Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034539 Streptomyces sp. MK45 chromosome, complete genome 8 crisprs csa3,casR,DEDDh,WYL,cas4,c2c9_V-U4,Cas9_archaeal,cas3,Cas14u_CAS-V,DinG 1 1 5 0

Results visualization

1. CP034539
CP034539 040000080000012000001600000200000024000002800000320000036000004000000440000048000005200000560000060000006400000680000072000007600000800000084000008800000920000096000001000000010400000 CRISPR 1 2 3 4 5 6 7 8 Self-targeting Prophage 1 2 3 4 5 anti-CRISPR
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_1 999996-1000093 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_2 2511965-2512052 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_3 3049822-3049907 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_4 3152081-3152172 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_5 4786873-4787031 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_7 6519364-6519451 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_8 7167819-7167965 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034539_9 8538099-8538181 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP034539_3 3.1|3049855|20|CP034539|CRISPRCasFinder 3049855-3049874 20 CP034539.1 3049909-3049928 0 1.0

1. spacer 3.1|3049855|20|CP034539|CRISPRCasFinder matches to position: 3049909-3049928, mismatch: 0, identity: 1.0

gccgaacccttcggacggac	CRISPR spacer
gccgaacccttcggacggac	Protospacer
********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034539_9 9.1|8538126|29|CP034539|CRISPRCasFinder 8538126-8538154 29 NZ_CP015867 Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence 308235-308263 5 0.828
CP034539_9 9.1|8538126|29|CP034539|CRISPRCasFinder 8538126-8538154 29 NC_047992 Microbacterium phage Zeta1847, complete genome 22736-22764 8 0.724

1. spacer 9.1|8538126|29|CP034539|CRISPRCasFinder matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 5, identity: 0.828

agggccgcccccgctcggggaggcgcata	CRISPR spacer
ggggccgcctccgctcggggtggcgtaca	Protospacer
.********.********** ****.*.*

2. spacer 9.1|8538126|29|CP034539|CRISPRCasFinder matches to NC_047992 (Microbacterium phage Zeta1847, complete genome) position: , mismatch: 8, identity: 0.724

agggccgcccccgctcggggaggcgcata	CRISPR spacer
gcatccgcctccgctcggggaggcggcga	Protospacer
. . *****.***************   *

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 88808 : 167583 48 Streptomyces_phage(28.57%) transposase NA
DBSCAN-SWA_2 7308623 : 7358815 43 Bacillus_phage(66.67%) tRNA,transposase,protease NA
DBSCAN-SWA_3 8369984 : 8413795 32 Staphylococcus_prophage(33.33%) tail,transposase,plate NA
DBSCAN-SWA_4 10325643 : 10355554 27 Paenibacillus_phage(66.67%) transposase NA
DBSCAN-SWA_5 10429707 : 10491636 49 Paenibacillus_phage(33.33%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage