Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032820 Butyricimonas sp. H184 plasmid unnamed, complete sequence 0 crisprs NA 0 0 0 0
CP032819 Butyricimonas sp. H184 chromosome, complete genome 4 crisprs DEDDh,cas3,RT,csa3,DinG,PD-DExK 0 1 4 3

Results visualization

1. CP032819
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032819_1 496491-496605 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032819_2 783336-783424 Orphan NA
1 spacers
RT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032819_3 1581503-1581584 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032819_4 4554941-4555043 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032819_3 3.1|1581530|28|CP032819|CRISPRCasFinder 1581530-1581557 28 MN234235 Mycobacterium phage BogosyJay, complete genome 33380-33407 8 0.714
CP032819_3 3.1|1581530|28|CP032819|CRISPRCasFinder 1581530-1581557 28 MN234200 Mycobacterium phage Maminiaina, complete genome 33362-33389 8 0.714

1. spacer 3.1|1581530|28|CP032819|CRISPRCasFinder matches to MN234235 (Mycobacterium phage BogosyJay, complete genome) position: , mismatch: 8, identity: 0.714

tcgtttctcccggggaggaggcgcagcg	CRISPR spacer
agcaggctcccgcggaggaggcgcagca	Protospacer
      ****** **************.

2. spacer 3.1|1581530|28|CP032819|CRISPRCasFinder matches to MN234200 (Mycobacterium phage Maminiaina, complete genome) position: , mismatch: 8, identity: 0.714

tcgtttctcccggggaggaggcgcagcg	CRISPR spacer
agcaggctcccgcggaggaggcgcagca	Protospacer
      ****** **************.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 934442 : 944756 10 unidentified_phage(62.5%) NA NA
DBSCAN-SWA_2 1332936 : 1338418 8 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_3 1686833 : 1695416 7 Escherichia_phage(50.0%) NA NA
DBSCAN-SWA_4 3755868 : 3764869 8 unidentified_phage(71.43%) NA NA
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP032819.1|AZS29041.1|1226065_1226488_+|PcfK-like-protein 1226065_1226488_+ 140 aa aa 40 NA NA No NA
CP032819.1|AZS29109.1|1296839_1297262_+|PcfK-like-protein 1296839_1297262_+ 140 aa aa 40 NA NA No NA
CP032819.1|AZS29180.1|1366583_1367039_+|PcfK-like-protein 1366583_1367039_+ 151 aa aa 40 NA NA No NA