRISPR spacer
cctgtacgtcgatgcggttttgaaatattatc Protospacer
.** **** ** ***************
281. spacer 2.11|804086|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
282. spacer 2.11|804086|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
283. spacer 2.11|804086|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
284. spacer 2.11|804086|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
285. spacer 2.13|804206|32|CP025865|CRISPRCasFinder,CRT matches to MT776806 (Mycobacterium phage MrMiyagi, complete genome) position: , mismatch: 9, identity: 0.719
aaaattctggattgagagcgaggggcgattcc CRISPR spacer
aaaattcttgatggagagcgaggcgttgattt Protospacer
******** *** ********** *. . *..
286. spacer 2.14|804266|32|CP025865|CRISPRCasFinder,CRT matches to MF140416 (Mycobacterium phage LastHope, complete genome) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
gtgcacaacgcgccgctggcgcttaacccgac Protospacer
. ******** **************.. *
287. spacer 2.14|804266|32|CP025865|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
cccgacaacgccgcgcaggcgctggccacggc Protospacer
*** ************ ****** . * . *
288. spacer 2.14|804266|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
cccgacaacgccgcgcaggcgctggccacggc Protospacer
*** ************ ****** . * . *
289. spacer 2.14|804266|32|CP025865|CRISPRCasFinder,CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
gcggtcaccgccgcgctggcgctgaactcggc Protospacer
* ** *************** ****. *
290. spacer 2.16|803548|32|CP025865|PILER-CR matches to NC_005017 (Yersinia enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719
-gccgggcgtatttgaaataacctgatcaatgt CRISPR spacer
caacaag-atattggaaataaccagatcaatga Protospacer
. *..* .**** ********* ********
291. spacer 2.16|803548|32|CP025865|PILER-CR matches to NC_008791 (Yersinia enterocolitica subsp. enterocolitica 8081 plasmid pYVe8081, complete sequence) position: , mismatch: 9, identity: 0.719
-gccgggcgtatttgaaataacctgatcaatgt CRISPR spacer
caacaag-atattggaaataaccagatcaatga Protospacer
. *..* .**** ********* ********
292. spacer 2.23|803968|32|CP025865|PILER-CR matches to MH643777 (Pseudomonas phage YMC12/01/R960, complete genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
293. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511031 (Pseudomonas phage BR52, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
294. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511034 (Pseudomonas phage BR243, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
295. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511033 (Pseudomonas phage BR205, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
296. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511017 (Pseudomonas phage CF23, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
297. spacer 2.23|803968|32|CP025865|PILER-CR matches to KM389326 (UNVERIFIED: Pseudomonas phage F_KK2074sp/Pa1651 clone contig00001 genomic sequence) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
298. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK144667 (Pseudomonas phage Spike, complete genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
299. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511026 (Pseudomonas phage CF121, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
300. spacer 2.23|803968|32|CP025865|PILER-CR matches to KM389261 (UNVERIFIED: Pseudomonas phage F_ET2439sp/Pa1651 clone ctg7180000000621 genomic sequence) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
301. spacer 2.23|803968|32|CP025865|PILER-CR matches to KM389464 (UNVERIFIED: Pseudomonas phage JBDs5 clone contig00001 genomic sequence) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
302. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511022 (Pseudomonas phage CF74, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
303. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511030 (Pseudomonas phage CF213, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
304. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511025 (Pseudomonas phage CF118, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
305. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511023 (Pseudomonas phage CF77, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
306. spacer 2.23|803968|32|CP025865|PILER-CR matches to MK511029 (Pseudomonas phage CF183, partial genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
307. spacer 2.23|803968|32|CP025865|PILER-CR matches to EU272036 (Pseudomonas phage MP29, complete genome) position: , mismatch: 9, identity: 0.719
atgtcgcctacgaacatcagccgggtgcctgt CRISPR spacer
gtgtcggctacgaacagcagccggtggagggc Protospacer
.***** ********* ******* * *.
308. spacer 2.24|804028|32|CP025865|PILER-CR matches to NZ_CP031072 (Bacillus mycoides strain BPN401 plasmid pl395, complete sequence) position: , mismatch: 9, identity: 0.719
attggcagtcgttggggttttgaaatattaga CRISPR spacer
cctgtacgtcgatgcggttttgaaatattatc Protospacer
.** **** ** ***************
309. spacer 2.25|804088|32|CP025865|PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
310. spacer 2.25|804088|32|CP025865|PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
311. spacer 2.25|804088|32|CP025865|PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
312. spacer 2.25|804088|32|CP025865|PILER-CR matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.719
gcgatctgttgcgtgaaatagtcaggcaatac CRISPR spacer
aaggactgttgcgtgaaatcgacaggcagtca Protospacer
. *. ************** * ******.*
313. spacer 2.27|804208|32|CP025865|PILER-CR matches to MT776806 (Mycobacterium phage MrMiyagi, complete genome) position: , mismatch: 9, identity: 0.719
aaaattctggattgagagcgaggggcgattcc CRISPR spacer
aaaattcttgatggagagcgaggcgttgattt Protospacer
******** *** ********** *. . *..
314. spacer 2.28|804268|32|CP025865|PILER-CR matches to MF140416 (Mycobacterium phage LastHope, complete genome) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
gtgcacaacgcgccgctggcgcttaacccgac Protospacer
. ******** **************.. *
315. spacer 2.28|804268|32|CP025865|PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
cccgacaacgccgcgcaggcgctggccacggc Protospacer
*** ************ ****** . * . *
316. spacer 2.28|804268|32|CP025865|PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
cccgacaacgccgcgcaggcgctggccacggc Protospacer
*** ************ ****** . * . *
317. spacer 2.28|804268|32|CP025865|PILER-CR matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 9, identity: 0.719
ccccacaacgccgcgctggcgcttaactttcc CRISPR spacer
gcggtcaccgccgcgctggcgctgaactcggc Protospacer
* ** *************** ****. *
318. spacer 3.3|815556|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016485 (Synechococcus sp. PCC 8807 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cgaaaactc-----ccgaatcgcccggatcgcgttca CRISPR spacer
-----atccattggccggatcgcccggatcgcgatca Protospacer
*..* ***.*************** ***
319. spacer 3.4|815616|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045307 (Legionella longbeachae strain B41211CHC plasmid pB41211CHC_76k, complete sequence) position: , mismatch: 9, identity: 0.719
tagaaattaatagctgtagtgattgcatgcca CRISPR spacer
tagaaattaatagttgtattgatgtcttttac Protospacer
*************.**** **** * * .
320. spacer 3.13|816156|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 9, identity: 0.719
tttctccattagcgcgaccggtttttctgccg CRISPR spacer
aatctccattcgcgcgcccggtttttggcgca Protospacer
******** ***** ********* *.
321. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 9, identity: 0.719
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
tgaattaggattatcgacatgagcgatacgga Protospacer
. .* . ********.**********.****
322. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct Protospacer
**********.*********.** .* *
323. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gcgagcccgatcatcggcatgggcttcgagct Protospacer
**********.*********.** .* *
324. spacer 7.5|3587534|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to HQ615693 (Synechococcus phage S-CRM01, complete genome) position: , mismatch: 9, identity: 0.719
atccggctatatctttgagcattacagaaata CRISPR spacer
gcctcaatatatcattgagcaatacagaaatt Protospacer
..*. . ****** ******* *********
325. spacer 7.10|3587839|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032828 (Sphingomonas sp. YZ-8 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
agcgtcaatcagcgcgtctatcgcgtcacttt CRISPR spacer
gaactcaatcagcgcgttcatcgcgtcgcgat Protospacer
.. *************..********.* *
326. spacer 7.11|3587900|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
atttgggggtatgagagcgccgagccgttcgg CRISPR spacer
gtcgaacggtatgcgggcgccgagccgttcga Protospacer
.*. .. ****** *.***************.
327. spacer 7.11|3587900|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
atttgggggtatgagagcgccgagccgttcgg CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt Protospacer
* .* ******* ********.******
328. spacer 7.11|3587900|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
atttgggggtatgagagcgccgagccgttcgg CRISPR spacer
aaacgttcgtatgagcgcgccgagtcgttcgt Protospacer
* .* ******* ********.******
329. spacer 7.16|3588205|32|CP025865|CRISPRCasFinder,CRT matches to MK249151 (Blackfly microvirus SF02 isolate 049, complete genome) position: , mismatch: 9, identity: 0.719
cgcgagagccagcaaaacgccagggcacaaaa CRISPR spacer
gccatgtcccaacaaaacgccagggaacaaat Protospacer
*. * ***.************* *****
330. spacer 8.1|3603793|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032486 (Neokomagataea tanensis strain AH13 = NBRC 106556 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gcattcaatattcggtttttaactgcggattc CRISPR spacer
tgatgcaatattaggtttttaactgcgcgagt Protospacer
** ******* ************** . .
331. spacer 8.2|3603854|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025016 (Rhizobium leguminosarum strain Norway plasmid pRLN4, complete sequence) position: , mismatch: 9, identity: 0.719
aacccgcgccgtcggctataacatctctgaaa----- CRISPR spacer
gtcccgcgccgtcgacgataacatc-----aacctcg Protospacer
. ************.* ******** **
332. spacer 8.2|3603854|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016451 (Sinorhizobium sp. RAC02 plasmid pBSY16_2, complete sequence) position: , mismatch: 9, identity: 0.719
aacccgcgccgtcggctataacatctctgaaa CRISPR spacer
tgcccgcgccctcggctatgacatcgacggca Protospacer
.******** ********.***** .*. *
333. spacer 8.2|3603854|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050088 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b6, complete sequence) position: , mismatch: 9, identity: 0.719
aacccgcgccgtcggctataacatctctgaaa----- CRISPR spacer
gtcccgcgccgtcgacgataacatc-----aacctcg Protospacer
. ************.* ******** **
334. spacer 8.10|3604344|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 9, identity: 0.719
cagctcgcagcgctcggaacgtggcgctatag CRISPR spacer
aaaacatcagcgctcagaacgcggcgctatcg Protospacer
*. . ********.*****.******** *
335. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
336. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
337. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
338. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
339. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
340. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
341. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
342. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
343. spacer 2.8|803906|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
344. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP021753 (Klebsiella pneumoniae strain AR_0113 plasmid unitig_2, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
345. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP008791 (Klebsiella oxytoca KONIH1 plasmid pKPC-727, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
346. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP025040 (Klebsiella pneumoniae strain NU-CRE047 plasmid pNU-CRE047_3, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
347. spacer 2.22|803908|32|CP025865|PILER-CR matches to KY940546 (Klebsiella pneumoniae plasmid pUCLA3, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
348. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP021545 (Klebsiella pneumoniae strain AR_0112 plasmid tig00000001, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
349. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP006922 (Klebsiella pneumoniae 30684/NJST258_2 plasmid pNJST258C1, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
350. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP020064 (Klebsiella pneumoniae strain AR_0117 plasmid unitig_3, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
351. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP021857 (Klebsiella pneumoniae strain AR_0125 plasmid tig00000002_pilon, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
352. spacer 2.22|803908|32|CP025865|PILER-CR matches to NZ_CP024544 (Klebsiella pneumoniae strain INF042 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
aacatgatgtgatcagcttcttccggccacca CRISPR spacer
ttaatgatgtaatcaccttcttccggatattt Protospacer
*******.**** ********** .*..
353. spacer 3.2|815496|32|CP025865|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 10, identity: 0.688
agttcattcagcacgagcacccactcggtgaa CRISPR spacer
gcccccgacagcccgagcacccactccgtgag Protospacer
. ..* **** ************* ****.
354. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta Protospacer
. . ****.*********.******** *
355. spacer 7.3|3587412|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 10, identity: 0.688
ccgagcccgattatcggcatgagcgatgcgga CRISPR spacer
gttgcggcgatcatcggcatgggcgatgcgta Protospacer
. . ****.*********.******** *
356. spacer 7.12|3587961|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043437 (Enterobacter sp. LU1 plasmid unnamed) position: , mismatch: 10, identity: 0.688
ttgattacctcgctgttgctgcgctactggtg CRISPR spacer
gtgattaccacgctgctgctgcgcggggcgca Protospacer
******** *****.******** . *..
357. spacer 7.15|3588144|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039902 (Agrobacterium tumefaciens strain CFBP5877 plasmid pTiCFBP5877, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
358. spacer 7.15|3588144|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039893 (Agrobacterium tumefaciens strain CFBP5499 plasmid pTiCFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
359. spacer 7.15|3588144|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000025 (Agrobacterium genomosp. 6 strain AR125 plasmid pTi_AR125, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
360. spacer 7.15|3588144|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_KY000029 (Agrobacterium genomosp. 6 strain CFBP5499 plasmid pTi_CFBP5499, complete sequence) position: , mismatch: 10, identity: 0.688
tattacgcgccagcaatgctgacagcggcaaa CRISPR spacer
agcatggcgccagcaatggcgacagcggccag Protospacer
.. ************ .********* *.
361. spacer 7.16|3588205|32|CP025865|CRISPRCasFinder,CRT matches to NZ_CP038854 (Pantoea vagans strain LMG 24199 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cgcgagagccagcaaaacgccagggcacaaaa CRISPR spacer
ggaaggagcctgcaaagcgccagggcaccggt Protospacer
* ..***** *****.*********** ..
362. spacer 8.4|3603976|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
gtccatggcctgacgaagctcgtaatattttg CRISPR spacer
gcgcatgtcctgacgaagctcgtgatgcaaga Protospacer
*. **** ***************.**.. .
363. spacer 7.13|3588022|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to MF919512 (Mycobacterium phage Klein, complete genome) position: , mismatch: 11, identity: 0.656
gcgtttccatgccgttgataaacatcccgccc CRISPR spacer
tatcccccatgcggtcgataaacatcccgata Protospacer
...****** **.************* .
364. spacer 7.13|3588022|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NC_022067 (Mycobacterium phage Wanda, complete genome) position: , mismatch: 11, identity: 0.656
gcgtttccatgccgttgataaacatcccgccc CRISPR spacer
tatcccccatgcggtcgataaacatcccgata Protospacer
...****** **.************* .
365. spacer 8.4|3603976|32|CP025865|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 11, identity: 0.656
gtccatggcctgacgaagctcgtaatattttg CRISPR spacer
ccgcatgtcctgacgaagctcgtgatgcaaga Protospacer
. **** ***************.**.. .
