Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034346 Paenibacillus sp. MBLB1234 chromosome, complete genome 6 crisprs WYL,RT,csa3,DinG,cas3,DEDDh 0 3 8 0

Results visualization

1. CP034346
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034346_1 1384909-1384983 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034346_2 1462546-1462622 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034346_3 1556858-1556932 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034346_4 2637399-2637472 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034346_5 3709701-3709775 Unclear NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034346_6 5345879-5345969 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034346_4 4.1|2637423|26|CP034346|CRISPRCasFinder 2637423-2637448 26 AP022646 Bacillus wiedmannii PL1 plasmid pBwiPL1-3 DNA, complete sequence 28463-28488 4 0.846
CP034346_2 2.1|1462572|25|CP034346|CRISPRCasFinder 1462572-1462596 25 NZ_CP049245 Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence 64165-64189 5 0.8
CP034346_2 2.1|1462572|25|CP034346|CRISPRCasFinder 1462572-1462596 25 NZ_CP015745 Shinella sp. HZN7 plasmid pShin-09, complete sequence 40802-40826 5 0.8
CP034346_5 5.1|3709726|25|CP034346|CRISPRCasFinder 3709726-3709750 25 NZ_LR134437 Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 28 11171-11195 5 0.8

1. spacer 4.1|2637423|26|CP034346|CRISPRCasFinder matches to AP022646 (Bacillus wiedmannii PL1 plasmid pBwiPL1-3 DNA, complete sequence) position: , mismatch: 4, identity: 0.846

ccgcaaaagcagcgcttaataaaatt	CRISPR spacer
ccgcaaccgcagcgcttaataaattc	Protospacer
******  *************** *.

2. spacer 2.1|1462572|25|CP034346|CRISPRCasFinder matches to NZ_CP049245 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence) position: , mismatch: 5, identity: 0.8

acaggtttaacaagcttggaatggg	CRISPR spacer
acaggtttcacaagcttggaagccc	Protospacer
******** ************    

3. spacer 2.1|1462572|25|CP034346|CRISPRCasFinder matches to NZ_CP015745 (Shinella sp. HZN7 plasmid pShin-09, complete sequence) position: , mismatch: 5, identity: 0.8

acaggtttaacaagcttggaatggg	CRISPR spacer
acaggtttcacaagcttggaagccc	Protospacer
******** ************    

4. spacer 5.1|3709726|25|CP034346|CRISPRCasFinder matches to NZ_LR134437 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 28) position: , mismatch: 5, identity: 0.8

atttatttacctcaaaatgtagggc	CRISPR spacer
atttattcacctcaaaatgtaaatt	Protospacer
*******.*************.. .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 992114 : 1003346 9 Mollivirus(25.0%) NA NA
DBSCAN-SWA_2 1698775 : 1723673 31 Brevibacillus_phage(30.43%) tail,portal,plate NA
DBSCAN-SWA_3 1923749 : 1932103 6 Bacillus_virus(83.33%) NA NA
DBSCAN-SWA_4 2410217 : 2420132 11 Staphylococcus_phage(50.0%) NA NA
DBSCAN-SWA_5 3068717 : 3125794 71 Bacillus_phage(34.21%) portal,tRNA,integrase,tail,terminase,plate attL 3064614:3064630|attR 3119038:3119054
DBSCAN-SWA_6 3859499 : 3866168 6 Bacillus_phage(83.33%) NA NA
DBSCAN-SWA_7 5653698 : 5686085 39 uncultured_Caudovirales_phage(29.41%) portal,capsid,protease,integrase,tail,holin,terminase,head attL 5650928:5650949|attR 5686090:5686111
DBSCAN-SWA_8 5774939 : 5783268 9 Escherichia_phage(28.57%) coat NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage