Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034541 Brevibacillus sp. SCSIO 07484 chromosome, complete genome 7 crisprs NA 1 3 0 0
CP034542 Brevibacillus sp. SCSIO 07484 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0

Results visualization

1. CP034541
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_1 567877-567973 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_2 590055-591097 Orphan NA
15 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_3 609173-610485 Orphan NA
19 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_4 1311184-1312028 Orphan NA
12 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_5 2154285-2154383 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_6 3316066-3316155 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034541_7 3390015-3390515 Orphan NA
7 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034541_5 5.1|2154316|37|CP034541|CRISPRCasFinder 2154316-2154352 37 CP034541.1 1748311-1748347 0 1.0

1. spacer 5.1|2154316|37|CP034541|CRISPRCasFinder matches to position: 1748311-1748347, mismatch: 0, identity: 1.0 

ggatggacccggaggtgccgctggtcgtgccggaagt	CRISPR spacer
ggatggacccggaggtgccgctggtcgtgccggaagt	Protospacer
*************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034541_4 4.2|1311281|35|CP034541|PILER-CR,CRISPRCasFinder,CRT 1311281-1311315 35 NC_015156 Vibrio nigripulchritudo plasmid VIBNI_pA, complete genome 209077-209111 8 0.771
CP034541_4 4.2|1311281|35|CP034541|PILER-CR,CRISPRCasFinder,CRT 1311281-1311315 35 KY549443 Enterococcus phage EFP01, complete genome 34546-34580 9 0.743
CP034541_5 5.1|2154316|37|CP034541|CRISPRCasFinder 2154316-2154352 37 NZ_CP054617 Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence 85332-85368 9 0.757
CP034541_7 7.7|3390450|36|CP034541|CRISPRCasFinder,CRT,PILER-CR 3390450-3390485 36 NC_041964 Pseudomonas phage R18 DNA, complete genome 932-967 9 0.75

1. spacer 4.2|1311281|35|CP034541|PILER-CR,CRISPRCasFinder,CRT matches to NC_015156 (Vibrio nigripulchritudo plasmid VIBNI_pA, complete genome) position: , mismatch: 8, identity: 0.771 

acggagggaacgttatggaaaaggtgaaactatct	CRISPR spacer
gcggagggatcgtgatggaaaaggtgacccgttcc	Protospacer
.******** *** *************  *  **.

2. spacer 4.2|1311281|35|CP034541|PILER-CR,CRISPRCasFinder,CRT matches to KY549443 (Enterococcus phage EFP01, complete genome) position: , mismatch: 9, identity: 0.743 

acggagggaacgttatggaaaaggtgaaactatct	CRISPR spacer
aatgcaagaacattatgcaaaaggtgaaactattg	Protospacer
*  * ..****.***** ***************.

3. spacer 5.1|2154316|37|CP034541|CRISPRCasFinder matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.757 

ggatggacccggaggtgccgctggtcgtgccggaagt	CRISPR spacer
cgacgccggaggaggtgccgctggtggtgccggatgt	Protospacer
 **.*     *************** ******** **

4. spacer 7.7|3390450|36|CP034541|CRISPRCasFinder,CRT,PILER-CR matches to NC_041964 (Pseudomonas phage R18 DNA, complete genome) position: , mismatch: 9, identity: 0.75 

ggtaactggaactggcagccggcttcttcaccttag----	CRISPR spacer
ggtaactggaactggtagccggcgtcggc----cagggtg	Protospacer
***************.******* **  *    .**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage