Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018586 Staphylococcus caprae JMUB590 DNA, complete genome 7 crisprs csa3,DEDDh,cas3,DinG 1 15 10 0

Results visualization

1. AP018586
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_2 465783-465872 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_3 484201-484343 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_4 652984-653066 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_5 1101491-1101613 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_6 1683813-1683906 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_7 1750575-1750805 Unclear NA
3 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018586_8 2263213-2263313 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 AP018586.1 342032-342059 1 0.964
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 AP018586.1 340778-340805 2 0.929

1. spacer 1.12|341570|28|AP018586|CRT matches to position: 342032-342059, mismatch: 1, identity: 0.964

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagtgactctgattcagacagcgattcc	Protospacer
********* ******************

2. spacer 1.12|341570|28|AP018586|CRT matches to position: 340778-340805, mismatch: 2, identity: 0.929

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagtgattcagactcagacagcgattcc	Protospacer
******.*****.***************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21151-21178 0 1.0
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21367-21394 0 1.0
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15772-15799 0 1.0
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15952-15979 0 1.0
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9709-9736 0 1.0
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9853-9880 0 1.0
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9997-10024 0 1.0
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21421-21454 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21133-21166 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21169-21202 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21331-21364 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15790-15823 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15934-15967 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9691-9724 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9727-9760 1 0.971
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9871-9904 1 0.971
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21295-21322 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21313-21340 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21349-21376 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21439-21466 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15754-15781 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15916-15943 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16499-16526 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17177-17204 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17831-17858 1 0.964
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19313-19340 1 0.964
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21403-21430 1 0.964
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15610-15643 2 0.941
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15916-15949 2 0.941
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21313-21346 2 0.941
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21421-21454 2 0.941
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15412-15439 2 0.929
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21205-21238 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21295-21328 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21349-21382 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15769 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15826-15859 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15754-15787 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9763-9796 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9907-9940 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9868 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18257-18290 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20045-20078 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16493-16526 2 0.941
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17171-17204 2 0.941
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21115-21142 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21133-21160 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21277-21304 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21331-21358 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21187-21214 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15898-15925 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15934-15961 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15808-15835 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9673-9700 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9979-10006 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9691-9718 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9601-9628 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9745-9772 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9889-9916 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18587-18614 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16661-16688 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16481-16508 2 0.929
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17159-17186 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21205-21232 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21043-21070 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15826-15853 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15538-15565 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15664-15691 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9763-9790 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9907-9934 2 0.929
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9601-9628 2 0.929
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15769 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15430-15463 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15754-15787 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21115-21148 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21295-21328 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21349-21382 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16493-16526 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17171-17204 3 0.912
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9673-9706 3 0.912
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15412-15439 3 0.893
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15520-15547 3 0.893
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15646-15673 3 0.893
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9565-9592 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9862 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9547-9574 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156019-156046 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156529-156556 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21025-21052 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21403-21430 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21439-21466 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1876-1903 3 0.893
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3232-3259 3 0.893
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21259-21292 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21313-21346 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21385-21418 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21403-21436 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21439-21472 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15610-15643 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15880-15913 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15916-15949 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15970-16003 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9961-9994 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9979-10012 3 0.912
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18581-18614 3 0.912
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21421-21448 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15610-15637 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15763 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9862 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18197-18224 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18641-18668 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19679-19706 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17021-17048 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20033-20060 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16793-16820 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17627-17654 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17789-17816 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18875-18902 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19058 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19271-19298 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155983-156010 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2212-2239 3 0.893
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2584-2611 3 0.893
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155983-156016 3 0.912
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15769 3 0.912
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21259-21286 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21421-21448 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21385-21412 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21439-21466 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15880-15907 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15430-15457 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15610-15637 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15763 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15970-15997 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9817-9844 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9862 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9961-9988 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16499-16526 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16517-16544 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16595-16622 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16907-16934 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17177-17204 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17195-17222 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18149-18176 3 0.893
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 152965-152992 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151906-151933 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153073-153100 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154567-154594 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156331-156358 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21097-21124 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 1156-1183 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15484-15511 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3052-3079 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3178-3205 3 0.893
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9655-9682 3 0.893
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15538-15571 4 0.882
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15664-15697 4 0.882
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21043-21076 4 0.882
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18581-18614 4 0.882
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9979-10012 4 0.882
AP018586_1 1.7|341264|28|AP018586|CRT 341264-341291 28 MT553347 Mycobacterium phage Awesomesauce, complete genome 54756-54783 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21079-21106 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21025-21052 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15466-15493 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15574-15601 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15700-15727 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9637-9664 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9547-9574 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9583-9610 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15826-15853 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15844-15871 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15898-15925 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15934-15961 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9691-9718 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9763-9790 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9781-9808 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9907-9934 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9925-9952 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153019-153046 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153145-153172 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153979-154006 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154567-154594 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21133-21160 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21205-21232 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21223-21250 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21277-21304 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21331-21358 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2092-2119 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3478-3505 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16457-16484 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17135-17162 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19907-19934 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16874 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17300 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18434 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18944 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19154 4 0.857
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19880 4 0.857
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21115-21148 4 0.882
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9673-9706 4 0.882
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9817-9850 4 0.882
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19739-19772 4 0.882
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16589-16622 4 0.882
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16901-16934 4 0.882
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18569-18596 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16703-16730 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18941-18968 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19631-19658 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16079-16106 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16211-16238 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16343-16370 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17369-17396 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17519-17546 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17585-17612 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18131-18158 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18245-18272 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18683-18710 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18833-18860 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19613-19640 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19727-19754 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19787-19814 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151245-151272 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151666-151693 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151720-151747 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153283-153310 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153301-153328 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153355-153382 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153409-153436 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153535-153562 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153763-153790 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154297-154324 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155677-155704 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155965-155992 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156001-156028 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156211-156238 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156763-156790 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156913-156940 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157219-157246 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157237-157264 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157327-157354 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 157453-157480 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1102-1129 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1228-1255 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1354-1381 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1426-1453 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1462-1489 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1666-1693 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1930-1957 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2902-2929 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3268-3295 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3598-3625 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3772-3799 4 0.857
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 958-985 4 0.857
AP018586_1 1.15|341738|46|AP018586|CRT 341738-341783 46 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15736-15781 4 0.913
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15610-15643 4 0.882
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21133-21160 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21169-21196 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21277-21304 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21331-21358 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15790-15817 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15898-15925 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15934-15961 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9691-9718 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9727-9754 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9871-9898 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16541-16568 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17219-17246 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18263-18290 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19631-19658 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19955-19982 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20051-20078 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16874 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17300 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17297-17324 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17669-17696 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17969-17996 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18173-18200 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18434 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18431-18458 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18944 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19154 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19151-19178 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19451-19478 4 0.857
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19880 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15592-15619 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15718-15745 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16124 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16256 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16388 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16664 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16838 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16976 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17066 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17414 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17672 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17834 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18332 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18728 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18920 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19076 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19316 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19832 4 0.857
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20006 4 0.857
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21223-21250 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21187-21214 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21241-21268 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15844-15871 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15592-15619 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15718-15745 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15808-15835 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15862-15889 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9781-9808 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9925-9952 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9745-9772 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9799-9826 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9889-9916 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9943-9970 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16457-16484 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17135-17162 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19907-19934 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1552-1579 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2680-2707 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3142-3169 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 154369-154396 5 0.821
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156457-156484 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16124 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16256 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16388 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16664 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16838 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16976 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17066 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17414 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17672 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17834 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17849-17876 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18101-18128 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18197-18224 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18332 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18641-18668 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18728 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18920 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19076 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19316 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19331-19358 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19583-19610 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19679-19706 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19832 5 0.821
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20006 5 0.821
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18599-18632 5 0.853
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19625-19658 5 0.853
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17003-17030 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17849-17876 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19331-19358 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16517-16544 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16871-16898 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16973-17000 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17195-17222 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17537-17564 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17873-17900 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17945-17972 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18149-18176 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18329-18356 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18353-18380 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19073-19100 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19355-19382 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19427-19454 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17903-17930 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19013-19040 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19385-19412 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NC_048174 Shigella phage HRP29, complete genome 896-923 5 0.821
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 MK562503 Shigella phage Buco, complete genome 896-923 5 0.821
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16541-16586 5 0.891
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17219-17264 5 0.891
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19031-19076 5 0.891
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17495-17522 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18077-18104 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18809-18836 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19559-19586 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20069-20096 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16151-16178 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16283-16310 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16415-16442 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17093-17120 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18023-18050 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18533-18560 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18965-18992 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19505-19532 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19745-19772 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16124 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16256 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16388 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16664 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16838 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16976 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17066 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17414 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17672 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17834 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17849-17876 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18197-18224 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18332 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18641-18668 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18728 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18920 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19076 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19316 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19331-19358 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19655-19682 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19679-19706 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19832 5 0.821
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20006 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1192-1219 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16874 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17300 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17468 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18434 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18632 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18782 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18944 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19154 5 0.821
AP018586_1 1.19|341996|28|AP018586|CRT 341996-342023 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19880 5 0.821
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19625-19658 6 0.824
AP018586_1 1.6|341210|28|AP018586|CRT 341210-341237 28 MG592576 Vibrio phage 1.206.O._10N.222.51.B10, partial genome 13163-13190 6 0.786
AP018586_1 1.6|341210|28|AP018586|CRT 341210-341237 28 MG592534 Vibrio phage 1.167.O._10N.261.51.F2, partial genome 13433-13460 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21097-21124 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21259-21286 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15484-15511 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15880-15907 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9655-9682 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9817-9844 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9835-9862 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18101-18128 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19583-19610 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1066-1093 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1624-1651 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1966-1993 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3556-3583 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 153919-153946 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 156565-156592 6 0.786
AP018586_1 1.9|341372|28|AP018586|CRT 341372-341399 28 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 994-1021 6 0.786
AP018586_1 1.10|341426|46|AP018586|CRT 341426-341471 46 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15412-15457 6 0.87
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3574-3601 6 0.786
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18569-18596 6 0.786
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17468 6 0.786
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18632 6 0.786
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18782 6 0.786
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20093-20120 6 0.786
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16091-16124 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16223-16256 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16355-16388 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16511-16544 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16631-16664 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16943-16976 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17033-17066 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17189-17222 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17381-17414 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17843-17876 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18071-18104 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18143-18176 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18299-18332 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18695-18728 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19325-19358 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19553-19586 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19799-19832 6 0.824
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20063-20096 6 0.824
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16619-16646 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16679-16706 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16931-16958 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18287-18314 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16874 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17300 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17297-17324 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17468 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17669-17696 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17969-17996 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18173-18200 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18434 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18431-18458 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18632 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18782 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18944 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19154 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19151-19178 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19451-19478 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19880 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20093-20120 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1786-1813 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2476-2503 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 3652-3679 6 0.786
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1702-1729 6 0.786
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18023-18068 6 0.87
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18965-19010 6 0.87
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19505-19550 6 0.87
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20051-20096 6 0.87
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16727-16754 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17561-17588 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17723-17750 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18221-18248 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18485-18512 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19205-19232 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19703-19730 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17441-17468 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17471-17498 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17903-17930 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18131-18158 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18383-18410 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18605-18632 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18755-18782 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18785-18812 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19013-19040 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19103-19130 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19385-19412 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19613-19640 6 0.786
AP018586_1 1.18|341942|28|AP018586|CRT 341942-341969 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19835-19862 6 0.786
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16511-16544 7 0.794
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17189-17222 7 0.794
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17843-17876 7 0.794
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18143-18176 7 0.794
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19325-19358 7 0.794
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1642-1669 7 0.75
AP018586_1 1.12|341570|28|AP018586|CRT 341570-341597 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17003-17030 7 0.75
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16145-16178 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16277-16310 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16409-16442 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16721-16754 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17087-17120 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17555-17588 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17717-17750 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18017-18050 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18215-18248 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18479-18512 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18527-18560 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18959-18992 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19043-19076 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19199-19232 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19499-19532 7 0.794
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19697-19730 7 0.794
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17999-18026 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18461-18488 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19481-19508 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16124 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16256 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16388 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16664 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16838 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16976 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17066 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17414 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17672 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17834 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18101-18128 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18332 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18728 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18920 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19076 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19316 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19583-19610 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19655-19682 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19832 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20006 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 151263-151290 7 0.75
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2338-2365 7 0.75
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 976-1009 7 0.794
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 CP052430 Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence 940-973 7 0.794
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19835-19880 7 0.848
AP018586_4 4.1|653009|33|AP018586|CRISPRCasFinder 653009-653041 33 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 110127-110159 7 0.788
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18125-18158 8 0.765
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19607-19640 8 0.765
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17435-17468 8 0.765
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18749-18782 8 0.765
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16127-16154 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16259-16286 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16391-16418 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17069-17096 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17327-17354 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17417-17444 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17699-17726 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18731-18758 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19181-19208 8 0.714
AP018586_1 1.14|341684|28|AP018586|CRT 341684-341711 28 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20009-20036 8 0.714
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 1648-1681 8 0.765
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16595-16640 8 0.826
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16907-16952 8 0.826
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18533-18578 8 0.826
AP018586_6 6.1|1683845|30|AP018586|CRISPRCasFinder 1683845-1683874 30 MT822287 Erwinia phage pEp_SNUABM_11, complete genome 472-501 8 0.733
AP018586_1 1.1|340808|34|AP018586|CRT 340808-340841 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19649-19682 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16535-16568 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17213-17246 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17489-17522 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18803-18836 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19949-19982 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18125-18158 9 0.735
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19607-19640 9 0.735
AP018586_1 1.17|341870|46|AP018586|CRT 341870-341915 46 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18263-18308 9 0.804
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19649-19682 10 0.706
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19973-20006 10 0.706
AP018586_1 1.13|341624|34|AP018586|CRT 341624-341657 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19919-19952 10 0.706
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18125-18158 10 0.706
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19607-19640 10 0.706
AP018586_1 1.16|341810|34|AP018586|CRT 341810-341843 34 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19919-19952 10 0.706

1. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

2. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

3. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

4. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

5. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

6. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

7. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgactca	Protospacer
****************************

8. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgactca	Protospacer
.*********************************

9. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactca	Protospacer
************************.*********

10. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagattcagatagcgactca	Protospacer
************.*********************

11. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactca	Protospacer
************************.*********

12. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagattcagatagcgactca	Protospacer
************.*********************

13. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactca	Protospacer
************************.*********

14. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgactca	Protospacer
************************.*********

15. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagattcagatagcgactca	Protospacer
************.*********************

16. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagattcagatagcgactca	Protospacer
************.*********************

17. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactca	Protospacer
.***************************

18. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactca	Protospacer
.***************************

19. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactca	Protospacer
.***************************

20. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagattcagacagcgactca	Protospacer
************.***************

21. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactca	Protospacer
.***************************

22. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactca	Protospacer
.***************************

23. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgactca	Protospacer
******************.*********

24. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgactca	Protospacer
******************.*********

25. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgactca	Protospacer
********* ******************

26. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgactca	Protospacer
********* ******************

27. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagattcagatagcgattca	Protospacer
*************************** 

28. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagactcagatagcgactcc	Protospacer
***************************.***** 

29. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactca	Protospacer
************************.**.******

30. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactca	Protospacer
************************.**.******

31. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgactca	Protospacer
******************.********.******

32. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagtgattcagattcagacagcgattct	Protospacer
******.********************.

33. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattca	Protospacer
.*****************************.***

34. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactca	Protospacer
******************.*****.*********

35. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactca	Protospacer
******************.*****.*********

36. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagatagcgactcc	Protospacer
******************.************** 

37. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattca	Protospacer
.*****************************.***

38. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactca	Protospacer
******************.*****.*********

39. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattca	Protospacer
.*****************************.***

40. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagattcagatagcgattca	Protospacer
.*****************************.***

41. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagattcagacagcgattca	Protospacer
************************.*****.***

42. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagatagcgactct	Protospacer
*************** ***************** 

43. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagatagcgactct	Protospacer
*************** ***************** 

44. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgactca	Protospacer
******.***********.***************

45. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgactca	Protospacer
******.***********.***************

46. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactcc	Protospacer
.************************** 

47. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.***********.***************

48. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgattca	Protospacer
.***********************.***

49. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.***********.***************

50. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
******.*****************.***

51. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgattca	Protospacer
.***********************.***

52. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.***********.***************

53. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
******.*****************.***

54. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactcc	Protospacer
.************************** 

55. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactcc	Protospacer
.************************** 

56. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.***********.***************

57. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgattca	Protospacer
******************.*****.***

58. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
******.*****************.***

59. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
******.*****************.***

60. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgactct	Protospacer
.************************** 

61. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgactct	Protospacer
********* ***************** 

62. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagatagcgactca	Protospacer
********* ********.*********

63. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagatagcgactca	Protospacer
********* ********.*********

64. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.************************** 

65. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagtgattcc	Protospacer
************.********.******

66. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.************************** 

67. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagtgattcc	Protospacer
************.********.******

68. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagtgattcc	Protospacer
************.********.******

69. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.************************** 

70. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.************************** 

71. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgattca	Protospacer
************.************** 

72. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagatagcgactcc	Protospacer
.**************************.***** 

73. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagtgattca	Protospacer
.*****.***********************.***

74. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactca	Protospacer
.***********************.**.******

75. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc	Protospacer
************************.**.***** 

76. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactca	Protospacer
.***********************.**.******

77. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactca	Protospacer
.***********************.**.******

78. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgactca	Protospacer
.*****.********************.******

79. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgactca	Protospacer
.*****.********************.******

80. spacer 1.1|340808|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc	Protospacer
************************.**.***** 

81. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagtgattcagattcagacagcgattct	Protospacer
* *******************.*****.

82. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagtgattccgattcagatagtgattcc	Protospacer
* ******* ********.*********

83. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagtgattccgattcagatagtgattcc	Protospacer
* ******* ********.*********

84. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagtgattccgattcagatagtgattcc	Protospacer
* ******* ********.*********

85. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgattca	Protospacer
.**.*********************** 

86. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagtgattccgattcagacagcgattct	Protospacer
******.** *****************.

87. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactccgattcggacagcgattcc	Protospacer
.******** *****.************

88. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactcggattccgacagcgattcc	Protospacer
.********.***** ************

89. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagtgattccgattcagacagcgattct	Protospacer
******.** *****************.

90. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactcagattcagatagcgattca	Protospacer
***.**************.******** 

91. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactcagattcagacagcgactca	Protospacer
***.********************.** 

92. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactcggattctgacagcgattcc	Protospacer
.********.***** ************

93. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactccgattcggacagcgattcc	Protospacer
.******** *****.************

94. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagattcagatagcgattcg	Protospacer
************.*****************.**.

95. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactca	Protospacer
.*****************.*****.*********

96. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgattcagattcagatagcgactca	Protospacer
.*****.*****.*********************

97. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgactcagattcagatagcgattca	Protospacer
.*****.***********************.***

98. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
atcagatagcgactcagattcagacagcgactca	Protospacer
 *****.*****************.*********

99. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagactcagatagcgactcc	Protospacer
.*****************.************** 

100. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagattcagatagcgattcg	Protospacer
************.*****************.**.

101. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactca	Protospacer
.*****************.*****.*********

102. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
atcagatagcgactcagattcaggtagcgactca	Protospacer
 *****.****************.**********

103. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactccgattcagatagcgattcg	Protospacer
*************** **************.**.

104. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactcc	Protospacer
******************.*****.******** 

105. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactct	Protospacer
******************.*****.******** 

106. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagattcagatagcgactca	Protospacer
.***********.*****.*********

107. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagatagcgactcc	Protospacer
.*****************.******** 

108. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagatagcgactcc	Protospacer
.*****************.******** 

109. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagattcagacagcgattca	Protospacer
.***********.***********.***

110. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
*************************   

111. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
*************************   

112. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
*************************   

113. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactcagacagcgactct	Protospacer
.******** ***************** 

114. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgattcagactcagacagcgactct	Protospacer
.*****.******************** 

115. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactctgacagcgactct	Protospacer
******.******** *********** 

116. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactctgacagcgactct	Protospacer
******.******** *********** 

117. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactctgacagcgactct	Protospacer
******.******** *********** 

118. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactctgacagcgactct	Protospacer
******.******** *********** 

119. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgactct	Protospacer
********* **.************** 

120. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactctgacagcgactct	Protospacer
******.******** *********** 

121. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactcagacagcgactcg	Protospacer
.********.*****************.

122. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactccgacagcgactcg	Protospacer
.************** ***********.

123. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactccgacagcgactct	Protospacer
.************** *********** 

124. spacer 1.16|341810|34|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ctcagacagcgactcggactcagacagcgactcg	Protospacer
************************.**.*****.

125. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagatagcgactcc	Protospacer
***************.***********.***** 

126. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgattcg	Protospacer
.*****.******************** 

127. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgactca	Protospacer
.***********************.** 

128. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagattcagatagcgactca	Protospacer
******.*****************.** 

129. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagattcagacagcgactca	Protospacer
******************.*****.** 

130. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgattcg	Protospacer
.*****.******************** 

131. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagtgattca	Protospacer
************.********.***** 

132. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagactcagatagcgactcc	Protospacer
.***********.***********.***

133. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagactcagatagcgactcc	Protospacer
.***********.***********.***

134. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagattcaggtagcgactca	Protospacer
*****************.******.** 

135. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgattcg	Protospacer
.*****.******************** 

136. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgattca	Protospacer
.*****************.******** 

137. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactccgattcagatagcgattcg	Protospacer
.******** ***************** 

138. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgactca	Protospacer
************.***********.** 

139. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgatagc	Protospacer
************.************  *

140. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgactct	Protospacer
********* **************.**.

141. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgactct	Protospacer
********* **************.**.

142. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgactca	Protospacer
************.***********.** 

143. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgatagc	Protospacer
************.************  *

144. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgatagc	Protospacer
************.************  *

145. spacer 1.18|341942|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagattccgatagcgattca	Protospacer
******.******** *********** 

146. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactctgactcggacagtgattcg	Protospacer
************.**.*********** 

147. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactccgattcggacagtgattcg	Protospacer
*********.*****.*********** 

148. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactctgattcggacagcgattcg	Protospacer
***************.*****.***** 

149. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactcggattcggacagtgattcg	Protospacer
********* *****.*********** 

150. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactccgattcagacagtgattca	Protospacer
***.*****.***************** 

151. spacer 1.19|341996|28|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactccgattctgacagtgattcg	Protospacer
*********.***** *********** 

152. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactccgattcagacagtgattca	Protospacer
***.*****.***************** 

153. spacer 1.19|341996|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactcggattcggacagtgattcg	Protospacer
********* *****.*********** 

154. spacer 1.19|341996|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagtgactccgattccgacagtgattcg	Protospacer
*********.***** *********** 

155. spacer 1.19|341996|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactccgattcagacagtgattca	Protospacer
***.*****.***************** 

156. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagtgattcc	Protospacer
.*****.***********************.** 

157. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagtgattcc	Protospacer
.*****.***********************.** 

158. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.882

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagtgattcc	Protospacer
.*****.***********************.** 

159. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactct	Protospacer
.***********************.**.***** 

160. spacer 1.1|340808|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgactcc	Protospacer
.***********************.**.***** 

161. spacer 1.7|341264|28|AP018586|CRT matches to MT553347 (Mycobacterium phage Awesomesauce, complete genome) position: , mismatch: 4, identity: 0.857

ttgtggctccgactccgattgtggttca	CRISPR spacer
tggtgactccgattccgattgtggttcc	Protospacer
* ***.******.************** 

162. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagtgattca	Protospacer
. **********.************** 

163. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagtgattccgattcagacagcgattct	Protospacer
* ******* ***********.*****.

164. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagtgattca	Protospacer
. **********.************** 

165. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagtgattca	Protospacer
. **********.************** 

166. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagtgattca	Protospacer
. **********.************** 

167. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagtgattca	Protospacer
. **********.************** 

168. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagtgattccgattcagacagcgattct	Protospacer
* ******* ***********.*****.

169. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcagactcagatagtgattcc	Protospacer
* *.********.*****.*********

170. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.**.**************.******** 

171. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
.*****.*****************.** 

172. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgattca	Protospacer
.**.********.************** 

173. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.**.********************.** 

174. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.**.********************.** 

175. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.**.**************.******** 

176. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
.*****.*****************.** 

177. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.**.**************.******** 

178. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
.*****.*****************.** 

179. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactcggattcggacagcgattcg	Protospacer
.********.*****.*********** 

180. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactcggattctgacagcgattcg	Protospacer
.********.***** *********** 

181. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactccgattctgacagcgattcg	Protospacer
.******** ***** *********** 

182. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactctgattcggacagcgattcg	Protospacer
.******** *****.*********** 

183. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.**.********************.** 

184. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagatagcgattca	Protospacer
.**.**************.******** 

185. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
.*****.*****************.** 

186. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgattca	Protospacer
.**.********.************** 

187. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.**.********************.** 

188. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactcggattctgacagcgattct	Protospacer
.********.***** ***********.

189. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgactcggattctgacagcgattcg	Protospacer
.********.***** *********** 

190. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagattcagacagcgatagc	Protospacer
.*****.******************  *

191. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagattcagacagcgatagc	Protospacer
.*****.******************  *

192. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagactcagacagcgattca	Protospacer
.*****.*****.************** 

193. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
***.***** ***************  *

194. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
***.***** ***************  *

195. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
***.***** ***************  *

196. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
***.***** ***************  *

197. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
***.***** ***************  *

198. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
***.***** ***************  *

199. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc	Protospacer
.*****************.*****.******** 

200. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc	Protospacer
.*****************.*****.******** 

201. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgattcagattcagatagcgattcg	Protospacer
.***********.*****************.**.

202. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagatagcgacagc	Protospacer
*************** ***************   

203. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgactctgattcagatagcgactct	Protospacer
.*****.******** ***************** 

204. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgactctgattcagatagcgactct	Protospacer
.*****.******** ***************** 

205. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
ctctgactcagactcagacagcgactca	Protospacer
.  .************************

206. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgacagc	Protospacer
********* ***************   

207. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgacagc	Protospacer
********* ***************   

208. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgacagc	Protospacer
******************.******   

209. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

210. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

211. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

212. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

213. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

214. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

215. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
ttcagactcagactcagatagcgactca	Protospacer
*   **************.*********

216. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

217. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

218. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

219. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
ttcagactcagactcagatagcgactca	Protospacer
*   **************.*********

220. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

221. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgactct	Protospacer
.**.**.******************** 

222. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcg	Protospacer
.********.***** ***********.

223. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

224. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

225. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcc	Protospacer
.********.***** *********** 

226. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcg	Protospacer
.********.***** ***********.

227. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

228. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

229. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactccgactccgacagcgactcg	Protospacer
.******** ***** ***********.

230. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcc	Protospacer
.********.***** *********** 

231. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcc	Protospacer
.********.***** *********** 

232. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

233. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

234. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgattccgactcagacagcgactcg	Protospacer
.*****.** *****************.

235. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcg	Protospacer
.********.***** ***********.

236. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcc	Protospacer
.********.***** *********** 

237. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactccgacagcgactcc	Protospacer
.********.***** *********** 

238. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

239. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

240. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcc	Protospacer
.********.***** *********** 

241. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

242. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcg	Protospacer
.********.***** ***********.

243. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactccgactccgacagcgactcg	Protospacer
.******** ***** ***********.

244. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactctgacagcgactcc	Protospacer
.******** ***** *********** 

245. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactccgactccgacagcgactct	Protospacer
.******** ***** *********** 

246. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactcggacagcgactcg	Protospacer
.******** *****.***********.

247. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactcggacagcgactcg	Protospacer
.******** *****.***********.

248. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactccgactcggacagcgactcg	Protospacer
.******** *****.***********.

249. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactccgacagcgactcg	Protospacer
.******** ***** ***********.

250. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcggactctgacagcgactcc	Protospacer
.********.***** *********** 

251. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactccgactcggacagcgactct	Protospacer
.******** *****.*********** 

252. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactcggacagcgactcc	Protospacer
.******** *****.*********** 

253. spacer 1.14|341684|28|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactccgactccgacagcgactcg	Protospacer
.******** ***** ***********.

254. spacer 1.15|341738|46|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.913

tagcgactcagactcagacagcgactcggactcagatagtgactca	CRISPR spacer
cagcgactcagactcagacagcgactcagactcagatagcgactcc	Protospacer
.**************************.***********.***** 

255. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ttcagacagcgactcagactcagatagcgactcc	Protospacer
.**************.***********.***** 

256. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.** 

257. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgactca	Protospacer
.*****.*****************.** 

258. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgattca	Protospacer
.***********.*****.******** 

259. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.** 

260. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgactca	Protospacer
.*****.*****************.** 

261. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgattca	Protospacer
.***********.*****.******** 

262. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.** 

263. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagattcagacagcgactca	Protospacer
.*****************.*****.** 

264. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgactca	Protospacer
.*****.*****************.** 

265. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagattcagatagcgactca	Protospacer
.*****.*****************.** 

266. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagc	Protospacer
********* **************.  *

267. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagc	Protospacer
********* **************.  *

268. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgactct	Protospacer
.******** **************.**.

269. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagatagcgacagc	Protospacer
************.***********.  *

270. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagc	Protospacer
********* **************.  *

271. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgactct	Protospacer
.******** **************.**.

272. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* ********.******  *

273. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* ********.******  *

274. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

275. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

276. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

277. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

278. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* ********.******  *

279. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

280. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* ********.******  *

281. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* ********.******  *

282. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

283. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.*****.************  *

284. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* ********.******  *

285. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactccgattcagacagtgattca	Protospacer
.**.*****.***************** 

286. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactccgattcagacagtgattca	Protospacer
.**.*****.***************** 

287. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

288. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

289. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

290. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

291. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

292. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

293. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

294. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

295. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

296. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

297. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

298. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

299. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

300. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

301. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

302. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

303. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
***.*****************.***  *

304. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
. *******************.**.** 

305. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
* *.********.********.***** 

306. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcggactcagacagtgattca	Protospacer
* *.*****.**.************** 

307. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
. *******************.**.** 

308. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgactccgattcagacagtgattca	Protospacer
* *.**.** ***************** 

309. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgactccgattcagacagtgattca	Protospacer
* *.**.** ***************** 

310. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
* *.********.********.***** 

311. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcggactcagacagtgattca	Protospacer
* *.*****.**.************** 

312. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
. *******************.**.** 

313. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagattcagacagcgactca	Protospacer
. *******************.**.** 

314. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
* *.********.********.***** 

315. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcggactcagacagtgattca	Protospacer
* *.*****.**.************** 

316. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcagactcagacagcgattca	Protospacer
* *.********.********.***** 

317. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgattcggactcagacagtgattca	Protospacer
* *.*****.**.************** 

318. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagattcagacagcgatagc	Protospacer
. *******************.***  *

319. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagattcagacagcgatagc	Protospacer
. *******************.***  *

320. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagcgattca	Protospacer
. **********.********.***** 

321. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcggattccgacagtgattcg	Protospacer
. *******.***** *********** 

322. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcggattctgacagtgattcc	Protospacer
. *.*****.***** ************

323. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcggattccgacagtgattcc	Protospacer
. *.*****.***** ************

324. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattccgattctgacagtgattcc	Protospacer
. *.***** ***** ************

325. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattccgattctgacagtgattcc	Protospacer
. *.***** ***** ************

326. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

327. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

328. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

329. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

330. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

331. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

332. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

333. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

334. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

335. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

336. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgatagc	Protospacer
.**.********.************  *

337. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagactcagacagcgatagc	Protospacer
.*****.*****.************  *

338. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
***.********.***********.  *

339. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

340. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
***.********.***********.  *

341. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

342. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

343. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

344. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

345. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgatagc	Protospacer
.**.********.************  *

346. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagactcagacagcgatagc	Protospacer
.*****.*****.************  *

347. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
***.********.***********.  *

348. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

349. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.**.***** ***************  *

350. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgacagc	Protospacer
*************** ********.******   

351. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgacagc	Protospacer
******.***********.************   

352. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactcagactcagacagcgactct	Protospacer
.   *********************** 

353. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgatagc	Protospacer
.***********************.   

354. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactcagactcagacagcgatagc	Protospacer
.***********************.   

355. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgatagc	Protospacer
******************.*****.   

356. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

357. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

358. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgatagc	Protospacer
******************.*****.   

359. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactcagacagcgacagc	Protospacer
.******** ***************   

360. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

361. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

362. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactcagactcagatagcgatagc	Protospacer
******************.*****.   

363. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

364. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

365. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

366. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

367. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgactcagacagcgatagc	Protospacer
********* **************.   

368. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
ttcagactcagactcagatagcgactct	Protospacer
*   **************.******** 

369. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
ttcagactcagactcagatagcgactct	Protospacer
*   **************.******** 

370. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagactcagacagcgactca	CRISPR spacer
ttcagactcagactcagatagcgactct	Protospacer
*   **************.******** 

371. spacer 1.14|341684|28|AP018586|CRT matches to NC_048174 (Shigella phage HRP29, complete genome) position: , mismatch: 5, identity: 0.821

-tagcgactcagactcagacagcgactca	CRISPR spacer
gttgt-actcagcctcagacagcgcctca	Protospacer
 * *. ****** *********** ****

372. spacer 1.14|341684|28|AP018586|CRT matches to MK562503 (Shigella phage Buco, complete genome) position: , mismatch: 5, identity: 0.821

-tagcgactcagactcagacagcgactca	CRISPR spacer
gttgt-actcagcctcagacagcgcctca	Protospacer
 * *. ****** *********** ****

373. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagc	Protospacer
*************************  ****************  .

374. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagc	Protospacer
*************************  ****************  .

375. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
tagcgactctgattcagacagcgactctgattcagacagcgatagc	Protospacer
******************.********.***************  .

376. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagt	Protospacer
********* **************.  .

377. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagt	Protospacer
********* **************.  .

378. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagt	Protospacer
********* **************.  .

379. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagt	Protospacer
********* **************.  .

380. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactctgattcagatagcgacagt	Protospacer
********* **************.  .

381. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

382. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

383. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

384. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

385. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

386. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

387. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

388. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

389. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagc	Protospacer
.******** **************.  *

390. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

391. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

392. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

393. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

394. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

395. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

396. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

397. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

398. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

399. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

400. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgatagc	Protospacer
.***********.*****.******  *

401. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
************.*****.*****.  *

402. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

403. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
************.*****.*****.  *

404. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

405. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

406. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

407. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

408. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactcagactcagacagcgatagc	Protospacer
.***********.*****.******  *

409. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgattcagactcagatagcgatagc	Protospacer
.*****.*****.************  *

410. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
tagcgactcagactcagacagcgacagc	Protospacer
************.*****.*****.  *

411. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

412. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** ********.******  *

413. spacer 1.19|341996|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
ctccgactctgattccgacagtgattcg	Protospacer
*  .*********** *********** 

414. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
.**.*****************.***  *

415. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
.**.*****************.***  *

416. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
***.*****************.**.  *

417. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
.**.*****************.***  *

418. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
***.*****************.**.  *

419. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
***.*****************.**.  *

420. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
.**.*****************.***  *

421. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
.**.*****************.***  *

422. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821

cagtgactctgattcagacagtgattcc	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
.**.*****************.***  *

423. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgacagc	Protospacer
.*****.********************.***   

424. spacer 1.6|341210|28|AP018586|CRT matches to MG592576 (Vibrio phage 1.206.O._10N.222.51.B10, partial genome) position: , mismatch: 6, identity: 0.786

ctgtggctcagactcagactgtgattca	CRISPR spacer
ttatggctcagacccagacagtgatttt	Protospacer
.*.**********.***** ******. 

425. spacer 1.6|341210|28|AP018586|CRT matches to MG592534 (Vibrio phage 1.167.O._10N.261.51.F2, partial genome) position: , mismatch: 6, identity: 0.786

ctgtggctcagactcagactgtgattca	CRISPR spacer
ttatggctcagacccagacagtgatttt	Protospacer
.*.**********.***** ******. 

426. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgactccgattcagacagtgattca	Protospacer
. *.**.** ***************** 

427. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcagattcagatagcgattcg	Protospacer
. *.**************.**.***** 

428. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgactccgattcagacagtgattca	Protospacer
. *.**.** ***************** 

429. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcagattcagatagcgattcg	Protospacer
. *.**************.**.***** 

430. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgactccgattcagacagtgattca	Protospacer
. *.**.** ***************** 

431. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcagattcagatagcgattcg	Protospacer
. *.**************.**.***** 

432. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgactcagattcagacagcgattca	Protospacer
. *.**.**************.***** 

433. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagcgatagc	Protospacer
. **********.********.***  *

434. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagtgattcagactcagacagcgatagc	Protospacer
. **********.********.***  *

435. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcggattctgacagtgattcg	Protospacer
. *.*****.***** *********** 

436. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcggattccgacagtgattcg	Protospacer
. *.*****.***** *********** 

437. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattccgattccgacagtgattcg	Protospacer
. *.***** ***** *********** 

438. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcggattccgacagtgattcg	Protospacer
. *.*****.***** *********** 

439. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
ctccgattcggattctgacagtgattcg	Protospacer
.* .*****.***** *********** 

440. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattcggattctgacagtgattcg	Protospacer
. *.*****.***** *********** 

441. spacer 1.9|341372|28|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.786

ttgtgattcagattcagacagtgattcc	CRISPR spacer
cagcgattccgattccgacagtgattcg	Protospacer
. *.***** ***** *********** 

442. spacer 1.10|341426|46|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.87

ttgtggctcagactcagattgtgattcagattcagacagtgattcc	CRISPR spacer
tagcgactcagactcagatagtgattcagattcagacagcgattct	Protospacer
* *.*.************* *******************.*****.

443. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

tagtgactcagattcagacagcgattcc	CRISPR spacer
ctctgactccgattcggacagcgattcg	Protospacer
.  ****** *****.*********** 

444. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagtgactcagattcagacagcgattcc	CRISPR spacer
ctctgactcagactcagacagcgactca	Protospacer
.  *********.***********.** 

445. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.**.***** **************.  *

446. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.**.***** **************.  *

447. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.**.***** **************.  *

448. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagtgactcagattcagacagcgattcc	CRISPR spacer
cagtgattcagactcagacagcgacagc	Protospacer
.*****.*****.***********.  *

449. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

450. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

451. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

452. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc	Protospacer
******.***********.***********.   

453. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

454. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

455. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

456. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc	Protospacer
******.***********.***********.   

457. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

458. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc	Protospacer
******************.*****.*****.   

459. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgactctgattcagatagcgacagt	Protospacer
.*****.******** ***************   

460. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc	Protospacer
******.***********.***********.   

461. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

462. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

463. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc	Protospacer
******************.*****.*****.   

464. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgactctgattcagatagcgacagt	Protospacer
.*****.******** ***************   

465. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc	Protospacer
*************** ********.*****.   

466. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagatagcgactctgattcagatagcgacagt	Protospacer
.*****.******** ***************   

467. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
ctctgattcagactcagacagcgactct	Protospacer
.  .**.******************** 

468. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactcagacagcgatagc	Protospacer
.******** **************.   

469. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
ctctgattcagactcagacagcgactct	Protospacer
.  .**.******************** 

470. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
ctctgattcagactcagacagcgactct	Protospacer
.  .**.******************** 

471. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* **.***********.   

472. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* **.***********.   

473. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

474. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.******** **.************   

475. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

476. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

477. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

478. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* **.***********.   

479. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

480. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.******** **.************   

481. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.******** **.************   

482. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* **.***********.   

483. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* **.***********.   

484. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

485. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgattcagactcagatagcgatagc	Protospacer
******.***********.*****.   

486. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
tagcgactctgattcagacagcgatagc	Protospacer
********* **.***********.   

487. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgacagc	Protospacer
.**.**.******************   

488. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactccgacagcgacagt	Protospacer
.******** ***** *********   

489. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgactctgacagcgacagt	Protospacer
.******** ***** *********   

490. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
ctccgactccgactctgacagcgactcg	Protospacer
.  ****** ***** ***********.

491. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786

tagcgactcagactcagacagcgactca	CRISPR spacer
ttcggactcggactctgacagcgactcg	Protospacer
*   *****.***** ***********.

492. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagc	Protospacer
.************************  ****************  .

493. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagc	Protospacer
.************************  ****************  .

494. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagc	Protospacer
.************************  ****************  .

495. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
cagcgactctgattcagatagcgactctgattcagatagcgacagt	Protospacer
.**************************.********.*****.  *

496. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

497. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

498. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

499. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

500. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

501. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

502. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagatagcgacagt	Protospacer
.******** **************.  .

503. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.******** ********.*****.  *

504. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgatagc	Protospacer
*   ********.************  *

505. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgactct	Protospacer
*   ********.***********.**.

506. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgactca	Protospacer
*   ********.***********.** 

507. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgatagc	Protospacer
*   ********.************  *

508. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.******** ********.*****.  *

509. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
cagcgactctgattcagacagcgacagc	Protospacer
.******** ********.*****.  *

510. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgatagc	Protospacer
*   ********.************  *

511. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgactct	Protospacer
*   ********.***********.**.

512. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgatagc	Protospacer
*   ********.************  *

513. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgactct	Protospacer
*   ********.***********.**.

514. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactcagactcagatagcgactca	Protospacer
*   ********.***********.** 

515. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786

tagcgactcagattcagatagcgattcc	CRISPR spacer
ttcagactctgattcagatagcgactct	Protospacer
*   ***** **************.**.

516. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc	Protospacer
.*****.********************.**.   

517. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc	Protospacer
.*****.********************.**.   

518. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc	Protospacer
.***********************.**.**.   

519. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc	Protospacer
.*****.********************.**.   

520. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc	Protospacer
.***********************.**.**.   

521. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.75

tagtgactcagattcagacagcgattcc	CRISPR spacer
ctcggactccgattcggacagcgattcg	Protospacer
.   ***** *****.*********** 

522. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagtgactcagattcagacagcgattcc	CRISPR spacer
ctcagactcagactcagacagcgactct	Protospacer
.   ********.***********.**.

523. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

524. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

525. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

526. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

527. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

528. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

529. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

530. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

531. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

532. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

533. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

534. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

535. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ttcagacagcgactctgattcagacagcgatagc	Protospacer
.************** ********.*****.   

536. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

537. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc	Protospacer
*   *********** ***************   

538. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt	Protospacer
*   *********** ***************   

539. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactcagactcagacagcgacagc	Protospacer
.   *********************   

540. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactcagactcagacagcgacagc	Protospacer
.   *********************   

541. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactcagactcagacagcgacagc	Protospacer
.   *********************   

542. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

543. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

544. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

545. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

546. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

547. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

548. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

549. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

550. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

551. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

552. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgatagc	Protospacer
.**.**.*****************.   

553. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

554. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

555. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

556. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

557. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

558. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagtgattcagactcagacagcgatagc	Protospacer
.**.**.*****************.   

559. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgattcagactcagatagcgatagc	Protospacer
.*****.***********.*****.   

560. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

561. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
cagcgactctgattcagacagcgatagc	Protospacer
.******** **.***********.   

562. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
ctctgactctgactctgacagcgactcg	Protospacer
.  .***** ***** ***********.

563. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.75

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcggactcggactcggacagcgactcg	Protospacer
.   *****.*****.***********.

564. spacer 1.16|341810|34|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ctccgacagcgactcggactctgattccgattcc	Protospacer
*** ***************** ***  .**.** 

565. spacer 1.16|341810|34|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.794

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ctccgacagcgactcggactctgattccgattcc	Protospacer
*** ***************** ***  .**.** 

566. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
ttcagactctgattcagatagcgactctgattcagacagcgatagc	Protospacer
*   ***********************.***************  .

567. spacer 4.1|653009|33|AP018586|CRISPRCasFinder matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tgcatttgtccaaagacaaatgtaaacatatgg-	CRISPR spacer
tatttttgtccaaagataaatgtaatca-atgct	Protospacer
*.. ************.******** ** ***  

568. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactca	Protospacer
*   **.   *****************.******

569. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactca	Protospacer
*   **.   *****************.******

570. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagacagcgacagc	Protospacer
*   *********** ********.******   

571. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
cagcgacagcgactctgattcagacagcgacagc	Protospacer
*   *********** ********.******   

572. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

573. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

574. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

575. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

576. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

577. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

578. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

579. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

580. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

581. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714

tagcgactcagactcagacagcgactca	CRISPR spacer
ctcagactctgactcagacagcgacagc	Protospacer
.   ***** ***************   

582. spacer 1.16|341810|34|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ctcggacagcgactcggactccgattcggacagc	Protospacer
***.***************** ***   ***   

583. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
tagcgactctgattcagatagcgactctgattcagactcagacagc	Protospacer
***************************.*********   **.  .

584. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
tagcgactctgattcagatagcgactctgattcagactcagacagc	Protospacer
***************************.*********   **.  .

585. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagactctgactca	Protospacer
.************************  **********  .**.** 

586. spacer 6.1|1683845|30|AP018586|CRISPRCasFinder matches to MT822287 (Erwinia phage pEp_SNUABM_11, complete genome) position: , mismatch: 8, identity: 0.733

cttttggtaatacttgaatctacgcttcat	CRISPR spacer
cgtccattaatacttgaatctccgcttcgg	Protospacer
* *... ************** ******. 

587. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ttcagacagcgactcagactcagatagtgactca	CRISPR spacer
tagcgacagcgattcagactcagatagcgatagc	Protospacer
*   ********.**************.**.   

588. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgatagcgactctgattcagatagcgacagc	Protospacer
.   **.******** ***************   

589. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgatagcgactctgattcagatagcgacagc	Protospacer
.   **.******** ***************   

590. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgatagcgactctgattcagatagcgacagt	Protospacer
.   **.******** ***************   

591. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgatagcgactctgattcagatagcgacagt	Protospacer
.   **.******** ***************   

592. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgatagcgactctgattcagatagcgacagc	Protospacer
.   **.******** ***************   

593. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactca	Protospacer
.   **.   ********.***************

594. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactca	Protospacer
.   **.   ********.***************

595. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.804

tagcgactctgattcagatagcgactccgattcagacagcgattct	CRISPR spacer
cagcgactctgattcagatagcgactctgattcagactcagacagc	Protospacer
.**************************.*********   **.  .

596. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgacagcgattcagactcagatagcgatagc	Protospacer
.   ********.*****.***********.   

597. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
tagcgacagcgactctgattcagacagcgatagc	Protospacer
.   *********** ********.*****.   

598. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcagacagcgactcagattcagatagcgactca	CRISPR spacer
ctcagacagcgattcagactcagacgcagatagc	Protospacer
************.*****.*****..  **.   

599. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactca	Protospacer
.   **.   *****.***********.******

600. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
tagcgattcagactcagactcagatagcgactca	Protospacer
.   **.   *****.***********.******

601. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706

ctcagacagcgactcggactcagatagtgactca	CRISPR spacer
ctcagacagcgattcagactcagacgcagatagc	Protospacer
************.**.********..  **.   

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 578733 : 595013 16 Bacillus_phage(33.33%) holin,protease NA
DBSCAN-SWA_2 985358 : 1001922 24 uncultured_Caudovirales_phage(68.42%) terminase,integrase attL 978339:978356|attR 999468:999485
DBSCAN-SWA_3 1135862 : 1176891 33 Staphylococcus_phage(96.3%) tRNA NA
DBSCAN-SWA_4 1301328 : 1310469 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 1438868 : 1448704 11 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_6 1820217 : 1865559 72 Staphylococcus_phage(71.88%) integrase,tail,terminase,holin,protease attL 1852469:1852486|attR 1874636:1874653
DBSCAN-SWA_7 1955660 : 1964130 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2203807 : 2212722 9 uncultured_Caudovirales_phage(71.43%) NA NA
DBSCAN-SWA_9 2230760 : 2240654 12 Pandoravirus(11.11%) NA NA
DBSCAN-SWA_10 2565081 : 2573251 16 Staphylococcus_phage(54.55%) terminase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage