Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP018725 Sulfuriflexus mobilis aks1 DNA, complete genome 2 crisprs NA 0 1 0 0

Results visualization

1. AP018725
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018725_1 2652945-2653040 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP018725_2 3004305-3004424 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 NZ_CP036456 Streptomonospora sp. M2 plasmid phiM2, complete sequence 36904-36933 8 0.733
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 JN106171 Uncultured bacterium plasmid pAKD26, complete sequence 37842-37871 8 0.733
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 NZ_CP017760 Cupriavidus necator strain NH9 plasmid pENH91, complete sequence 54320-54349 8 0.733
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 NC_019283 Delftia acidovorans plasmid pC1-1, complete sequence 38376-38405 8 0.733
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 NC_006830 Achromobacter xylosoxidans A8 plasmid pA81, complete sequence 23357-23386 8 0.733
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 NZ_CP045419 Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence 641128-641157 9 0.7
AP018725_2 2.1|3004350|30|AP018725|CRISPRCasFinder 3004350-3004379 30 MN693678 Marine virus AFVG_250M132, complete genome 21144-21173 10 0.667

1. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to NZ_CP036456 (Streptomonospora sp. M2 plasmid phiM2, complete sequence) position: , mismatch: 8, identity: 0.733 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
cgacctgctcgaccagtggcacaccaagct	Protospacer
.   .************ ********.**

2. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to JN106171 (Uncultured bacterium plasmid pAKD26, complete sequence) position: , mismatch: 8, identity: 0.733 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
cgggttgctcgaccagttccacacccgctt	Protospacer
.  *************** ****** * .

3. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to NZ_CP017760 (Cupriavidus necator strain NH9 plasmid pENH91, complete sequence) position: , mismatch: 8, identity: 0.733 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
cgggttgctcgaccagttccacacccgctt	Protospacer
.  *************** ****** * .

4. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to NC_019283 (Delftia acidovorans plasmid pC1-1, complete sequence) position: , mismatch: 8, identity: 0.733 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
cgggttgctcgaccagttccacacccgctt	Protospacer
.  *************** ****** * .

5. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to NC_006830 (Achromobacter xylosoxidans A8 plasmid pA81, complete sequence) position: , mismatch: 8, identity: 0.733 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
cgggttgctcgaccagttccacacccgctt	Protospacer
.  *************** ****** * .

6. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to NZ_CP045419 (Pseudoalteromonas sp. THAF3 plasmid pTHAF3_a, complete sequence) position: , mismatch: 9, identity: 0.7 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
agctttgctcgcccagttgcacacctccct	Protospacer
  . ******* *************   *

7. spacer 2.1|3004350|30|AP018725|CRISPRCasFinder matches to MN693678 (Marine virus AFVG_250M132, complete genome) position: , mismatch: 10, identity: 0.667 

tctgttgctcgaccagttgcacaccaggcg	CRISPR spacer
gctgttgctccaccagttgcacttagatta	Protospacer
 ********* *********** . .. ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage