Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034570 Maribacter sp. MJ134 chromosome, complete genome 2 crisprs DEDDh,cas3,csa3,cas4,cas2,cas1,cas6,cas5,cas7b,cas8b1 0 2 0 0

Results visualization

1. CP034570
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034570_1 1451425-1451526 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034570_3 3281759-3287117 TypeI-B NA
73 spacers
cas4,cas2,cas1,cas6,cas3,cas5,cas7b,cas8b1

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034570_3 3.26|3283620|35|CP034570|PILER-CR,CRISPRCasFinder,CRT 3283620-3283654 35 NZ_CP026418 Acinetobacter sp. ACNIH2 plasmid pKPC-8dee, complete sequence 14364-14398 9 0.743
CP034570_3 3.11|3282525|37|CP034570|PILER-CR,CRISPRCasFinder,CRT 3282525-3282561 37 AP014374 Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C54, *** SEQUENCING IN PROGRESS *** 27729-27765 10 0.73

1. spacer 3.26|3283620|35|CP034570|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026418 (Acinetobacter sp. ACNIH2 plasmid pKPC-8dee, complete sequence) position: , mismatch: 9, identity: 0.743

aaaaatagaaatgctttgaattactatgctttggt	CRISPR spacer
atcgttaagaatgcattggattactatgctttgga	Protospacer
*  . **..***** ***.*************** 

2. spacer 3.11|3282525|37|CP034570|PILER-CR,CRISPRCasFinder,CRT matches to AP014374 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S42-C54, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 10, identity: 0.73

attatttcctaataaccataaacccggacaaaaattt	CRISPR spacer
gatgattcctaaaaaccataaaccaggacaacaggct	Protospacer
. *. ******* *********** ****** *. .*

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage