Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018585 Staphylococcus caprae JMUB145 DNA, complete genome 7 crisprs WYL,csa3,DEDDh,cas3,DinG 0 2 9 0

Results visualization

1. AP018585
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_1 472790-472879 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_2 491208-491350 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_3 659989-660071 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_4 1095185-1095307 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_5 1678000-1678093 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_6 1744763-1744993 Unclear NA
3 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018585_7 2260222-2260322 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018585_3 3.1|660014|33|AP018585|CRISPRCasFinder 660014-660046 33 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 110127-110159 7 0.788
AP018585_5 5.1|1678032|30|AP018585|CRISPRCasFinder 1678032-1678061 30 MT822287 Erwinia phage pEp_SNUABM_11, complete genome 472-501 8 0.733

1. spacer 3.1|660014|33|AP018585|CRISPRCasFinder matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tgcatttgtccaaagacaaatgtaaacatatgg-	CRISPR spacer
tatttttgtccaaagataaatgtaatca-atgct	Protospacer
*.. ************.******** ** ***  

2. spacer 5.1|1678032|30|AP018585|CRISPRCasFinder matches to MT822287 (Erwinia phage pEp_SNUABM_11, complete genome) position: , mismatch: 8, identity: 0.733

cttttggtaatacttgaatctacgcttcat	CRISPR spacer
cgtccattaatacttgaatctccgcttcgg	Protospacer
* *... ************** ******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 41411 : 90378 46 Staphylococcus_phage(84.62%) transposase NA
DBSCAN-SWA_2 585740 : 602020 16 Bacillus_phage(33.33%) protease,holin NA
DBSCAN-SWA_3 1134128 : 1175157 33 Staphylococcus_phage(96.3%) tRNA NA
DBSCAN-SWA_4 1292907 : 1302048 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 1431722 : 1441558 11 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_6 1791097 : 1858570 92 Staphylococcus_phage(89.39%) head,tRNA,portal,terminase,tail,holin,integrase attL 1796845:1796862|attR 1857326:1857343
DBSCAN-SWA_7 1948671 : 1957141 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2199484 : 2208399 9 uncultured_Caudovirales_phage(71.43%) NA NA
DBSCAN-SWA_9 2226439 : 2235427 11 Pandoravirus(12.5%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage