Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP028314 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 chromosome, complete genome 3 crisprs PD-DExK,WYL,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3,cas3,DEDDh,DinG,RT 0 27 9 0
CP028317 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-3, complete sequence 0 crisprs NA 0 0 0 0
CP028316 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-2, complete sequence 0 crisprs DEDDh 0 0 12 0
CP028315 Salmonella enterica subsp. enterica serovar Typhimurium var. 5- strain CFSAN067217 plasmid pSC-31-1, complete sequence 0 crisprs DEDDh,cas14j 0 0 1 0

Results visualization

1. CP028314
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028314_2 950683-952115 TypeI-E I-E
23 spacers
cas8e,cse2gr11

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028314_3 968247-969254 TypeI-E I-E
16 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP028314_4 969328-969783 TypeI-E I-E
7 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP028314_2 2.19|951814|32|CP028314|PILER-CR 951814-951845 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
CP028314_2 2.19|951814|32|CP028314|PILER-CR 951814-951845 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
CP028314_2 2.29|951811|32|CP028314|CRISPRCasFinder,CRT 951811-951842 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
CP028314_2 2.29|951811|32|CP028314|CRISPRCasFinder,CRT 951811-951842 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
CP028314_3 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969131-969162 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
CP028314_3 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969131-969162 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
CP028314_2 2.23|951444|32|CP028314|CRISPRCasFinder,CRT 951444-951475 32 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130783-130814 2 0.938
CP028314_3 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969131-969162 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
CP028314_2 2.13|951444|35|CP028314|PILER-CR 951444-951478 35 NZ_CP030204 Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence 130780-130814 4 0.886
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_019849 Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence 850282-850313 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_003078 Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence 887728-887759 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP019586 Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence 856045-856076 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_017326 Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence 835457-835488 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021799 Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence 953948-953979 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_017323 Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence 431895-431926 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP009146 Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence 843687-843718 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_018701 Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence 833486-833517 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021828 Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence 457962-457993 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021802 Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence 1502459-1502490 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021820 Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence 1188725-1188756 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021831 Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence 1094940-1094971 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021823 Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence 574071-574102 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021814 Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence 758103-758134 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021795 Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence 92938-92969 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021810 Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence 1622461-1622492 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021806 Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence 174090-174121 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP021218 Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence 996227-996258 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP026527 Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence 856529-856560 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP019484 Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence 1026857-1026888 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP019487 Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence 801217-801248 6 0.812
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_020560 Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence 887731-887762 6 0.812
CP028314_3 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969009-969040 32 MT774487 Salmonella phage MG40, complete genome 21746-21777 6 0.812
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NC_011366 Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence 208454-208485 7 0.781
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NC_017958 Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence 449563-449594 7 0.781
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NZ_CP035001 Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence 167100-167131 7 0.781
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP030829 Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence 360377-360408 7 0.781
CP028314_3 3.9|968765|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968765-968796 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
CP028314_3 3.9|968765|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968765-968796 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
CP028314_3 3.11|968887|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968887-968918 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
CP028314_3 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969009-969040 32 JQ288021 Salmonella phage SPN3UB, complete genome 39452-39483 7 0.781
CP028314_3 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969009-969040 32 MH370364 Salmonella phage S107, complete genome 29959-29990 7 0.781
CP028314_3 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969009-969040 32 MH370382 Salmonella phage S135, complete genome 29959-29990 7 0.781
CP028314_3 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969009-969040 32 MH370383 Salmonella phage S137, complete genome 29959-29990 7 0.781
CP028314_2 2.8|951139|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951139-951170 32 CP001770 Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence 145771-145802 8 0.75
CP028314_2 2.9|951200|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951200-951231 32 LQ277707 Sequence 2 from Patent WO2016071503 12422-12453 8 0.75
CP028314_2 2.9|951200|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951200-951231 32 LZ998055 JP 2017534684-A/2: Phage Therapy 12422-12453 8 0.75
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NZ_CP028348 Novosphingobium sp. THN1 plasmid pTHN, complete sequence 1098771-1098802 8 0.75
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NZ_CP014128 Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence 160189-160220 8 0.75
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NC_014561 Pantoea vagans C9-1 plasmid pPag1, complete sequence 156443-156474 8 0.75
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NC_010553 Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence 137983-138014 8 0.75
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NC_012811 Methylorubrum extorquens AM1 megaplasmid, complete sequence 43093-43124 8 0.75
CP028314_2 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951322-951353 32 NZ_CP053442 Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence 152052-152083 8 0.75
CP028314_2 2.16|951631|32|CP028314|PILER-CR 951631-951662 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
CP028314_2 2.16|951631|32|CP028314|PILER-CR 951631-951662 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
CP028314_2 2.26|951628|32|CP028314|CRISPRCasFinder,CRT 951628-951659 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
CP028314_2 2.26|951628|32|CP028314|CRISPRCasFinder,CRT 951628-951659 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
CP028314_3 3.10|968826|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968826-968857 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
CP028314_4 4.6|969662|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969662-969693 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
CP028314_2 2.2|950773|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950773-950804 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
CP028314_2 2.2|950773|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950773-950804 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 DQ674738 Aeromonas phage phiO18P, complete genome 15707-15738 9 0.719
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NZ_CP031166 Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence 380725-380756 9 0.719
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 153785-153816 9 0.719
CP028314_2 2.6|951017|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951017-951048 32 MN694645 Marine virus AFVG_250M761, complete genome 31050-31081 9 0.719
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 MN062720 Microbacterium phage FuzzBuster, complete genome 19374-19405 9 0.719
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NZ_CP045722 Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence 332-363 9 0.719
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NZ_CP022519 Pantoea vagans strain FBS135 plasmid pPant3, complete sequence 62976-63007 9 0.719
CP028314_2 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951261-951292 32 NZ_CP028351 Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence 144976-145007 9 0.719
CP028314_2 2.14|951508|32|CP028314|PILER-CR 951508-951539 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
CP028314_2 2.24|951505|32|CP028314|CRISPRCasFinder,CRT 951505-951536 32 NZ_CP051686 Duganella sp. GN2-R2 plasmid unnamed1, complete sequence 45237-45268 9 0.719
CP028314_3 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968643-968674 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
CP028314_3 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969009-969040 32 MK448228 Klebsiella phage ST15-VIM1phi2.1, complete genome 32866-32897 9 0.719
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 NZ_CP019257 Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence 20006-20037 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 NZ_CP019274 Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence 9024-9055 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 NZ_CP019275 Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence 27130-27161 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 NZ_CP019279 Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence 19363-19394 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 NZ_CP019246 Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence 23427-23458 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 NC_049342 Escherichia phage 500465-1, complete genome 24342-24373 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 KY271398 Klebsiella phage 4 LV-2017, complete genome 28240-28271 10 0.688
CP028314_2 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 951078-951109 32 CP025900 Escherichia phage sp., complete genome 24342-24373 10 0.688
CP028314_2 2.20|951875|32|CP028314|PILER-CR 951875-951906 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
CP028314_2 2.30|951872|32|CP028314|CRISPRCasFinder,CRT 951872-951903 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
CP028314_2 2.33|952055|32|CP028314|CRISPRCasFinder,CRT 952055-952086 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
CP028314_3 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968643-968674 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
CP028314_3 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968643-968674 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
CP028314_3 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968643-968674 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
CP028314_3 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968643-968674 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
CP028314_3 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 968643-968674 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
CP028314_3 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 969131-969162 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
CP028314_4 4.7|969723|32|CP028314|CRISPRCasFinder,CRT 969723-969754 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
CP028314_4 4.7|969723|32|CP028314|CRISPRCasFinder,CRT 969723-969754 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NZ_CP054036 Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence 234768-234799 11 0.656
CP028314_2 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT 950834-950865 32 NZ_CP022568 Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence 299431-299462 11 0.656

1. spacer 2.19|951814|32|CP028314|PILER-CR matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

2. spacer 2.19|951814|32|CP028314|PILER-CR matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

3. spacer 2.29|951811|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

4. spacer 2.29|951811|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

5. spacer 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacgttcggcgatgttggccccatcggtccg	Protospacer
*******************************.

6. spacer 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacattcggcgatgttggccccatcggtcca	Protospacer
****.***************************

7. spacer 2.23|951444|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 2, identity: 0.938

aaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
aaacgaaagaggccatgcgattgtttatcggt	Protospacer
*************.*****.************

8. spacer 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ctacgttcggtgatgttggccccataggtcca	Protospacer
*.********.************** ******

9. spacer 2.13|951444|35|CP028314|PILER-CR matches to NZ_CP030204 (Salmonella enterica strain SA20083530 plasmid pSA20083530.1, complete sequence) position: , mismatch: 4, identity: 0.886

tcgaaacgaaagaggctatgcggttgtttatcggt	CRISPR spacer
atgaaacgaaagaggccatgcgattgtttatcggt	Protospacer
 .**************.*****.************

10. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_019849 (Sinorhizobium meliloti GR4 plasmid pRmeGR4d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

11. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_003078 (Sinorhizobium meliloti 1021 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

12. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019586 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

13. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_017326 (Sinorhizobium meliloti SM11 plasmid pSmeSM11d, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

14. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021799 (Sinorhizobium meliloti strain USDA1106 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

15. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_017323 (Sinorhizobium meliloti BL225C plasmid pSINMEB02, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

16. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009146 (Sinorhizobium meliloti strain RMO17 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

17. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_018701 (Sinorhizobium meliloti Rm41 plasmid pSYMB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

18. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021828 (Sinorhizobium meliloti strain KH35c plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

19. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021802 (Sinorhizobium meliloti strain USDA1021 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

20. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021820 (Sinorhizobium meliloti strain M162 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

21. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021831 (Sinorhizobium meliloti strain HM006 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

22. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021823 (Sinorhizobium meliloti strain KH46 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

23. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021814 (Sinorhizobium meliloti strain M270 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

24. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021795 (Sinorhizobium meliloti strain USDA1157 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

25. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021810 (Sinorhizobium meliloti strain Rm41 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

26. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021806 (Sinorhizobium meliloti strain T073 plasmid psymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

27. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021218 (Sinorhizobium meliloti RU11/001 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

28. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026527 (Sinorhizobium meliloti strain AK21 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

29. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019484 (Sinorhizobium meliloti strain B401 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

30. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019487 (Sinorhizobium meliloti strain B399 plasmid pSym, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

31. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_020560 (Sinorhizobium meliloti 2011 plasmid pSymB, complete sequence) position: , mismatch: 6, identity: 0.812

ttgacggtgacgtcagtgccgaa--ggcgaaata	CRISPR spacer
atgacggtgacgtcggagccgaagcggcggaa--	Protospacer
 *************.* ******  ****.**  

32. spacer 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MT774487 (Salmonella phage MG40, complete genome) position: , mismatch: 6, identity: 0.812

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgg	Protospacer
 .  **********************  ****

33. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_011366 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG202, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

34. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcaccgccgatcctttcaccgccgcc	Protospacer
********* ********* ****. *.  **

35. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035001 (Rhizobium acidisoli strain FH23 plasmid pRapFH23c, complete sequence) position: , mismatch: 7, identity: 0.781

ccggcatcagcgccgatccgttcatagtgccc---	CRISPR spacer
tcggcaccagcgccgatccggtca---tgctcgaa	Protospacer
.*****.************* ***   ***.*   

36. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030829 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750b, complete sequence) position: , mismatch: 7, identity: 0.781

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcttcggtgacgacattgccgaaggcgacgta	Protospacer
*.  ******** ** ************ .**

37. spacer 3.9|968765|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

38. spacer 3.9|968765|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

39. spacer 3.11|968887|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781

acgccccgaatgtgtttgcctcgcccgctgcc	CRISPR spacer
gcgacctgaatgtgtttgcctcgcgccgtggc	Protospacer
.** **.***************** *  ** *

40. spacer 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

41. spacer 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

42. spacer 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

43. spacer 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
ccatttcatcaggcactaccggcactggctgc	Protospacer
 .  **********************  *** 

44. spacer 2.8|951139|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to CP001770 (Spirosoma linguale DSM 74 plasmid pSLIN01, complete sequence) position: , mismatch: 8, identity: 0.75

cggaggatggaatatttccgaggctggcgatt	CRISPR spacer
tgggagatggaatacttccggggctggcaacc	Protospacer
.**..*********.*****.*******.*..

45. spacer 2.9|951200|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to LQ277707 (Sequence 2 from Patent WO2016071503) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

46. spacer 2.9|951200|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to LZ998055 (JP 2017534684-A/2: Phage Therapy) position: , mismatch: 8, identity: 0.75

atgccggaacgctgatggcgtttgacatgagc----	CRISPR spacer
ttgccggaacgctattggcgtttg----cagccttt	Protospacer
 ************. *********     ***    

47. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac-	CRISPR spacer
atacgctggtctataccggcaa-ggatccgctg	Protospacer
  ******************** *.*. ** . 

48. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014128 (Pantoea vagans strain FDAARGOS_160 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

49. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_014561 (Pantoea vagans C9-1 plasmid pPag1, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattc	Protospacer
****.********.********** * .   *

50. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_010553 (Burkholderia ambifaria MC40-6 plasmid pBMC401, complete sequence) position: , mismatch: 8, identity: 0.75

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
ggacgctgttcaataccggcaacgtccggatc	Protospacer
 ******* ** ************  ** . *

51. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
tcgacggtgacgtccgtgacgaaggtgttcga	Protospacer
*.************ *** ******.*    *

52. spacer 2.11|951322|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053442 (Rhizobium leguminosarum bv. trifolii strain CC275e plasmid pRltCC275eD, complete sequence) position: , mismatch: 8, identity: 0.75

ttgacggtgacgtcagtgccgaaggcgaaata	CRISPR spacer
ttctggtggacgtccgtgccgaaggcgcaatg	Protospacer
**   *  ****** ************ ***.

53. spacer 2.16|951631|32|CP028314|PILER-CR matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

54. spacer 2.16|951631|32|CP028314|PILER-CR matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

55. spacer 2.26|951628|32|CP028314|CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  . 

56. spacer 2.26|951628|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.** 

57. spacer 3.10|968826|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75

gaggcgtac-----aggctgttagatgagaaattacc	CRISPR spacer
-----atactaataaggctgtttgatgcgaaattacc	Protospacer
     .***     ******** **** *********

58. spacer 4.6|969662|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  . 

59. spacer 2.2|950773|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

60. spacer 2.2|950773|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*  

61. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to DQ674738 (Aeromonas phage phiO18P, complete genome) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatcagcgccgagcagttcagcaaactg	Protospacer
**************** * *****  . .*. 

62. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
gcggcatcagcgccgaccggttcaccgtcagg	Protospacer
 ***************.* *****. **    

63. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ccggcatgagcgccgatcagttcgacgccctg	Protospacer
******* ********** ****.  *. *. 

64. spacer 2.6|951017|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MN694645 (Marine virus AFVG_250M761, complete genome) position: , mismatch: 9, identity: 0.719

aacaggaacaggaaaaaaaagatttgtccggt	CRISPR spacer
tacagtaacaggaaaaaaaggattaatgatgc	Protospacer
 **** *************.**** .*   *.

65. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MN062720 (Microbacterium phage FuzzBuster, complete genome) position: , mismatch: 9, identity: 0.719

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaacggtcagcctgtccaggagga	Protospacer
****** *********** ****..**     

66. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045722 (Pantoea eucalypti strain LMG 24197 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

67. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022519 (Pantoea vagans strain FBS135 plasmid pPant3, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacgctgatctataccggcaacgtcaagttt	Protospacer
********.***************   .   .

68. spacer 2.10|951261|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028351 (Pantoea vagans strain PV989 plasmid pPV989-167, complete sequence) position: , mismatch: 9, identity: 0.719

tgacgctggtctataccggcaacgaacgcgac	CRISPR spacer
tgacactggtctacaccggcaacgtaaaattt	Protospacer
****.********.********** * .   .

69. spacer 2.14|951508|32|CP028314|PILER-CR matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

70. spacer 2.24|951505|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP051686 (Duganella sp. GN2-R2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719

ccccgatagcgacgcttctgtagtcactggca	CRISPR spacer
gtccgatagcgacacttcggtagtcaggcgtg	Protospacer
 .***********.**** *******   *..

71. spacer 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719

ttgcag----ggcgatattgttgttggtgaatggga	CRISPR spacer
----aacactgacgatattattgttggtgattgggg	Protospacer
    *.    *.*******.********** ****.

72. spacer 3.13|969009|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to MK448228 (Klebsiella phage ST15-VIM1phi2.1, complete genome) position: , mismatch: 9, identity: 0.719

gtcgttcatcaggcactaccggcactttctgg	CRISPR spacer
tgagttcatccggcactaccggcgctggatgc	Protospacer
   ******* ************.**   ** 

73. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019257 (Escherichia coli strain 13TMH22 plasmid p13TMH22-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

74. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019274 (Escherichia coli strain 13P477T plasmid p13P477T-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

75. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019275 (Escherichia coli strain 13P477T plasmid p13P477T-2, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

76. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019279 (Escherichia coli strain 13P477T plasmid p13P477T-6, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

77. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019246 (Escherichia coli strain Combat13F7 plasmid pCombat13F7-1, complete sequence) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

78. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_049342 (Escherichia phage 500465-1, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

79. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to KY271398 (Klebsiella phage 4 LV-2017, complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

80. spacer 2.7|951078|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to CP025900 (Escherichia phage sp., complete genome) position: , mismatch: 10, identity: 0.688

cagatcctcaacggtcaggctgtttagttcct	CRISPR spacer
cagatcgtcaaccgtcaggctgtcggtaaacc	Protospacer
****** ***** **********. .    *.

81. spacer 2.20|951875|32|CP028314|PILER-CR matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

82. spacer 2.30|951872|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

83. spacer 2.33|952055|32|CP028314|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*  

84. spacer 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

85. spacer 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

86. spacer 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

87. spacer 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

88. spacer 3.7|968643|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

89. spacer 3.15|969131|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
actcgttcggcgatgtggcccccatccaggtg	Protospacer
 * ************* * ******* .  ..

90. spacer 4.7|969723|32|CP028314|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

91. spacer 4.7|969723|32|CP028314|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

92. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054036 (Rhizobium sp. JKLM13E plasmid pPR13E05, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

93. spacer 2.3|950834|32|CP028314|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022568 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK04, complete sequence) position: , mismatch: 11, identity: 0.656

ccggcatcagcgccgatccgttcatagtgccc	CRISPR spacer
ttccgatcagcgccgatccgctcctagtctat	Protospacer
..   ***************.** **** . .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1643512 : 1659963 15 Salmonella_phage(30.77%) tail,holin,transposase NA
DBSCAN-SWA_2 1732726 : 1741897 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_3 1810205 : 1820711 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_4 1906704 : 1917307 13 Morganella_phage(25.0%) NA NA
DBSCAN-SWA_5 2021350 : 2051575 40 Escherichia_phage(18.18%) tail,protease,integrase attL 2025212:2025226|attR 2043698:2043712
DBSCAN-SWA_6 2818643 : 2909560 95 Salmonella_phage(59.57%) protease,holin,tail,tRNA,lysis,terminase NA
DBSCAN-SWA_7 2959623 : 2968355 8 Enterobacteria_phage(16.67%) transposase,protease NA
DBSCAN-SWA_8 3580976 : 3626629 69 Salmonella_phage(42.65%) protease,tail,lysis,integrase,transposase,portal,terminase,coat attL 3567660:3567676|attR 3635844:3635860
DBSCAN-SWA_9 4384774 : 4431818 50 Burkholderia_phage(40.91%) tail,tRNA,plate NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP028316
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 0 : 3891 6 Lactococcus_phage(33.33%) transposase NA
DBSCAN-SWA_2 10755 : 12423 1 Erysipelothrix_phage(100.0%) NA NA
DBSCAN-SWA_3 15488 : 22916 10 Brevibacillus_phage(25.0%) NA NA
DBSCAN-SWA_4 27376 : 33903 8 Stx2-converting_phage(40.0%) transposase NA
DBSCAN-SWA_5 37546 : 43401 11 Sodalis_phage(25.0%) NA NA
DBSCAN-SWA_6 47042 : 48158 1 unidentified_phage(100.0%) NA NA
DBSCAN-SWA_7 52076 : 55823 7 Bacillus_phage(50.0%) NA NA
DBSCAN-SWA_8 63151 : 64663 1 Pseudoalteromonas_phage(100.0%) NA NA
DBSCAN-SWA_9 67832 : 135103 43 Stx2-converting_phage(17.65%) integrase,transposase attL 56553:56569|attR 84335:84351
DBSCAN-SWA_10 143095 : 146696 3 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_11 165454 : 167865 3 Stx2-converting_phage(66.67%) transposase NA
DBSCAN-SWA_12 176565 : 185248 13 Streptococcus_phage(25.0%) tail,head NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP028315
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 10948 : 57627 60 Escherichia_phage(20.0%) integrase,transposase attL 16514:16528|attR 26832:26846
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage