1. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
2. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
3. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
4. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
5. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
6. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
7. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgactca Protospacer
****************************
8. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagattcagatagcgactca Protospacer
.*********************************
9. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagattcagacagcgactca Protospacer
************************.*********
10. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagattcagatagcgactca Protospacer
************.*********************
11. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagattcagacagcgactca Protospacer
************************.*********
12. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagattcagatagcgactca Protospacer
************.*********************
13. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagattcagacagcgactca Protospacer
************************.*********
14. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagattcagacagcgactca Protospacer
************************.*********
15. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagattcagatagcgactca Protospacer
************.*********************
16. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.971
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagattcagatagcgactca Protospacer
************.*********************
17. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactca Protospacer
.***************************
18. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactca Protospacer
.***************************
19. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactca Protospacer
.***************************
20. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagattcagacagcgactca Protospacer
************.***************
21. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactca Protospacer
.***************************
22. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactca Protospacer
.***************************
23. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgactca Protospacer
******************.*********
24. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgactca Protospacer
******************.*********
25. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgactca Protospacer
********* ******************
26. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgactca Protospacer
********* ******************
27. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.964
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagattcagatagcgattca Protospacer
***************************
28. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ttcagacagcgactcagactcagatagcgactcc Protospacer
***************************.*****
29. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactca Protospacer
************************.**.******
30. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactca Protospacer
************************.**.******
31. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ttcagacagcgactcagattcagatagcgactca Protospacer
******************.********.******
32. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagtgactcagattcagacagcgattcc CRISPR spacer
tagtgattcagattcagacagcgattct Protospacer
******.********************.
33. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagattcagatagcgattca Protospacer
.*****************************.***
34. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactca Protospacer
******************.*****.*********
35. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactca Protospacer
******************.*****.*********
36. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagatagcgactcc Protospacer
******************.**************
37. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagattcagatagcgattca Protospacer
.*****************************.***
38. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactca Protospacer
******************.*****.*********
39. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagattcagatagcgattca Protospacer
.*****************************.***
40. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagattcagatagcgattca Protospacer
.*****************************.***
41. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagattcagacagcgattca Protospacer
************************.*****.***
42. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagatagcgactct Protospacer
*************** *****************
43. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagatagcgactct Protospacer
*************** *****************
44. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgactca Protospacer
******.***********.***************
45. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.941
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgactca Protospacer
******.***********.***************
46. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactcc Protospacer
.**************************
47. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.***********.***************
48. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgattca Protospacer
.***********************.***
49. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.***********.***************
50. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
******.*****************.***
51. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgattca Protospacer
.***********************.***
52. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.***********.***************
53. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
******.*****************.***
54. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactcc Protospacer
.**************************
55. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactcc Protospacer
.**************************
56. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.***********.***************
57. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgattca Protospacer
******************.*****.***
58. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
******.*****************.***
59. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
******.*****************.***
60. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgactct Protospacer
.**************************
61. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgactct Protospacer
********* *****************
62. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagatagcgactca Protospacer
********* ********.*********
63. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagatagcgactca Protospacer
********* ********.*********
64. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**************************
65. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagtgattcc Protospacer
************.********.******
66. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**************************
67. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagtgattcc Protospacer
************.********.******
68. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagtgattcc Protospacer
************.********.******
69. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**************************
70. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**************************
71. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.929
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgattca Protospacer
************.**************
72. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagatagcgactcc Protospacer
.**************************.*****
73. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagtgattca Protospacer
.*****.***********************.***
74. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactca Protospacer
.***********************.**.******
75. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc Protospacer
************************.**.*****
76. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactca Protospacer
.***********************.**.******
77. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactca Protospacer
.***********************.**.******
78. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgactca Protospacer
.*****.********************.******
79. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgactca Protospacer
.*****.********************.******
80. spacer 1.1|340808|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc Protospacer
************************.**.*****
81. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagtgattcagattcagacagcgattct Protospacer
* *******************.*****.
82. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagtgattccgattcagatagtgattcc Protospacer
* ******* ********.*********
83. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagtgattccgattcagatagtgattcc Protospacer
* ******* ********.*********
84. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagtgattccgattcagatagtgattcc Protospacer
* ******* ********.*********
85. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagacagcgattca Protospacer
.**.***********************
86. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
tagtgattccgattcagacagcgattct Protospacer
******.** *****************.
87. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactccgattcggacagcgattcc Protospacer
.******** *****.************
88. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactcggattccgacagcgattcc Protospacer
.********.***** ************
89. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
tagtgattccgattcagacagcgattct Protospacer
******.** *****************.
90. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactcagattcagatagcgattca Protospacer
***.**************.********
91. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactcagattcagacagcgactca Protospacer
***.********************.**
92. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactcggattctgacagcgattcc Protospacer
.********.***** ************
93. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactccgattcggacagcgattcc Protospacer
.******** *****.************
94. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagattcagatagcgattcg Protospacer
************.*****************.**.
95. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactca Protospacer
.*****************.*****.*********
96. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgattcagattcagatagcgactca Protospacer
.*****.*****.*********************
97. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgactcagattcagatagcgattca Protospacer
.*****.***********************.***
98. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
atcagatagcgactcagattcagacagcgactca Protospacer
*****.*****************.*********
99. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagactcagatagcgactcc Protospacer
.*****************.**************
100. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagattcagatagcgattcg Protospacer
************.*****************.**.
101. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactca Protospacer
.*****************.*****.*********
102. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
atcagatagcgactcagattcaggtagcgactca Protospacer
*****.****************.**********
103. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactccgattcagatagcgattcg Protospacer
*************** **************.**.
104. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactcc Protospacer
******************.*****.********
105. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactct Protospacer
******************.*****.********
106. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagattcagatagcgactca Protospacer
.***********.*****.*********
107. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagatagcgactcc Protospacer
.*****************.********
108. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagatagcgactcc Protospacer
.*****************.********
109. spacer 1.14|341684|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagattcagacagcgattca Protospacer
.***********.***********.***
110. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
*************************
111. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
*************************
112. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
*************************
113. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactcagacagcgactct Protospacer
.******** *****************
114. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgattcagactcagacagcgactct Protospacer
.*****.********************
115. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactctgacagcgactct Protospacer
******.******** ***********
116. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactctgacagcgactct Protospacer
******.******** ***********
117. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactctgacagcgactct Protospacer
******.******** ***********
118. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactctgacagcgactct Protospacer
******.******** ***********
119. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgactct Protospacer
********* **.**************
120. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactctgacagcgactct Protospacer
******.******** ***********
121. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactcagacagcgactcg Protospacer
.********.*****************.
122. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactccgacagcgactcg Protospacer
.************** ***********.
123. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactccgacagcgactct Protospacer
.************** ***********
124. spacer 1.16|341810|34|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ctcagacagcgactcggactcagacagcgactcg Protospacer
************************.**.*****.
125. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.912
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagatagcgactcc Protospacer
***************.***********.*****
126. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgattcg Protospacer
.*****.********************
127. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagatagcgactca Protospacer
.***********************.**
128. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagattcagatagcgactca Protospacer
******.*****************.**
129. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagattcagacagcgactca Protospacer
******************.*****.**
130. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgattcg Protospacer
.*****.********************
131. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagtgattca Protospacer
************.********.*****
132. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagactcagatagcgactcc Protospacer
.***********.***********.***
133. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagactcagatagcgactcc Protospacer
.***********.***********.***
134. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagattcaggtagcgactca Protospacer
*****************.******.**
135. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgattcg Protospacer
.*****.********************
136. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagacagcgattca Protospacer
.*****************.********
137. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactccgattcagatagcgattcg Protospacer
.******** *****************
138. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgactca Protospacer
************.***********.**
139. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgatagc Protospacer
************.************ *
140. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgactct Protospacer
********* **************.**.
141. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgactct Protospacer
********* **************.**.
142. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgactca Protospacer
************.***********.**
143. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgatagc Protospacer
************.************ *
144. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgatagc Protospacer
************.************ *
145. spacer 1.18|341942|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagattccgatagcgattca Protospacer
******.******** ***********
146. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactctgactcggacagtgattcg Protospacer
************.**.***********
147. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactccgattcggacagtgattcg Protospacer
*********.*****.***********
148. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactctgattcggacagcgattcg Protospacer
***************.*****.*****
149. spacer 1.19|341996|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactcggattcggacagtgattcg Protospacer
********* *****.***********
150. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactccgattcagacagtgattca Protospacer
***.*****.*****************
151. spacer 1.19|341996|28|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactccgattctgacagtgattcg Protospacer
*********.***** ***********
152. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactccgattcagacagtgattca Protospacer
***.*****.*****************
153. spacer 1.19|341996|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactcggattcggacagtgattcg Protospacer
********* *****.***********
154. spacer 1.19|341996|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagtgactccgattccgacagtgattcg Protospacer
*********.***** ***********
155. spacer 1.19|341996|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.893
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactccgattcagacagtgattca Protospacer
***.*****.*****************
156. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagtgattcc Protospacer
.*****.***********************.**
157. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagtgattcc Protospacer
.*****.***********************.**
158. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.882
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagtgattcc Protospacer
.*****.***********************.**
159. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactct Protospacer
.***********************.**.*****
160. spacer 1.1|340808|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgactcc Protospacer
.***********************.**.*****
161. spacer 1.7|341264|28|AP018586|CRT matches to MT553347 (Mycobacterium phage Awesomesauce, complete genome) position: , mismatch: 4, identity: 0.857
ttgtggctccgactccgattgtggttca CRISPR spacer
tggtgactccgattccgattgtggttcc Protospacer
* ***.******.**************
162. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagtgattca Protospacer
. **********.**************
163. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagtgattccgattcagacagcgattct Protospacer
* ******* ***********.*****.
164. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagtgattca Protospacer
. **********.**************
165. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagtgattca Protospacer
. **********.**************
166. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagtgattca Protospacer
. **********.**************
167. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagtgattca Protospacer
. **********.**************
168. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagtgattccgattcagacagcgattct Protospacer
* ******* ***********.*****.
169. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcagactcagatagtgattcc Protospacer
* *.********.*****.*********
170. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**.**************.********
171. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
.*****.*****************.**
172. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagactcagacagcgattca Protospacer
.**.********.**************
173. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.**.********************.**
174. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.**.********************.**
175. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**.**************.********
176. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
.*****.*****************.**
177. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**.**************.********
178. spacer 1.12|341570|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
.*****.*****************.**
179. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactcggattcggacagcgattcg Protospacer
.********.*****.***********
180. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactcggattctgacagcgattcg Protospacer
.********.***** ***********
181. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactccgattctgacagcgattcg Protospacer
.******** ***** ***********
182. spacer 1.12|341570|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactctgattcggacagcgattcg Protospacer
.******** *****.***********
183. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.**.********************.**
184. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagatagcgattca Protospacer
.**.**************.********
185. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
.*****.*****************.**
186. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagactcagacagcgattca Protospacer
.**.********.**************
187. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.**.********************.**
188. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactcggattctgacagcgattct Protospacer
.********.***** ***********.
189. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgactcggattctgacagcgattcg Protospacer
.********.***** ***********
190. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagattcagacagcgatagc Protospacer
.*****.****************** *
191. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagattcagacagcgatagc Protospacer
.*****.****************** *
192. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagactcagacagcgattca Protospacer
.*****.*****.**************
193. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
***.***** *************** *
194. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
***.***** *************** *
195. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
***.***** *************** *
196. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
***.***** *************** *
197. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
***.***** *************** *
198. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
***.***** *************** *
199. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc Protospacer
.*****************.*****.********
200. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactcagactcagacagcgactcc Protospacer
.*****************.*****.********
201. spacer 1.13|341624|34|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgattcagattcagatagcgattcg Protospacer
.***********.*****************.**.
202. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagatagcgacagc Protospacer
*************** ***************
203. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgactctgattcagatagcgactct Protospacer
.*****.******** *****************
204. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgactctgattcagatagcgactct Protospacer
.*****.******** *****************
205. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
ctctgactcagactcagacagcgactca Protospacer
. .************************
206. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgacagc Protospacer
********* ***************
207. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgacagc Protospacer
********* ***************
208. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgacagc Protospacer
******************.******
209. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
210. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
211. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
212. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
213. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
214. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
215. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
ttcagactcagactcagatagcgactca Protospacer
* **************.*********
216. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
217. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
218. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
219. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
ttcagactcagactcagatagcgactca Protospacer
* **************.*********
220. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
221. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgactct Protospacer
.**.**.********************
222. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcg Protospacer
.********.***** ***********.
223. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
224. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
225. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcc Protospacer
.********.***** ***********
226. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcg Protospacer
.********.***** ***********.
227. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
228. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
229. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactccgactccgacagcgactcg Protospacer
.******** ***** ***********.
230. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcc Protospacer
.********.***** ***********
231. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcc Protospacer
.********.***** ***********
232. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
233. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
234. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgattccgactcagacagcgactcg Protospacer
.*****.** *****************.
235. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcg Protospacer
.********.***** ***********.
236. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcc Protospacer
.********.***** ***********
237. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactccgacagcgactcc Protospacer
.********.***** ***********
238. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
239. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
240. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcc Protospacer
.********.***** ***********
241. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
242. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcg Protospacer
.********.***** ***********.
243. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactccgactccgacagcgactcg Protospacer
.******** ***** ***********.
244. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactctgacagcgactcc Protospacer
.******** ***** ***********
245. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactccgactccgacagcgactct Protospacer
.******** ***** ***********
246. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactcggacagcgactcg Protospacer
.******** *****.***********.
247. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactcggacagcgactcg Protospacer
.******** *****.***********.
248. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactccgactcggacagcgactcg Protospacer
.******** *****.***********.
249. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactccgacagcgactcg Protospacer
.******** ***** ***********.
250. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcggactctgacagcgactcc Protospacer
.********.***** ***********
251. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactccgactcggacagcgactct Protospacer
.******** *****.***********
252. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactcggacagcgactcc Protospacer
.******** *****.***********
253. spacer 1.14|341684|28|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactccgactccgacagcgactcg Protospacer
.******** ***** ***********.
254. spacer 1.15|341738|46|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.913
tagcgactcagactcagacagcgactcggactcagatagtgactca CRISPR spacer
cagcgactcagactcagacagcgactcagactcagatagcgactcc Protospacer
.**************************.***********.*****
255. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.882
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ttcagacagcgactcagactcagatagcgactcc Protospacer
.**************.***********.*****
256. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.*****************.*****.**
257. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgactca Protospacer
.*****.*****************.**
258. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagactcagacagcgattca Protospacer
.***********.*****.********
259. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.*****************.*****.**
260. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgactca Protospacer
.*****.*****************.**
261. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagactcagacagcgattca Protospacer
.***********.*****.********
262. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.*****************.*****.**
263. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagattcagacagcgactca Protospacer
.*****************.*****.**
264. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgactca Protospacer
.*****.*****************.**
265. spacer 1.18|341942|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagattcagatagcgactca Protospacer
.*****.*****************.**
266. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagc Protospacer
********* **************. *
267. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagc Protospacer
********* **************. *
268. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgactct Protospacer
.******** **************.**.
269. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagatagcgacagc Protospacer
************.***********. *
270. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagc Protospacer
********* **************. *
271. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgactct Protospacer
.******** **************.**.
272. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* ********.****** *
273. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* ********.****** *
274. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
275. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
276. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
277. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
278. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* ********.****** *
279. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
280. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* ********.****** *
281. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* ********.****** *
282. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
283. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.*****.************ *
284. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* ********.****** *
285. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactccgattcagacagtgattca Protospacer
.**.*****.*****************
286. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactccgattcagacagtgattca Protospacer
.**.*****.*****************
287. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
288. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
289. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
290. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
291. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
292. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
293. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
294. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
295. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
296. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
297. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
298. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
299. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
300. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
301. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
302. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
303. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.857
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
***.*****************.*** *
304. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
. *******************.**.**
305. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
* *.********.********.*****
306. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcggactcagacagtgattca Protospacer
* *.*****.**.**************
307. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
. *******************.**.**
308. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgactccgattcagacagtgattca Protospacer
* *.**.** *****************
309. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgactccgattcagacagtgattca Protospacer
* *.**.** *****************
310. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
* *.********.********.*****
311. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcggactcagacagtgattca Protospacer
* *.*****.**.**************
312. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
. *******************.**.**
313. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagattcagacagcgactca Protospacer
. *******************.**.**
314. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
* *.********.********.*****
315. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcggactcagacagtgattca Protospacer
* *.*****.**.**************
316. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcagactcagacagcgattca Protospacer
* *.********.********.*****
317. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
tagcgattcggactcagacagtgattca Protospacer
* *.*****.**.**************
318. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagattcagacagcgatagc Protospacer
. *******************.*** *
319. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagattcagacagcgatagc Protospacer
. *******************.*** *
320. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagcgattca Protospacer
. **********.********.*****
321. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcggattccgacagtgattcg Protospacer
. *******.***** ***********
322. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcggattctgacagtgattcc Protospacer
. *.*****.***** ************
323. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcggattccgacagtgattcc Protospacer
. *.*****.***** ************
324. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattccgattctgacagtgattcc Protospacer
. *.***** ***** ************
325. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 5, identity: 0.821
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattccgattctgacagtgattcc Protospacer
. *.***** ***** ************
326. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
327. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
328. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
329. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
330. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
331. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
332. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
333. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
334. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
335. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
336. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagactcagacagcgatagc Protospacer
.**.********.************ *
337. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagactcagacagcgatagc Protospacer
.*****.*****.************ *
338. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
***.********.***********. *
339. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
340. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
***.********.***********. *
341. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
342. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
343. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
344. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
345. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactcagactcagacagcgatagc Protospacer
.**.********.************ *
346. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagactcagacagcgatagc Protospacer
.*****.*****.************ *
347. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
***.********.***********. *
348. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
349. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.**.***** *************** *
350. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgacagc Protospacer
*************** ********.******
351. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.853
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgacagc Protospacer
******.***********.************
352. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactcagactcagacagcgactct Protospacer
. ***********************
353. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgatagc Protospacer
.***********************.
354. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactcagactcagacagcgatagc Protospacer
.***********************.
355. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgatagc Protospacer
******************.*****.
356. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
357. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
358. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgatagc Protospacer
******************.*****.
359. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactcagacagcgacagc Protospacer
.******** ***************
360. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
361. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
362. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactcagactcagatagcgatagc Protospacer
******************.*****.
363. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
364. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
365. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
366. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
367. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgactcagacagcgatagc Protospacer
********* **************.
368. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
ttcagactcagactcagatagcgactct Protospacer
* **************.********
369. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
ttcagactcagactcagatagcgactct Protospacer
* **************.********
370. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagactcagacagcgactca CRISPR spacer
ttcagactcagactcagatagcgactct Protospacer
* **************.********
371. spacer 1.14|341684|28|AP018586|CRT matches to NC_048174 (Shigella phage HRP29, complete genome) position: , mismatch: 5, identity: 0.821
-tagcgactcagactcagacagcgactca CRISPR spacer
gttgt-actcagcctcagacagcgcctca Protospacer
* *. ****** *********** ****
372. spacer 1.14|341684|28|AP018586|CRT matches to MK562503 (Shigella phage Buco, complete genome) position: , mismatch: 5, identity: 0.821
-tagcgactcagactcagacagcgactca CRISPR spacer
gttgt-actcagcctcagacagcgcctca Protospacer
* *. ****** *********** ****
373. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagc Protospacer
************************* **************** .
374. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
tagcgactctgattcagatagcgacagcgattcagacagcgatagc Protospacer
************************* **************** .
375. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.891
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
tagcgactctgattcagacagcgactctgattcagacagcgatagc Protospacer
******************.********.*************** .
376. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagt Protospacer
********* **************. .
377. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagt Protospacer
********* **************. .
378. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagt Protospacer
********* **************. .
379. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagt Protospacer
********* **************. .
380. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactctgattcagatagcgacagt Protospacer
********* **************. .
381. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
382. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
383. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
384. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
385. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
386. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
387. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
388. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
389. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagc Protospacer
.******** **************. *
390. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
391. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
392. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
393. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
394. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
395. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
396. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
397. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
398. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
399. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
400. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagactcagacagcgatagc Protospacer
.***********.*****.****** *
401. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
************.*****.*****. *
402. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
403. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
************.*****.*****. *
404. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
405. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
406. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
407. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
408. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactcagactcagacagcgatagc Protospacer
.***********.*****.****** *
409. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgattcagactcagatagcgatagc Protospacer
.*****.*****.************ *
410. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
tagcgactcagactcagacagcgacagc Protospacer
************.*****.*****. *
411. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
412. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** ********.****** *
413. spacer 1.19|341996|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
ctccgactctgattccgacagtgattcg Protospacer
* .*********** ***********
414. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
.**.*****************.*** *
415. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
.**.*****************.*** *
416. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
***.*****************.**. *
417. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
.**.*****************.*** *
418. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
***.*****************.**. *
419. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
***.*****************.**. *
420. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
.**.*****************.*** *
421. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
.**.*****************.*** *
422. spacer 1.19|341996|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.821
cagtgactctgattcagacagtgattcc CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
.**.*****************.*** *
423. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgacagc Protospacer
.*****.********************.***
424. spacer 1.6|341210|28|AP018586|CRT matches to MG592576 (Vibrio phage 1.206.O._10N.222.51.B10, partial genome) position: , mismatch: 6, identity: 0.786
ctgtggctcagactcagactgtgattca CRISPR spacer
ttatggctcagacccagacagtgatttt Protospacer
.*.**********.***** ******.
425. spacer 1.6|341210|28|AP018586|CRT matches to MG592534 (Vibrio phage 1.167.O._10N.261.51.F2, partial genome) position: , mismatch: 6, identity: 0.786
ctgtggctcagactcagactgtgattca CRISPR spacer
ttatggctcagacccagacagtgatttt Protospacer
.*.**********.***** ******.
426. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgactccgattcagacagtgattca Protospacer
. *.**.** *****************
427. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcagattcagatagcgattcg Protospacer
. *.**************.**.*****
428. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgactccgattcagacagtgattca Protospacer
. *.**.** *****************
429. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcagattcagatagcgattcg Protospacer
. *.**************.**.*****
430. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgactccgattcagacagtgattca Protospacer
. *.**.** *****************
431. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcagattcagatagcgattcg Protospacer
. *.**************.**.*****
432. spacer 1.9|341372|28|AP018586|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgactcagattcagacagcgattca Protospacer
. *.**.**************.*****
433. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagcgatagc Protospacer
. **********.********.*** *
434. spacer 1.9|341372|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagtgattcagactcagacagcgatagc Protospacer
. **********.********.*** *
435. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcggattctgacagtgattcg Protospacer
. *.*****.***** ***********
436. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcggattccgacagtgattcg Protospacer
. *.*****.***** ***********
437. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattccgattccgacagtgattcg Protospacer
. *.***** ***** ***********
438. spacer 1.9|341372|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcggattccgacagtgattcg Protospacer
. *.*****.***** ***********
439. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
ctccgattcggattctgacagtgattcg Protospacer
.* .*****.***** ***********
440. spacer 1.9|341372|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattcggattctgacagtgattcg Protospacer
. *.*****.***** ***********
441. spacer 1.9|341372|28|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 6, identity: 0.786
ttgtgattcagattcagacagtgattcc CRISPR spacer
cagcgattccgattccgacagtgattcg Protospacer
. *.***** ***** ***********
442. spacer 1.10|341426|46|AP018586|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.87
ttgtggctcagactcagattgtgattcagattcagacagtgattcc CRISPR spacer
tagcgactcagactcagatagtgattcagattcagacagcgattct Protospacer
* *.*.************* *******************.*****.
443. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
tagtgactcagattcagacagcgattcc CRISPR spacer
ctctgactccgattcggacagcgattcg Protospacer
. ****** *****.***********
444. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagtgactcagattcagacagcgattcc CRISPR spacer
ctctgactcagactcagacagcgactca Protospacer
. *********.***********.**
445. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.**.***** **************. *
446. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.**.***** **************. *
447. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagtgactcagattcagacagcgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.**.***** **************. *
448. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagtgactcagattcagacagcgattcc CRISPR spacer
cagtgattcagactcagacagcgacagc Protospacer
.*****.*****.***********. *
449. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
450. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
451. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
452. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc Protospacer
******.***********.***********.
453. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
454. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
455. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
456. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc Protospacer
******.***********.***********.
457. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
458. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc Protospacer
******************.*****.*****.
459. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgactctgattcagatagcgacagt Protospacer
.*****.******** ***************
460. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc Protospacer
******.***********.***********.
461. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
462. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
463. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc Protospacer
******************.*****.*****.
464. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgactctgattcagatagcgacagt Protospacer
.*****.******** ***************
465. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgactctgattcagacagcgatagc Protospacer
*************** ********.*****.
466. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.824
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagatagcgactctgattcagatagcgacagt Protospacer
.*****.******** ***************
467. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
ctctgattcagactcagacagcgactct Protospacer
. .**.********************
468. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactcagacagcgatagc Protospacer
.******** **************.
469. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
ctctgattcagactcagacagcgactct Protospacer
. .**.********************
470. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
ctctgattcagactcagacagcgactct Protospacer
. .**.********************
471. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* **.***********.
472. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* **.***********.
473. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
474. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.******** **.************
475. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
476. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
477. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
478. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* **.***********.
479. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
480. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.******** **.************
481. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.******** **.************
482. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* **.***********.
483. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* **.***********.
484. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
485. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgattcagactcagatagcgatagc Protospacer
******.***********.*****.
486. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
tagcgactctgattcagacagcgatagc Protospacer
********* **.***********.
487. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgacagc Protospacer
.**.**.******************
488. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactccgacagcgacagt Protospacer
.******** ***** *********
489. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgactctgacagcgacagt Protospacer
.******** ***** *********
490. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
ctccgactccgactctgacagcgactcg Protospacer
. ****** ***** ***********.
491. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 6, identity: 0.786
tagcgactcagactcagacagcgactca CRISPR spacer
ttcggactcggactctgacagcgactcg Protospacer
* *****.***** ***********.
492. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagc Protospacer
.************************ **************** .
493. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagc Protospacer
.************************ **************** .
494. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagacagcgatagc Protospacer
.************************ **************** .
495. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.87
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
cagcgactctgattcagatagcgactctgattcagatagcgacagt Protospacer
.**************************.********.*****. *
496. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
497. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
498. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
499. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
500. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
501. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
502. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagatagcgacagt Protospacer
.******** **************. .
503. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.******** ********.*****. *
504. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgatagc Protospacer
* ********.************ *
505. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgactct Protospacer
* ********.***********.**.
506. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgactca Protospacer
* ********.***********.**
507. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgatagc Protospacer
* ********.************ *
508. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.******** ********.*****. *
509. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
cagcgactctgattcagacagcgacagc Protospacer
.******** ********.*****. *
510. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgatagc Protospacer
* ********.************ *
511. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgactct Protospacer
* ********.***********.**.
512. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgatagc Protospacer
* ********.************ *
513. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgactct Protospacer
* ********.***********.**.
514. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactcagactcagatagcgactca Protospacer
* ********.***********.**
515. spacer 1.18|341942|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786
tagcgactcagattcagatagcgattcc CRISPR spacer
ttcagactctgattcagatagcgactct Protospacer
* ***** **************.**.
516. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc Protospacer
.*****.********************.**.
517. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc Protospacer
.*****.********************.**.
518. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc Protospacer
.***********************.**.**.
519. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagatagcgactcagactcagatagcgatagc Protospacer
.*****.********************.**.
520. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
ctcagacagcgactcagactcagacagcgatagc Protospacer
.***********************.**.**.
521. spacer 1.12|341570|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.75
tagtgactcagattcagacagcgattcc CRISPR spacer
ctcggactccgattcggacagcgattcg Protospacer
. ***** *****.***********
522. spacer 1.12|341570|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagtgactcagattcagacagcgattcc CRISPR spacer
ctcagactcagactcagacagcgactct Protospacer
. ********.***********.**.
523. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
524. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
525. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
526. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
527. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
528. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
529. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
530. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
531. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
532. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
533. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
534. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
535. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ttcagacagcgactctgattcagacagcgatagc Protospacer
.************** ********.*****.
536. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
537. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagc Protospacer
* *********** ***************
538. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagatagcgacagt Protospacer
* *********** ***************
539. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactcagactcagacagcgacagc Protospacer
. *********************
540. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactcagactcagacagcgacagc Protospacer
. *********************
541. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactcagactcagacagcgacagc Protospacer
. *********************
542. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
543. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
544. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
545. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
546. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
547. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
548. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
549. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
550. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
551. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
552. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgatagc Protospacer
.**.**.*****************.
553. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
554. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
555. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
556. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
557. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
558. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagtgattcagactcagacagcgatagc Protospacer
.**.**.*****************.
559. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgattcagactcagatagcgatagc Protospacer
.*****.***********.*****.
560. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
561. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
cagcgactctgattcagacagcgatagc Protospacer
.******** **.***********.
562. spacer 1.14|341684|28|AP018586|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
ctctgactctgactctgacagcgactcg Protospacer
. .***** ***** ***********.
563. spacer 1.14|341684|28|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.75
tagcgactcagactcagacagcgactca CRISPR spacer
ctcggactcggactcggacagcgactcg Protospacer
. *****.*****.***********.
564. spacer 1.16|341810|34|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ctccgacagcgactcggactctgattccgattcc Protospacer
*** ***************** *** .**.**
565. spacer 1.16|341810|34|AP018586|CRT matches to CP052430 (Klebsiella pneumoniae strain C16KP0129 plasmid pC16KP0129-3, complete sequence) position: , mismatch: 7, identity: 0.794
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ctccgacagcgactcggactctgattccgattcc Protospacer
*** ***************** *** .**.**
566. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.848
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
ttcagactctgattcagatagcgactctgattcagacagcgatagc Protospacer
* ***********************.*************** .
567. spacer 4.1|653009|33|AP018586|CRISPRCasFinder matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788
tgcatttgtccaaagacaaatgtaaacatatgg- CRISPR spacer
tatttttgtccaaagataaatgtaatca-atgct Protospacer
*.. ************.******** ** ***
568. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
tagcgattcagactcagactcagatagcgactca Protospacer
* **. *****************.******
569. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
tagcgattcagactcagactcagatagcgactca Protospacer
* **. *****************.******
570. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagacagcgacagc Protospacer
* *********** ********.******
571. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
cagcgacagcgactctgattcagacagcgacagc Protospacer
* *********** ********.******
572. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
573. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
574. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
575. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
576. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
577. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
578. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
579. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
580. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
581. spacer 1.14|341684|28|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.714
tagcgactcagactcagacagcgactca CRISPR spacer
ctcagactctgactcagacagcgacagc Protospacer
. ***** ***************
582. spacer 1.16|341810|34|AP018586|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 8, identity: 0.765
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ctcggacagcgactcggactccgattcggacagc Protospacer
***.***************** *** ***
583. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
tagcgactctgattcagatagcgactctgattcagactcagacagc Protospacer
***************************.********* **. .
584. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
tagcgactctgattcagatagcgactctgattcagactcagacagc Protospacer
***************************.********* **. .
585. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.826
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
cagcgactctgattcagatagcgacagcgattcagactctgactca Protospacer
.************************ ********** .**.**
586. spacer 6.1|1683845|30|AP018586|CRISPRCasFinder matches to MT822287 (Erwinia phage pEp_SNUABM_11, complete genome) position: , mismatch: 8, identity: 0.733
cttttggtaatacttgaatctacgcttcat CRISPR spacer
cgtccattaatacttgaatctccgcttcgg Protospacer
* *... ************** ******.
587. spacer 1.1|340808|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ttcagacagcgactcagactcagatagtgactca CRISPR spacer
tagcgacagcgattcagactcagatagcgatagc Protospacer
* ********.**************.**.
588. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgatagcgactctgattcagatagcgacagc Protospacer
. **.******** ***************
589. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgatagcgactctgattcagatagcgacagc Protospacer
. **.******** ***************
590. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgatagcgactctgattcagatagcgacagt Protospacer
. **.******** ***************
591. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgatagcgactctgattcagatagcgacagt Protospacer
. **.******** ***************
592. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgatagcgactctgattcagatagcgacagc Protospacer
. **.******** ***************
593. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgattcagactcagactcagatagcgactca Protospacer
. **. ********.***************
594. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.735
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgattcagactcagactcagatagcgactca Protospacer
. **. ********.***************
595. spacer 1.17|341870|46|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.804
tagcgactctgattcagatagcgactccgattcagacagcgattct CRISPR spacer
cagcgactctgattcagatagcgactctgattcagactcagacagc Protospacer
.**************************.********* **. .
596. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgacagcgattcagactcagatagcgatagc Protospacer
. ********.*****.***********.
597. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
tagcgacagcgactctgattcagacagcgatagc Protospacer
. *********** ********.*****.
598. spacer 1.13|341624|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcagacagcgactcagattcagatagcgactca CRISPR spacer
ctcagacagcgattcagactcagacgcagatagc Protospacer
************.*****.*****.. **.
599. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
tagcgattcagactcagactcagatagcgactca Protospacer
. **. *****.***********.******
600. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
tagcgattcagactcagactcagatagcgactca Protospacer
. **. *****.***********.******
601. spacer 1.16|341810|34|AP018586|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
ctcagacagcgactcggactcagatagtgactca CRISPR spacer
ctcagacagcgattcagactcagacgcagatagc Protospacer
************.**.********.. **.