Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034429 Pseudomonas aeruginosa strain GIMC5015:PAKB6, complete sequence 1 crisprs csa3,DEDDh,cas3,DinG,WYL 0 1 5 0

Results visualization

1. CP034429
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034429_1 342663-342776 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034429_2 2.2|5914055|23|CP034429|PILER-CR 5914055-5914077 23 AP014204 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S42-C31, *** SEQUENCING IN PROGRESS *** 32703-32725 2 0.913
CP034429_2 2.2|5914055|23|CP034429|PILER-CR 5914055-5914077 23 AP014203 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS *** 10290-10312 2 0.913

1. spacer 2.2|5914055|23|CP034429|PILER-CR matches to AP014204 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S42-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.913

tcgcggccgcggatttcgccaca	CRISPR spacer
tcgcggccgatgatttcgccaca	Protospacer
*********  ************

2. spacer 2.2|5914055|23|CP034429|PILER-CR matches to AP014203 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.913

tcgcggccgcggatttcgccaca	CRISPR spacer
tcgcggccgatgatttcgccaca	Protospacer
*********  ************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 74915 : 107746 28 Planktothrix_phage(50.0%) protease,head,plate NA
DBSCAN-SWA_2 641447 : 721073 85 Pseudomonas_phage(37.5%) tRNA,plate,tail NA
DBSCAN-SWA_3 2560654 : 2567548 9 uncultured_Caudovirales_phage(83.33%) tRNA NA
DBSCAN-SWA_4 4706765 : 4714314 8 Pseudomonas_phage(100.0%) integrase,coat attL 4705795:4705821|attR 4718128:4718154
DBSCAN-SWA_5 5229989 : 5236612 7 Pseudomonas_phage(85.71%) integrase,coat attL 5229748:5229807|attR 5241827:5241908
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage