Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP029474 Staphylococcus aureus strain USA 100 isolate 30-47 chromosome, complete genome 9 crisprs RT,WYL,cas3,DEDDh,DinG,csa3 9 3 8 1
CP029475 Staphylococcus aureus strain USA 100 isolate 30-47 plasmid unnamed, complete sequence 0 crisprs csa3 0 0 0 0

Results visualization

1. CP029474
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_1 74204-74284 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_3 196063-196143 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_4 1107418-1107519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_5 1462354-1462436 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_6 1503301-1503379 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_7 1508756-1509025 Unclear NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_8 1551806-1551887 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_9 2314326-2314410 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP029474_10 2705943-2706024 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 870344-870365 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 993403-993424 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 1335365-1335386 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 1461396-1461417 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 1551879-1551900 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 2044449-2044470 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 2314402-2314423 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 2328936-2328957 0 1.0
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 2646089-2646110 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 870344-870365 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 993403-993424 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 1335365-1335386 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 1461396-1461417 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 1551879-1551900 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 2044449-2044470 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 2314402-2314423 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 2328936-2328957 0 1.0
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 2646089-2646110 0 1.0
CP029474_10 10.1|2705967|34|CP029474|CRISPRCasFinder 2705967-2706000 34 CP029474.1 1503300-1503333 0 1.0
CP029474_10 10.1|2705967|34|CP029474|CRISPRCasFinder 2705967-2706000 34 CP029474.1 1831284-1831317 0 1.0
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1516044-1516074 1 0.968
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1516100-1516130 1 0.968
CP029474_6 6.1|1503325|31|CP029474|CRISPRCasFinder 1503325-1503355 31 CP029474.1 2348809-2348839 1 0.968
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 1638357-1638378 1 0.955
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 2348664-2348685 1 0.955
CP029474_7 7.1|1508792|22|CP029474|CRT 1508792-1508813 22 CP029474.1 2348897-2348918 1 0.955
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 185234-185256 1 0.957
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 1462345-1462367 1 0.957
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 1462623-1462645 1 0.957
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 2044565-2044587 1 0.957
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 2646147-2646169 1 0.957
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 1638357-1638378 1 0.955
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 2348664-2348685 1 0.955
CP029474_7 7.3|1508909|22|CP029474|CRT 1508909-1508930 22 CP029474.1 2348897-2348918 1 0.955
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 185234-185256 1 0.957
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 1462345-1462367 1 0.957
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 1462623-1462645 1 0.957
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 2044565-2044587 1 0.957
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 2646147-2646169 1 0.957
CP029474_8 8.1|1551830|34|CP029474|CRISPRCasFinder 1551830-1551863 34 CP029474.1 2044545-2044578 1 0.971
CP029474_9 9.1|2314352|33|CP029474|CRISPRCasFinder 2314352-2314384 33 CP029474.1 2044546-2044578 1 0.97
CP029474_10 10.1|2705967|34|CP029474|CRISPRCasFinder 2705967-2706000 34 CP029474.1 2441027-2441060 1 0.971
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 185287-185317 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 360873-360903 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 771702-771732 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1068680-1068710 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1335420-1335450 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1516156-1516186 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1552142-1552172 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1734356-1734386 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 1836882-1836912 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 2044504-2044534 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 2132936-2132966 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 2328990-2329020 2 0.935
CP029474_3 3.1|196088|31|CP029474|CRISPRCasFinder 196088-196118 31 CP029474.1 2644741-2644771 2 0.935
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 2132883-2132905 2 0.913
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 CP029474.1 2706024-2706046 2 0.913
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 2132883-2132905 2 0.913
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 CP029474.1 2706024-2706046 2 0.913
CP029474_10 10.1|2705967|34|CP029474|CRISPRCasFinder 2705967-2706000 34 CP029474.1 641276-641309 2 0.941
CP029474_10 10.1|2705967|34|CP029474|CRISPRCasFinder 2705967-2706000 34 CP029474.1 2048919-2048952 2 0.941

1. spacer 7.1|1508792|22|CP029474|CRT matches to position: 870344-870365, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

2. spacer 7.1|1508792|22|CP029474|CRT matches to position: 993403-993424, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

3. spacer 7.1|1508792|22|CP029474|CRT matches to position: 1335365-1335386, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

4. spacer 7.1|1508792|22|CP029474|CRT matches to position: 1461396-1461417, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

5. spacer 7.1|1508792|22|CP029474|CRT matches to position: 1551879-1551900, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

6. spacer 7.1|1508792|22|CP029474|CRT matches to position: 2044449-2044470, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

7. spacer 7.1|1508792|22|CP029474|CRT matches to position: 2314402-2314423, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

8. spacer 7.1|1508792|22|CP029474|CRT matches to position: 2328936-2328957, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

9. spacer 7.1|1508792|22|CP029474|CRT matches to position: 2646089-2646110, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

10. spacer 7.3|1508909|22|CP029474|CRT matches to position: 870344-870365, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

11. spacer 7.3|1508909|22|CP029474|CRT matches to position: 993403-993424, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

12. spacer 7.3|1508909|22|CP029474|CRT matches to position: 1335365-1335386, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

13. spacer 7.3|1508909|22|CP029474|CRT matches to position: 1461396-1461417, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

14. spacer 7.3|1508909|22|CP029474|CRT matches to position: 1551879-1551900, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

15. spacer 7.3|1508909|22|CP029474|CRT matches to position: 2044449-2044470, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

16. spacer 7.3|1508909|22|CP029474|CRT matches to position: 2314402-2314423, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

17. spacer 7.3|1508909|22|CP029474|CRT matches to position: 2328936-2328957, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

18. spacer 7.3|1508909|22|CP029474|CRT matches to position: 2646089-2646110, mismatch: 0, identity: 1.0

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttcgaaa	Protospacer
**********************

19. spacer 10.1|2705967|34|CP029474|CRISPRCasFinder matches to position: 1503300-1503333, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

20. spacer 10.1|2705967|34|CP029474|CRISPRCasFinder matches to position: 1831284-1831317, mismatch: 0, identity: 1.0

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctctgtgttgg	Protospacer
**********************************

21. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1516044-1516074, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

22. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1516100-1516130, mismatch: 1, identity: 0.968

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgtcagct	Protospacer
***********************.*******

23. spacer 6.1|1503325|31|CP029474|CRISPRCasFinder matches to position: 2348809-2348839, mismatch: 1, identity: 0.968

ctgtgttggggccccgccaacttgcattgcc	CRISPR spacer
ctgtgttggggccccgccaacttccattgcc	Protospacer
*********************** *******

24. spacer 7.1|1508792|22|CP029474|CRT matches to position: 1638357-1638378, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

25. spacer 7.1|1508792|22|CP029474|CRT matches to position: 2348664-2348685, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

26. spacer 7.1|1508792|22|CP029474|CRT matches to position: 2348897-2348918, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

27. spacer 7.2|1508850|23|CP029474|CRT matches to position: 185234-185256, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

28. spacer 7.2|1508850|23|CP029474|CRT matches to position: 1462345-1462367, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

29. spacer 7.2|1508850|23|CP029474|CRT matches to position: 1462623-1462645, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

30. spacer 7.2|1508850|23|CP029474|CRT matches to position: 2044565-2044587, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

31. spacer 7.2|1508850|23|CP029474|CRT matches to position: 2646147-2646169, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

32. spacer 7.3|1508909|22|CP029474|CRT matches to position: 1638357-1638378, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttcttttagaaa	Protospacer
***************** ****

33. spacer 7.3|1508909|22|CP029474|CRT matches to position: 2348664-2348685, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

34. spacer 7.3|1508909|22|CP029474|CRT matches to position: 2348897-2348918, mismatch: 1, identity: 0.955

cctgtagaatttcttttcgaaa	CRISPR spacer
cctgtagaatttctttacgaaa	Protospacer
**************** *****

35. spacer 7.4|1508967|23|CP029474|CRT matches to position: 185234-185256, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

36. spacer 7.4|1508967|23|CP029474|CRT matches to position: 1462345-1462367, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

37. spacer 7.4|1508967|23|CP029474|CRT matches to position: 1462623-1462645, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

38. spacer 7.4|1508967|23|CP029474|CRT matches to position: 2044565-2044587, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

39. spacer 7.4|1508967|23|CP029474|CRT matches to position: 2646147-2646169, mismatch: 1, identity: 0.957

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatccaat	Protospacer
**************.********

40. spacer 8.1|1551830|34|CP029474|CRISPRCasFinder matches to position: 2044545-2044578, mismatch: 1, identity: 0.971

attgagaatccaatttctctttgttggggcccat	CRISPR spacer
attgggaatccaatttctctttgttggggcccat	Protospacer
****.*****************************

41. spacer 9.1|2314352|33|CP029474|CRISPRCasFinder matches to position: 2044546-2044578, mismatch: 1, identity: 0.97

attgggaatccaatttctctgtgttggggccca	CRISPR spacer
attgggaatccaatttctctttgttggggccca	Protospacer
******************** ************

42. spacer 10.1|2705967|34|CP029474|CRISPRCasFinder matches to position: 2441027-2441060, mismatch: 1, identity: 0.971

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttgtgttgg	Protospacer
*************************.********

43. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 185287-185317, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

44. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 360873-360903, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

45. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 771702-771732, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

46. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1068680-1068710, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

47. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1335420-1335450, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

48. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1516156-1516186, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

49. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1552142-1552172, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

50. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1734356-1734386, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

51. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 1836882-1836912, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

52. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 2044504-2044534, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

53. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 2132936-2132966, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

54. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 2328990-2329020, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgactttccgccagct	Protospacer
***********************.*.*****

55. spacer 3.1|196088|31|CP029474|CRISPRCasFinder matches to position: 2644741-2644771, mismatch: 2, identity: 0.935

cacattattgtaagctgactttctgtcagct	CRISPR spacer
cacattattgtaagctgacttttcgtcagct	Protospacer
**********************..*******

56. spacer 7.2|1508850|23|CP029474|CRT matches to position: 2132883-2132905, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

57. spacer 7.2|1508850|23|CP029474|CRT matches to position: 2706024-2706046, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

58. spacer 7.4|1508967|23|CP029474|CRT matches to position: 2132883-2132905, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgtagaaattgggaatacaat	Protospacer
**************.*** ****

59. spacer 7.4|1508967|23|CP029474|CRT matches to position: 2706024-2706046, mismatch: 2, identity: 0.913

tctgtagaaattggaaatccaat	CRISPR spacer
tctgttgaaattgggaatccaat	Protospacer
***** ********.********

60. spacer 10.1|2705967|34|CP029474|CRISPRCasFinder matches to position: 641276-641309, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtagaatttcttttcgaaattctttttgttgg	Protospacer
*************************.* ******

61. spacer 10.1|2705967|34|CP029474|CRISPRCasFinder matches to position: 2048919-2048952, mismatch: 2, identity: 0.941

ttgtagaatttcttttcgaaattctctgtgttgg	CRISPR spacer
ttgtggaatttcttatcgaaattctctgtgttgg	Protospacer
****.********* *******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP029474_7 7.2|1508850|23|CP029474|CRT 1508850-1508872 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 AP014226 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS *** 28490-28512 3 0.87
CP029474_7 7.4|1508967|23|CP029474|CRT 1508967-1508989 23 AP014225 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS *** 24653-24675 3 0.87
CP029474_2 2.1|86551|34|CP029474|CRISPRCasFinder 86551-86584 34 JN882286 Cronobacter phage vB_CsaP_GAP52, complete genome 23034-23067 8 0.765
CP029474_2 2.1|86551|34|CP029474|CRISPRCasFinder 86551-86584 34 CP030544 Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence 7567-7600 8 0.765

1. spacer 7.2|1508850|23|CP029474|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

2. spacer 7.2|1508850|23|CP029474|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

3. spacer 7.4|1508967|23|CP029474|CRT matches to AP014226 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S44-C3, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

4. spacer 7.4|1508967|23|CP029474|CRT matches to AP014225 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C9-MedDCM-OCT-S41-C89, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 3, identity: 0.87

tctgtagaaattggaaatccaat	CRISPR spacer
actgtagaaaatggaaatccaac	Protospacer
 ********* ***********.

5. spacer 2.1|86551|34|CP029474|CRISPRCasFinder matches to JN882286 (Cronobacter phage vB_CsaP_GAP52, complete genome) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgcatatctttagctttatagcttttatatgct	Protospacer
******************** *.** .*  **  

6. spacer 2.1|86551|34|CP029474|CRISPRCasFinder matches to CP030544 (Staphylococcus aureus strain ER04166.3 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765

ttgcatatctttagctttattgtttgcaactggg	CRISPR spacer
ttgaataactttagctttattgttataaacagta	Protospacer
*** *** ****************   *** * .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1440474 : 1448295 10 Hokovirus(16.67%) NA NA
DBSCAN-SWA_2 1460266 : 1474906 18 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_3 1556118 : 1574945 28 Staphylococcus_phage(85.0%) integrase,coat,terminase attL 1550995:1551012|attR 1569567:1569584
DBSCAN-SWA_4 1663813 : 1715828 54 Streptococcus_phage(33.33%) holin,protease,bacteriocin,tRNA NA
DBSCAN-SWA_5 1735866 : 1744339 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_6 2363996 : 2373039 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_7 2503033 : 2565244 60 Staphylococcus_phage(95.65%) protease,tRNA NA
DBSCAN-SWA_8 2571445 : 2575691 6 Staphylococcus_phage(66.67%) NA NA
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP029474.1|AZR70603.1|1464091_1464193_+|hypothetical-protein 1464091_1464193_+ 33 aa aa NA NA NA 1460266-1474906 yes