Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018587 Staphylococcus caprae JMUB898 DNA, complete genome 6 crisprs csa3,DEDDh,cas3,DinG 2 7 9 0

Results visualization

1. AP018587
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018587_2 451288-451377 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018587_3 469706-469848 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018587_4 638489-638571 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018587_5 1086660-1086782 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018587_6 1668982-1669075 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018587_7 2246933-2247033 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP018587_1 1.7|327003|20|AP018587|CRT 327003-327022 20 AP018587.1 326283-326302 1 0.95
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 AP018587.1 326295-326314 2 0.9
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 AP018587.1 326331-326350 2 0.9

1. spacer 1.7|327003|20|AP018587|CRT matches to position: 326283-326302, mismatch: 1, identity: 0.95

tagtgattccgactcagaca	CRISPR spacer
tagtgattcagactcagaca	Protospacer
********* **********

2. spacer 1.9|327129|20|AP018587|CRT matches to position: 326295-326314, mismatch: 2, identity: 0.9

ctcagacagcgactcagatt	CRISPR spacer
ctcagacagcgattccgatt	Protospacer
************.** ****

3. spacer 1.9|327129|20|AP018587|CRT matches to position: 326331-326350, mismatch: 2, identity: 0.9

ctcagacagcgactcagatt	CRISPR spacer
ctcagatagtgactcagatt	Protospacer
******.**.**********

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21147-21166 0 1.0
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21345-21364 0 1.0
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15948-15967 0 1.0
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9705-9724 0 1.0
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9849-9868 0 1.0
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21147-21178 0 1.0
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15948-15979 0 1.0
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9705-9736 0 1.0
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9849-9880 0 1.0
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21219-21238 1 0.95
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21435-21454 1 0.95
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15840-15859 1 0.95
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9777-9796 1 0.95
AP018587_1 1.9|327129|20|AP018587|CRT 327129-327148 20 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9921-9940 1 0.95
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21345-21376 1 0.969
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21363-21394 1 0.969
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21435-21466 1 0.969
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15768-15799 1 0.969
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9993-10024 1 0.969
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21111-21142 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21273-21304 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21291-21322 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21309-21340 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21183-21214 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15750-15781 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15894-15925 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15912-15943 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15804-15835 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9669-9700 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9975-10006 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9741-9772 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9885-9916 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18587-18618 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16499-16530 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17177-17208 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17831-17862 2 0.938
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19313-19344 2 0.938
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15426-15451 3 0.885
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15444-15469 3 0.885
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15552-15577 3 0.885
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15678-15703 3 0.885
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21057-21082 3 0.885
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9615-9640 3 0.885
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21129-21160 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21327-21358 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21417-21448 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15606-15637 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15732-15763 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15930-15961 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9687-9718 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9831-9862 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9597-9628 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17021-17052 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 20033-20064 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16481-16512 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16661-16692 3 0.906
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17159-17190 3 0.906
AP018587_1 1.6|326931|32|AP018587|CRT 326931-326962 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15426-15457 4 0.875
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16487-16512 4 0.846
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16505-16530 4 0.846
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17165-17190 4 0.846
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17183-17208 4 0.846
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18137-18162 4 0.846
AP018587_1 1.8|327063|26|AP018587|CRT 327063-327088 26 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19619-19644 4 0.846
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18197-18228 4 0.875
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19679-19710 4 0.875
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 LR134125 Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5 155979-156010 4 0.875
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2208-2239 4 0.875
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 CP052500 Klebsiella pneumoniae strain B17KP0021 plasmid unnamed 2580-2611 4 0.875
AP018587_1 1.5|326859|32|AP018587|CRT 326859-326890 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15426-15457 5 0.844
AP018587_1 1.6|326931|32|AP018587|CRT 326931-326962 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15534-15565 5 0.844
AP018587_1 1.6|326931|32|AP018587|CRT 326931-326962 32 NZ_CP047808 Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence 15660-15691 5 0.844
AP018587_1 1.6|326931|32|AP018587|CRT 326931-326962 32 NZ_CP023562 Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence 21039-21070 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18569-18600 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18131-18162 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19013-19044 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19613-19644 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16703-16734 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18941-18972 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16871-16902 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17873-17904 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17945-17976 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18149-18180 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18353-18384 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19073-19104 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19355-19386 5 0.844
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19427-19458 5 0.844
AP018587_1 1.6|326931|32|AP018587|CRT 326931-326962 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9579-9610 6 0.812
AP018587_1 1.6|326931|32|AP018587|CRT 326931-326962 32 NZ_LT009691 Staphylococcus aureus strain NZAK3 plasmid 2 9597-9628 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16619-16650 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16931-16962 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17003-17034 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18287-18318 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17849-17880 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19331-19362 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16517-16548 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16973-17004 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17195-17226 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17537-17568 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18329-18360 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17273-17304 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18407-18438 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19127-19158 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19853-19884 6 0.812
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17903-17934 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19385-19416 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16679-16710 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16847-16878 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17297-17328 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17669-17700 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17969-18000 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18173-18204 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18431-18462 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18917-18948 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19151-19182 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19451-19482 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16811-16842 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17645-17676 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18101-18132 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19583-19614 7 0.781
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19805-19836 7 0.781
AP018587_4 4.1|638514|33|AP018587|CRISPRCasFinder 638514-638546 33 NZ_CP023514 Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence 110127-110159 7 0.788
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16097-16128 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16229-16260 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16361-16392 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16637-16668 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 16949-16980 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17039-17070 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17387-17418 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 17807-17838 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18305-18336 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18701-18732 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 18893-18924 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19049-19080 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19289-19320 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19655-19686 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NZ_CP035292 Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence 19979-20010 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 NC_048174 Shigella phage HRP29, complete genome 892-923 8 0.75
AP018587_1 1.10|327189|32|AP018587|CRT 327189-327220 32 MK562503 Shigella phage Buco, complete genome 892-923 8 0.75
AP018587_6 6.1|1669014|30|AP018587|CRISPRCasFinder 1669014-1669043 30 MT822287 Erwinia phage pEp_SNUABM_11, complete genome 472-501 8 0.733

1. spacer 1.9|327129|20|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagacagcgactcagatt	CRISPR spacer
ctcagacagcgactcagatt	Protospacer
********************

2. spacer 1.9|327129|20|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagacagcgactcagatt	CRISPR spacer
ctcagacagcgactcagatt	Protospacer
********************

3. spacer 1.9|327129|20|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

ctcagacagcgactcagatt	CRISPR spacer
ctcagacagcgactcagatt	Protospacer
********************

4. spacer 1.9|327129|20|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

ctcagacagcgactcagatt	CRISPR spacer
ctcagacagcgactcagatt	Protospacer
********************

5. spacer 1.9|327129|20|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

ctcagacagcgactcagatt	CRISPR spacer
ctcagacagcgactcagatt	Protospacer
********************

6. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagatt	Protospacer
********************************

7. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagatt	Protospacer
********************************

8. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagatt	Protospacer
********************************

9. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 0, identity: 1.0

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagatt	Protospacer
********************************

10. spacer 1.9|327129|20|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.95

ctcagacagcgactcagatt	CRISPR spacer
ttcagacagcgactcagatt	Protospacer
.*******************

11. spacer 1.9|327129|20|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.95

ctcagacagcgactcagatt	CRISPR spacer
ttcagacagcgactcagatt	Protospacer
.*******************

12. spacer 1.9|327129|20|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.95

ctcagacagcgactcagatt	CRISPR spacer
ttcagacagcgactcagatt	Protospacer
.*******************

13. spacer 1.9|327129|20|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.95

ctcagacagcgactcagatt	CRISPR spacer
ttcagacagcgactcagatt	Protospacer
.*******************

14. spacer 1.9|327129|20|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.95

ctcagacagcgactcagatt	CRISPR spacer
ttcagacagcgactcagatt	Protospacer
.*******************

15. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.969

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactcagatt	Protospacer
.*******************************

16. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.969

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagact	Protospacer
******************************.*

17. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 1, identity: 0.969

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagattcagacagcgactcagatt	Protospacer
************.*******************

18. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.969

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagact	Protospacer
******************************.*

19. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 1, identity: 0.969

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgactcagact	Protospacer
******************************.*

20. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactccgatt	Protospacer
.************************** ****

21. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgattcagatt	Protospacer
.***********************.*******

22. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactcagact	Protospacer
.*****************************.*

23. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactcagact	Protospacer
.*****************************.*

24. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagacagcgattcagatt	Protospacer
******.*****************.*******

25. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactcagact	Protospacer
.*****************************.*

26. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgattcagatt	Protospacer
.***********************.*******

27. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactcagact	Protospacer
.*****************************.*

28. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagacagcgattcagatt	Protospacer
******.*****************.*******

29. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactccgatt	Protospacer
.************************** ****

30. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactccgatt	Protospacer
.************************** ****

31. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagacagcgattcagatt	Protospacer
******.*****************.*******

32. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagacagcgattcagatt	Protospacer
******.*****************.*******

33. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgactctgatt	Protospacer
.************************** ****

34. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagatagcgactcagact	Protospacer
******************.***********.*

35. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagatagcgactcagact	Protospacer
******************.***********.*

36. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgactcagact	Protospacer
********* ********************.*

37. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 2, identity: 0.938

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgactcagact	Protospacer
********* ********************.*

38. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885

ttccgactcagatagtgactcagatt	CRISPR spacer
ctcagactcagatagtgattcagatt	Protospacer
.** **************.*******

39. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885

ttccgactcagatagtgactcagatt	CRISPR spacer
ttcagactcagatagcgactcagact	Protospacer
*** ***********.********.*

40. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885

ttccgactcagatagtgactcagatt	CRISPR spacer
ttcagactcagatagcgactcagact	Protospacer
*** ***********.********.*

41. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.885

ttccgactcagatagtgactcagatt	CRISPR spacer
ttcagactcagatagcgactcagact	Protospacer
*** ***********.********.*

42. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.885

ttccgactcagatagtgactcagatt	CRISPR spacer
ttcagactcagatagcgactcagact	Protospacer
*** ***********.********.*

43. spacer 1.8|327063|26|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.885

ttccgactcagatagtgactcagatt	CRISPR spacer
ttcagactcagatagcgactcagact	Protospacer
*** ***********.********.*

44. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagattcagacagcgactcagact	Protospacer
.***********.*****************.*

45. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagattcagacagcgactcagact	Protospacer
.***********.*****************.*

46. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagattcagatagcgactcagatt	Protospacer
.***********.*****.*************

47. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagatagcgactccgatt	Protospacer
.*****************.******** ****

48. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagatagcgactccgatt	Protospacer
.*****************.******** ****

49. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagattcagacagcgactcagact	Protospacer
.***********.*****************.*

50. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagattcagacagcgactcagact	Protospacer
.***********.*****************.*

51. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagattcagacagcgattcagatt	Protospacer
.***********.***********.*******

52. spacer 1.10|327189|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagatagcgattcagact	Protospacer
******************.*****.*****.*

53. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgactcagacagcgactctgatt	Protospacer
.******** ***************** ****

54. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgattcagactcagacagcgactctgatt	Protospacer
.*****.******************** ****

55. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagatagcgactcagact	Protospacer
********* ********.***********.*

56. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgactctgact	Protospacer
********* ***************** **.*

57. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 3, identity: 0.906

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagatagcgactcagact	Protospacer
********* ********.***********.*

58. spacer 1.6|326931|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 4, identity: 0.875

ttgtggctcagactcagattgtgattcagatt	CRISPR spacer
tagcgactcagactcagatagtgattcagatt	Protospacer
* *.*.************* ************

59. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

ttccgactcagatagtgactcagatt	CRISPR spacer
ctctgactcagatagcgactcagact	Protospacer
.**.***********.********.*

60. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

ttccgactcagatagtgactcagatt	CRISPR spacer
ctcagactcagatagcgactcagact	Protospacer
.** ***********.********.*

61. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

ttccgactcagatagtgactcagatt	CRISPR spacer
ctctgactcagatagcgactcagact	Protospacer
.**.***********.********.*

62. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

ttccgactcagatagtgactcagatt	CRISPR spacer
ctcagactcagatagcgactcagact	Protospacer
.** ***********.********.*

63. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

ttccgactcagatagtgactcagatt	CRISPR spacer
ctcagactcagatagcgactcagact	Protospacer
.** ***********.********.*

64. spacer 1.8|327063|26|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.846

ttccgactcagatagtgactcagatt	CRISPR spacer
ctcagactcagatagcgactcagact	Protospacer
.** ***********.********.*

65. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgacagcgact	Protospacer
*************************   **.*

66. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagacagcgacagcgact	Protospacer
*************************   **.*

67. spacer 1.10|327189|32|AP018587|CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 4, identity: 0.875

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcggactcagacagcgactcggact	Protospacer
.********.*****************.**.*

68. spacer 1.10|327189|32|AP018587|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.875

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactccgacagcgactcggact	Protospacer
.************** ***********.**.*

69. spacer 1.10|327189|32|AP018587|CRT matches to CP052500 (Klebsiella pneumoniae strain B17KP0021 plasmid unnamed) position: , mismatch: 4, identity: 0.875

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactccgacagcgactctgact	Protospacer
.************** *********** **.*

70. spacer 1.5|326859|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

ttgtggctccgactcagattgtgattcagatt	CRISPR spacer
tagcgactcagactcagatagtgattcagatt	Protospacer
* *.*.*** ********* ************

71. spacer 1.6|326931|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

ttgtggctcagactcagattgtgattcagatt	CRISPR spacer
tagcgactcagactcagatagtgattccgatt	Protospacer
* *.*.************* ******* ****

72. spacer 1.6|326931|32|AP018587|CRT matches to NZ_CP047808 (Staphylococcus aureus strain UP_1612 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844

ttgtggctcagactcagattgtgattcagatt	CRISPR spacer
tagcgactcagactcagatagtgattccgatt	Protospacer
* *.*.************* ******* ****

73. spacer 1.6|326931|32|AP018587|CRT matches to NZ_CP023562 (Staphylococcus aureus strain TF3198 plasmid pTF3198, complete sequence) position: , mismatch: 5, identity: 0.844

ttgtggctcagactcagattgtgattcagatt	CRISPR spacer
tagcgactcagactcagatagtgattccgatt	Protospacer
* *.*.************* ******* ****

74. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ctctgactcagactcagacagcgactcagact	Protospacer
.  .**************************.*

75. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ttcagactcagactcagatagcgactcagact	Protospacer
*   **************.***********.*

76. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ttcagactcagactcagatagcgactctgatt	Protospacer
*   **************.******** ****

77. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ttcagactcagactcagatagcgactcagact	Protospacer
*   **************.***********.*

78. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgacagcgact	Protospacer
********* ***************   **.*

79. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgacagcgact	Protospacer
********* ***************   **.*

80. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

81. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

82. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

83. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagatagcgatagcgatt	Protospacer
******************.*****.   ****

84. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

85. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

86. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

87. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.844

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgatt	Protospacer
********* **************.   ****

88. spacer 1.6|326931|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.812

ttgtggctcagactcagattgtgattcagatt	CRISPR spacer
tagcgattcagactcagatagtgattccgatt	Protospacer
* *.*..************ ******* ****

89. spacer 1.6|326931|32|AP018587|CRT matches to NZ_LT009691 (Staphylococcus aureus strain NZAK3 plasmid 2) position: , mismatch: 6, identity: 0.812

ttgtggctcagactcagattgtgattcagatt	CRISPR spacer
tagcgactcagactcagatagcgattcagact	Protospacer
* *.*.************* *.********.*

90. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ctctgattcagactcagacagcgactctgatt	Protospacer
.  .**.******************** ****

91. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ctctgattcagactcagacagcgactctgatt	Protospacer
.  .**.******************** ****

92. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ctcagactcagactcagacagcgactctgact	Protospacer
.   *********************** **.*

93. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ctctgattcagactcagacagcgactctgatt	Protospacer
.  .**.******************** ****

94. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgatagcgact	Protospacer
.***********************.   **.*

95. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactcagactcagacagcgatagcgact	Protospacer
.***********************.   **.*

96. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagatagcgatagcgact	Protospacer
******************.*****.   **.*

97. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgact	Protospacer
********* **************.   **.*

98. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactcagactcagatagcgatagcgact	Protospacer
******************.*****.   **.*

99. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgactcagacagcgacagcgact	Protospacer
.******** ***************   **.*

100. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgactcagacagcgatagcgact	Protospacer
********* **************.   **.*

101. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgattcagacagcgatagcgatt	Protospacer
********* **.***********.   ****

102. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgattcagacagcgatagcgatt	Protospacer
********* **.***********.   ****

103. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgattcagacagcgatagcgatt	Protospacer
********* **.***********.   ****

104. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgattcagacagcgatagcgatt	Protospacer
********* **.***********.   ****

105. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ttcagactcagactcagatagcgactctgacg	Protospacer
*   **************.******** **. 

106. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
ttcagactcagactcagatagcgactctgacg	Protospacer
*   **************.******** **. 

107. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgactcagacagcgatagcgact	Protospacer
.******** **************.   **.*

108. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgattcagacagcgatagcgact	Protospacer
********* **.***********.   **.*

109. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

110. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

111. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

112. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

113. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

114. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgactctgattcagacagcgatagcgact	Protospacer
********* **.***********.   **.*

115. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

116. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
tagcgattcagactcagatagcgatagcgact	Protospacer
******.***********.*****.   **.*

117. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgatt	Protospacer
.******** **.***********.   ****

118. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgatt	Protospacer
.******** **.***********.   ****

119. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagtgattcagactcagacagcgatagcgatt	Protospacer
.**.**.*****************.   ****

120. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagtgattcagactcagacagcgatagcgatt	Protospacer
.**.**.*****************.   ****

121. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgatt	Protospacer
.******** **.***********.   ****

122. spacer 4.1|638514|33|AP018587|CRISPRCasFinder matches to NZ_CP023514 (Enterococcus sp. FDAARGOS_375 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.788

tgcatttgtccaaagacaaatgtaaacatatgg-	CRISPR spacer
tatttttgtccaaagataaatgtaatca-atgct	Protospacer
*.. ************.******** ** ***  

123. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

124. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

125. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

126. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

127. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

128. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

129. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

130. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

131. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

132. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

133. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

134. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

135. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

136. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgattcagactcagatagcgatagcgact	Protospacer
.*****.***********.*****.   **.*

137. spacer 1.10|327189|32|AP018587|CRT matches to NZ_CP035292 (Staphylococcus haemolyticus strain ATCC 29970 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

tagcgactcagactcagacagcgactcagatt	CRISPR spacer
cagcgactctgattcagacagcgatagcgact	Protospacer
.******** **.***********.   **.*

138. spacer 1.10|327189|32|AP018587|CRT matches to NC_048174 (Shigella phage HRP29, complete genome) position: , mismatch: 8, identity: 0.75

-tagcgactcagactcagacagcgactcagatt	CRISPR spacer
gttgt-actcagcctcagacagcgcctcagcgc	Protospacer
 * *. ****** *********** *****  .

139. spacer 1.10|327189|32|AP018587|CRT matches to MK562503 (Shigella phage Buco, complete genome) position: , mismatch: 8, identity: 0.75

-tagcgactcagactcagacagcgactcagatt	CRISPR spacer
gttgt-actcagcctcagacagcgcctcagcgc	Protospacer
 * *. ****** *********** *****  .

140. spacer 6.1|1669014|30|AP018587|CRISPRCasFinder matches to MT822287 (Erwinia phage pEp_SNUABM_11, complete genome) position: , mismatch: 8, identity: 0.733

cttttggtaatacttgaatctacgcttcat	CRISPR spacer
cgtccattaatacttgaatctccgcttcgg	Protospacer
* *... ************** ******. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 564238 : 580518 16 Bacillus_phage(33.33%) protease,holin NA
DBSCAN-SWA_2 970528 : 987092 24 uncultured_Caudovirales_phage(68.42%) terminase,integrase attL 963509:963526|attR 984638:984655
DBSCAN-SWA_3 1121031 : 1162060 33 Staphylococcus_phage(96.3%) tRNA NA
DBSCAN-SWA_4 1286497 : 1295638 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_5 1424037 : 1433873 11 Bacillus_phage(42.86%) NA NA
DBSCAN-SWA_6 1804981 : 1850335 71 Staphylococcus_phage(71.43%) terminase,holin,protease,integrase,tail attL 1837233:1837250|attR 1859412:1859429
DBSCAN-SWA_7 1939446 : 1947916 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_8 2187526 : 2196441 9 uncultured_Caudovirales_phage(71.43%) NA NA
DBSCAN-SWA_9 2214480 : 2224374 12 Pandoravirus(11.11%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage