1. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to BK000583 (TPA_inf: Enterobacteria phage P22 wild type, complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
2. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to MN161573 (UNVERIFIED: Salmonella virus P22 isolate HT105/1 int-201, complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
3. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to AB426868 (Enterobacteria phage P22 DNA, complete genome, strain: ATCC 19585-B1) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
4. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to J02471 (Bacteriophage P22 essential recombination function (erf) gene, complete cds; growth-related protein genes abc-1 and abc-2, complete cds) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
5. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to KR296686 (Salmonella phage 22, complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
6. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to L06296 (Bacteriophage P22 eaA - eaI genes, complete cds) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
7. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to NC_002371 (Enterobacteria phage P22 virus, complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
8. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to KR296688 (Salmonella phage 34, complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
9. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to AF217253 (Bacteriophage P22 complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
10. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to KR296687 (Salmonella phage 25, complete genome) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
11. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to AB362338 (Enterobacteria phage P22 DNA, complete sequence, strain: MSU) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
12. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to AF527608 (Bacteriophage P22-pbi, complete sequence) position: , mismatch: 1, identity: 0.969
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
tgccgcgcatttcgcctccagttcccgataat Protospacer
.*******************************
13. spacer 3.7|907947|32|CP034721|PILER-CR matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 5, identity: 0.844
--gcagtcaaaaagaattacccgtataaattcga CRISPR spacer
atgcaat--aaaagaattacccgtattaattaga Protospacer
***.* ***************** **** **
14. spacer 3.15|907946|32|CP034721|CRISPRCasFinder,CRT matches to NC_018688 (Bacillus thuringiensis MC28 plasmid pMC319, complete sequence) position: , mismatch: 5, identity: 0.844
--gcagtcaaaaagaattacccgtataaattcga CRISPR spacer
atgcaat--aaaagaattacccgtattaattaga Protospacer
***.* ***************** **** **
15. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 5, identity: 0.844
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
ccagacaaccgagaccgagaccgagacccaga Protospacer
* ** ********************* ***
16. spacer 3.6|907886|32|CP034721|PILER-CR matches to NZ_CP015351 (Bacillus thuringiensis strain MYBT18246 plasmid p150790, complete sequence) position: , mismatch: 6, identity: 0.812
atcatcgccgaccacctgacattgccagtgtg-- CRISPR spacer
ataatcgccaaccacctgacatt--caatttgac Protospacer
** ******.************* **.* **
17. spacer 3.14|907885|32|CP034721|CRISPRCasFinder matches to NZ_CP015351 (Bacillus thuringiensis strain MYBT18246 plasmid p150790, complete sequence) position: , mismatch: 6, identity: 0.812
atcatcgccgaccacctgacattgccagtgtg-- CRISPR spacer
ataatcgccaaccacctgacatt--caatttgac Protospacer
** ******.************* **.* **
18. spacer 3.21|908311|32|CP034721|CRISPRCasFinder,CRT matches to MN096267 (Pseudomonas phage vB_PaS_IME307, complete genome) position: , mismatch: 6, identity: 0.812
-cactgcgcgaggcgttcggtattgaggttcac CRISPR spacer
gcaatac-ccaggcgttcgacattgaggttcac Protospacer
** *.* * *********..************
19. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 6, identity: 0.812
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gaccgagaccgagaccgagaccgagaccgaga Protospacer
..*. *************************
20. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 6, identity: 0.812
cgtcactac-cgagaccgagaccgagaccgaga CRISPR spacer
-gcccccacgcgagactgagaccgagactgaga Protospacer
*.* *.** ******.***********.****
21. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 6, identity: 0.812
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
cgctgccagcgctatacgtgccagctcctccg Protospacer
*********.** **************. *
22. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
cgctgacagtgcgacacgtgccagcttcaaac Protospacer
***** ********.***********..** .
23. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 6, identity: 0.812
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tgatgccagcgcgatacgtgccagctccattt Protospacer
.* ******.*****************.* .*
24. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 6, identity: 0.812
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tgatgccagcgcgatacgtgccagctccattt Protospacer
.* ******.*****************.* .*
25. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 6, identity: 0.812
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tgatgccagcgcgatacgtgccagctccattt Protospacer
.* ******.*****************.* .*
26. spacer 5.47|926332|31|CP034721|CRISPRCasFinder matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 6, identity: 0.806
tgcagcg-cgacatgatgaaggacatcatcgt CRISPR spacer
-gcaccaccgagatcatgaaggacatcatcgg Protospacer
*** *. *** ** ****************
27. spacer 5.53|926697|31|CP034721|CRISPRCasFinder matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 6, identity: 0.806
--tcagcgtgatatcgcccgtcagcgccttgtt CRISPR spacer
catcgccgagata--gcccgtcagcgccttgtc Protospacer
**. ** **** *****************.
28. spacer 5.54|926757|31|CP034721|CRISPRCasFinder matches to NZ_CP034088 (Methylocystis rosea strain GW6 plasmid pGW6_2, complete sequence) position: , mismatch: 6, identity: 0.806
-cgatcacaaacgacgacgccgattttattga CRISPR spacer
tccgtca-gaacgacgacgccgatttttgtga Protospacer
* .*** .****************** ***
29. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 6, identity: 0.812
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
cggcgcccggcccgaaccggcggtgcccatgc Protospacer
********* ************ ** *.* *
30. spacer 3.11|908196|32|CP034721|PILER-CR matches to CP053405 (Salmonella enterica strain 2010K-2057 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccggaggcaacgcctttaccggcaccggtggt CRISPR spacer
cctgttaccacgcctttacctgcaccagtggt Protospacer
** * .* *********** *****.*****
31. spacer 3.13|907825|31|CP034721|CRISPRCasFinder matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 7, identity: 0.774
gtagggcagatgcgcagggagcgtgacgagg CRISPR spacer
gcacgaaagatgcgcagcgagcgggacgagt Protospacer
*.* *. ********** ***** ******
32. spacer 3.19|908189|32|CP034721|CRISPRCasFinder,CRT matches to CP053405 (Salmonella enterica strain 2010K-2057 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ccggaggcaacgcctttaccggcaccggtggt CRISPR spacer
cctgttaccacgcctttacctgcaccagtggt Protospacer
** * .* *********** *****.*****
33. spacer 3.22|907886|31|CP034721|CRT matches to NZ_CP013746 (Arthrobacter alpinus strain A3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
tcatcgccgaccacctgacattgccagtgtg CRISPR spacer
gaatcgccgaccacctgacgttgccacagct Protospacer
*****************.****** *.
34. spacer 3.22|907886|31|CP034721|CRT matches to NZ_CP013746 (Arthrobacter alpinus strain A3 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.774
tcatcgccgaccacctgacattgccagtgtg CRISPR spacer
gaatcgccgaccacctgacgttgccacagct Protospacer
*****************.****** *.
35. spacer 5.39|925729|30|CP034721|CRISPRCasFinder matches to NZ_CP015008 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA03, complete sequence) position: , mismatch: 7, identity: 0.767
gttaccgattggcgttgtcgttaacggccc CRISPR spacer
catcccgattggcgtcgtcgtcaacggcga Protospacer
* ***********.*****.******
36. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagaccgcgaccgagaccgaaa Protospacer
** . .********** ************.*
37. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
caccgagaccgcgaccgagaccgaaaccgaga Protospacer
*..*. **** ************.*******
38. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MT758688 (Mycobacterium phage CELFI, complete genome) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
caacgggaccgagaccgggaccgggaccgaga Protospacer
*. *. **********.*****.********
39. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_006363 (Nocardia farcinica IFM 10152 plasmid pNF2, complete sequence) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
catccgcaccgagaccgcgaccgagatcgagc Protospacer
*.** .********** ********.****
40. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_LN868942 (Nocardia farcinica strain NCTC11134 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
catccgcaccgagaccgcgaccgagatcgagc Protospacer
*.** .********** ********.****
41. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP031420 (Nocardia farcinica strain W6977 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
catccgcaccgagaccgcgaccgagatcgagc Protospacer
*.** .********** ********.****
42. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgccgaggccgagaccgaggccgaggccgaga Protospacer
**.*. .***********.*****.******
43. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 7, identity: 0.781
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgccgccgccgagaccgaggccgaggccgagg Protospacer
**.*.*..***********.*****.*****.
44. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to NZ_CP039495 (Salmonella enterica subsp. enterica serovar Bareilly str. CFSAN000669 plasmid pCFSAN000669_2, complete sequence) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
45. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
46. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to AJ011580 (Bacteriophage PS34 lysis genes 13, 19, 15, antiterminator gene 23, and packaging gene 3, complete cds) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
47. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KU927496 (Salmonella phage 101962B_sal5, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
48. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KU927491 (Salmonella phage 146851_sal5, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
49. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to MG969415 (UNVERIFIED: Salmonella phage GE_vB_TR, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
50. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KU927495 (Salmonella phage 103203_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
51. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KU927498 (Salmonella phage 64795_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
52. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KU927492 (Salmonella phage 146851_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
53. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to NC_030919 (Salmonella phage 118970_sal4, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
54. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to NC_028696 (Salmonella phage SEN22, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
55. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to NC_018275 (Salmonella phage vB_SemP_Emek, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
56. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to JQ806764 (Salmonella phage vB_SosS_Oslo, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
57. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to MH370364 (Salmonella phage S107, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
58. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to NC_017985 (Salmonella phage SPN9CC, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
59. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to NC_042346 (Salmonella virus BTP1 genome assembly, chromosome: BTP1) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
60. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to MH370382 (Salmonella phage S135, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
61. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to MH370383 (Salmonella phage S137, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
62. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to MT932212 (Salmonella phage VSe13, complete genome) position: , mismatch: 7, identity: 0.781
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
cgccacttatcgccgctattacgctatttcgt Protospacer
** * *.********** ***********.
63. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MT261384 (Salmonella virus PAT1, complete genome) position: , mismatch: 7, identity: 0.781
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
agatgccagcgcgatacgagccagctccctct Protospacer
* ******.******** ********. **
64. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MT580116 (Salmonella phage 65FD, complete genome) position: , mismatch: 7, identity: 0.781
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
agatgccagcgcgatacgagccagctccctct Protospacer
* ******.******** ********. **
65. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MT580117 (Salmonella phage 66FD, complete genome) position: , mismatch: 7, identity: 0.781
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
agatgccagcgcgatacgagccagctccctct Protospacer
* ******.******** ********. **
66. spacer 5.47|926332|31|CP034721|CRISPRCasFinder matches to NZ_KP294352 (Paracoccus kondratievae strain NCIMB 13773 plasmid pKON1, complete sequence) position: , mismatch: 7, identity: 0.774
tgcagcg-cgacatgatgaaggacatcatcgt CRISPR spacer
-atcgcgtcgacatgatgaacgacatcttcgg Protospacer
.. *** ************ ****** ***
67. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP026305 (Streptomyces lunaelactis strain MM109 plasmid pSLUN1, complete sequence) position: , mismatch: 7, identity: 0.781
cggcgcccgccccgaaccggcgctggctagga-- CRISPR spacer
cggcgcccgccgcgagccggcgc--gccacggcg Protospacer
*********** ***.******* **.* *.
68. spacer 3.1|907581|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
acgcgggaaacaacagcaggcgcggcggtcat CRISPR spacer
cggcgggaaccaacagcatgcgcggcgcccgc Protospacer
******* ******** ******** .*..
69. spacer 3.3|907703|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015739 (Shinella sp. HZN7 plasmid pShin-03, complete sequence) position: , mismatch: 8, identity: 0.75
cgccgcgcatttcgcctccagttcccgataat CRISPR spacer
ggccgcgcctttcgcatccagttcgccgtatc Protospacer
******* ****** ******** * .** .
70. spacer 3.5|907825|32|CP034721|PILER-CR,CRT matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 8, identity: 0.75
gtagggcagatgcgcagggagcgtgacgaggg CRISPR spacer
gcacgaaagatgcgcagcgagcgggacgagtc Protospacer
*.* *. ********** ***** ******
71. spacer 3.6|907886|32|CP034721|PILER-CR matches to NZ_CP013746 (Arthrobacter alpinus strain A3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
atcatcgccgaccacctgacattgccagtgtg CRISPR spacer
ggaatcgccgaccacctgacgttgccacagct Protospacer
. *****************.****** *.
72. spacer 3.6|907886|32|CP034721|PILER-CR matches to NZ_CP013746 (Arthrobacter alpinus strain A3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
atcatcgccgaccacctgacattgccagtgtg CRISPR spacer
ggaatcgccgaccacctgacgttgccacagct Protospacer
. *****************.****** *.
73. spacer 3.11|908196|32|CP034721|PILER-CR matches to NZ_CP016441 (Bordetella pseudohinzii strain HI4681 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccggaggcaacgcctttaccggcaccggtggt CRISPR spacer
ccggaggcaacgcctataccagcatcctcgag Protospacer
*************** ****.***.* .*.
74. spacer 3.14|907885|32|CP034721|CRISPRCasFinder matches to NZ_CP013746 (Arthrobacter alpinus strain A3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
atcatcgccgaccacctgacattgccagtgtg CRISPR spacer
ggaatcgccgaccacctgacgttgccacagct Protospacer
. *****************.****** *.
75. spacer 3.14|907885|32|CP034721|CRISPRCasFinder matches to NZ_CP013746 (Arthrobacter alpinus strain A3 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
atcatcgccgaccacctgacattgccagtgtg CRISPR spacer
ggaatcgccgaccacctgacgttgccacagct Protospacer
. *****************.****** *.
76. spacer 3.18|908129|31|CP034721|CRISPRCasFinder,CRT matches to NZ_CP007650 (Lactobacillus salivarius strain JCM1046 plasmid pCTN1046, complete sequence) position: , mismatch: 8, identity: 0.742
ccaaacagcagcattaaggtctgaaaatcgc CRISPR spacer
cagaaaagcagcattaaggtctgaatttacg Protospacer
* .** ******************* *
77. spacer 3.19|908189|32|CP034721|CRISPRCasFinder,CRT matches to NZ_CP016441 (Bordetella pseudohinzii strain HI4681 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccggaggcaacgcctttaccggcaccggtggt CRISPR spacer
ccggaggcaacgcctataccagcatcctcgag Protospacer
*************** ****.***.* .*.
78. spacer 5.11|925606|37|CP034721|CRT matches to NC_022747 (Vibrio phage VPUSM 8, complete genome) position: , mismatch: 8, identity: 0.784
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
cagttacatgggtaccatgtacggcatcttcaaaaat Protospacer
* *.**. **** *****************.*** .*
79. spacer 5.11|925606|37|CP034721|CRT matches to KX058879 (Vibrio phage VcP032, complete genome) position: , mismatch: 8, identity: 0.784
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
cagttacatgggtaccatgtacggcatcttcaaaaat Protospacer
* *.**. **** *****************.*** .*
80. spacer 5.11|925606|37|CP034721|CRT matches to AB374228 (Vibrio phage kappa proviral DNA, complete genome) position: , mismatch: 8, identity: 0.784
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
cagttacatgggtaccatgtacggcatcttcaaaaat Protospacer
* *.**. **** *****************.*** .*
81. spacer 5.11|925606|37|CP034721|CRT matches to AF125163 (Bacteriophage K139, complete genome) position: , mismatch: 8, identity: 0.784
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
cagttacatgggtaccatgtacggcatcttcaaaaat Protospacer
* *.**. **** *****************.*** .*
82. spacer 5.11|925606|37|CP034721|CRT matches to NC_003313 (Vibrio phage K139, complete genome) position: , mismatch: 8, identity: 0.784
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
cagttacatgggtaccatgtacggcatcttcaaaaat Protospacer
* *.**. **** *****************.*** .*
83. spacer 5.11|925606|37|CP034721|CRT matches to KU504502 (UNVERIFIED: Vibrio phage 919TP, complete genome) position: , mismatch: 8, identity: 0.784
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
cagttacatgggtaccatgtacggcatcttcaaaaat Protospacer
* *.**. **** *****************.*** .*
84. spacer 5.39|925729|30|CP034721|CRISPRCasFinder matches to NZ_CP033462 (Brevibacillus laterosporus strain 1821L plasmid p1821L02, complete sequence) position: , mismatch: 8, identity: 0.733
gttaccgattggcgttgtcgttaacggccc CRISPR spacer
gctaccgtttggcgttgttgttaacaagaa Protospacer
*.***** **********.******..
85. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
aagcgtcgtcgagaccgagaccgagaccgaga Protospacer
. *.....***********************
86. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------aaccgagaccgagaccgagacccagacccagt Protospacer
********************* ***
87. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to JQ807255 (Environmental Halophage eHP-36, partial genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cactggaaccgagaccgagaccgagaccgatg Protospacer
*.... *********************** .
88. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MH509446 (Gordonia phage DelRio, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gaccgcgaccgagaccgaaaccgagacggagt Protospacer
..*.* ***********.******** ***
89. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
ggccgagaccgaggccgaggccgagaccgagg Protospacer
*.*. ******.*****.***********.
90. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK359319 (Gordonia phage Parada, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
91. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK359319 (Gordonia phage Parada, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
92. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK376958 (Gordonia phage Brylie, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
93. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK376958 (Gordonia phage Brylie, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
94. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MH399781 (Gordonia phage Nadeem, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
95. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MH399781 (Gordonia phage Nadeem, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
96. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
97. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK967392 (Gordonia phage GrandSlam, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
98. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK279893 (Gordonia phage WheatThin, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
99. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK279893 (Gordonia phage WheatThin, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
100. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MT701595 (Streptomyces phage Shaeky, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgaggacaccgagaccgaggccgaggccgagg Protospacer
** . .************.*****.*****.
101. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_031247 (Gordonia phage BetterKatz, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
102. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_031247 (Gordonia phage BetterKatz, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgaaggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
103. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK305885 (Gordonia phage Mulch, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
gacctcgaccgagaccgaaaccgagacggagt Protospacer
..* * ***********.******** ***
104. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MK305885 (Gordonia phage Mulch, complete genome) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgagggcaccgagacctcgaccgagaccgaaa Protospacer
** . .********* ************.*
105. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP014599 (Yangia sp. CCB-MM3 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
ctacagcaccaagaccgagaccgagacggaat Protospacer
* ** .***.**************** **.
106. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MG269973 (TM7 phage DolZOral124_53_65, complete genome) position: , mismatch: 8, identity: 0.75
-----cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
acaagcgt-----ccgaaaccgaaaccgagaccgagc Protospacer
*** ****.*****.************
107. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to NZ_CP032182 (Citrobacter freundii strain AR_0116 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tgatgccagcgcgatacgcgccagctcacgca Protospacer
.* ******.********.******** .*
108. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to JQ288021 (Salmonella phage SPN3UB, complete genome) position: , mismatch: 8, identity: 0.75
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tgatgccagcgcgatacgcgccagctcacgca Protospacer
.* ******.********.******** .*
109. spacer 5.47|926332|31|CP034721|CRISPRCasFinder matches to JN106175 (Uncultured bacterium plasmid pAKD34, complete sequence) position: , mismatch: 8, identity: 0.742
tgcagcgcgacatgatgaaggacatcatcgt CRISPR spacer
agtgggacgacatgatgaaggtcatcgtcgg Protospacer
*..* .************** ****.***
110. spacer 5.47|926332|31|CP034721|CRISPRCasFinder matches to JN106167 (Uncultured bacterium plasmid pAKD16, complete sequence) position: , mismatch: 8, identity: 0.742
tgcagcgcgacatgatgaaggacatcatcgt CRISPR spacer
agtgggacgacatgatgaaggtcatcgtcgg Protospacer
*..* .************** ****.***
111. spacer 5.52|926636|32|CP034721|CRISPRCasFinder matches to MH622943 (Myoviridae sp. isolate ctbc_4, complete genome) position: , mismatch: 8, identity: 0.75
cggctatttgaagagactccgggtggagacct CRISPR spacer
agagtatttgaagaaactccgggtggaatttt Protospacer
*. **********.************. ..*
112. spacer 5.53|926697|31|CP034721|CRISPRCasFinder matches to NZ_CP045319 (Roseivivax sp. THAF197b plasmid pTHAF197b_a, complete sequence) position: , mismatch: 8, identity: 0.742
tcagcgtgatatcgcccgtcagcgccttgtt CRISPR spacer
tgatgatggtatcgcccgtcaccgccttgcg Protospacer
* * .**.************ *******.
113. spacer 5.57|926936|31|CP034721|CRISPRCasFinder matches to NZ_LR215032 (Mycoplasma gallopavonis strain NCTC10186 plasmid 2) position: , mismatch: 8, identity: 0.742
cctttataaaattgggtgatggcgttaaaga CRISPR spacer
actttacaaaatttggtgatggcggagctga Protospacer
*****.****** ********** . **
114. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP032327 (Azospirillum brasilense strain MTCC4035 plasmid p6, complete sequence) position: , mismatch: 8, identity: 0.75
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
ggacgccagccccgaaccggcgctggtcgagg Protospacer
*.**** ******************....*.
115. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
cggcgcccgccccgacccgccgcacccgcggt Protospacer
*************** *** *** * **
116. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_009837 (Escherichia coli APEC O1 plasmid pAPEC-O1-ColBM, complete sequence) position: , mismatch: 8, identity: 0.75
---gctggagtgttacgccctgactcataatttga CRISPR spacer
caacct---gtgctgcgccctgactcataattgca Protospacer
** ***.*.***************** *
117. spacer 3.5|907825|32|CP034721|PILER-CR,CRT matches to KC107834 (Cronobacter sakazakii phage vB_CskP_GAP227, complete genome) position: , mismatch: 9, identity: 0.719
gtagggcagatgcgcagggagcgtgacgaggg CRISPR spacer
attaacaagatgcgcagggagcgtaccgagtg Protospacer
.* .. *****************. **** *
118. spacer 3.7|907947|32|CP034721|PILER-CR matches to AJ635161 (Pyrobaculum spherical virus complete genome) position: , mismatch: 9, identity: 0.719
gcagtcaaaaagaattacccgtataaattcga CRISPR spacer
actatcaaaaagaaatagccgtataaaaacct Protospacer
.* .********** ** ********* *
119. spacer 3.8|908008|32|CP034721|PILER-CR matches to NZ_CP015040 (Rhodovulum sp. P5 plasmid pRGUI01, complete sequence) position: , mismatch: 9, identity: 0.719
atcccggctactggtccggcgacacagtgcgc CRISPR spacer
ttcccggccactggaccggcgacaagctctgg Protospacer
*******.***** ********* . * .*
120. spacer 3.13|907825|31|CP034721|CRISPRCasFinder matches to KC107834 (Cronobacter sakazakii phage vB_CskP_GAP227, complete genome) position: , mismatch: 9, identity: 0.71
gtagggcagatgcgcagggagcgtgacgagg CRISPR spacer
attaacaagatgcgcagggagcgtaccgagt Protospacer
.* .. *****************. ****
121. spacer 3.15|907946|32|CP034721|CRISPRCasFinder,CRT matches to AJ635161 (Pyrobaculum spherical virus complete genome) position: , mismatch: 9, identity: 0.719
gcagtcaaaaagaattacccgtataaattcga CRISPR spacer
actatcaaaaagaaatagccgtataaaaacct Protospacer
.* .********** ** ********* *
122. spacer 3.16|908007|32|CP034721|CRISPRCasFinder,CRT matches to NZ_CP015040 (Rhodovulum sp. P5 plasmid pRGUI01, complete sequence) position: , mismatch: 9, identity: 0.719
atcccggctactggtccggcgacacagtgcgc CRISPR spacer
ttcccggccactggaccggcgacaagctctgg Protospacer
*******.***** ********* . * .*
123. spacer 3.21|908311|32|CP034721|CRISPRCasFinder,CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 9, identity: 0.719
cactgcgcgaggcgttcggtattgaggttcac CRISPR spacer
aactgcgcgaggcggtcgatattgtcggcggc Protospacer
************* ***.***** * . .*
124. spacer 3.21|908311|32|CP034721|CRISPRCasFinder,CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 9, identity: 0.719
cactgcgcgaggcgttcggtattgaggttcac CRISPR spacer
aactgcgcgaggcggtcgatattgtcggcggc Protospacer
************* ***.***** * . .*
125. spacer 4.1|908493|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031226 (Pseudomonas amygdali pv. lachrymans str. M301315 plasmid pMPPla107, complete sequence) position: , mismatch: 9, identity: 0.719
gccagcgcagaccgtgtgccacaactggagca CRISPR spacer
aatagcgcagaccgtgagccaaaactcggtga Protospacer
. .************* **** **** *. *
126. spacer 4.2|908554|32|CP034721|PILER-CR,CRISPRCasFinder,CRT matches to MK016501 (Mycobacterium phage Nebkiss, complete genome) position: , mismatch: 9, identity: 0.719
caagcggatgtcgtgaaaaaactcaacgacgc CRISPR spacer
gatccagatgtcgtgaaaaagatcaacgaaat Protospacer
* *.**************. ******* ..
127. spacer 5.11|925606|37|CP034721|CRT matches to JF974301 (Vibrio phage VD1, *** SEQUENCING IN PROGRESS ***, 5 unordered pieces) position: , mismatch: 9, identity: 0.757
ccgctatctggggaccatgtacggcatctttaaacgt CRISPR spacer
ctcatacatgggtaccatgtacggcatctttaaaaac Protospacer
*. **. **** ********************* ..
128. spacer 5.16|925908|35|CP034721|CRT matches to AP013984 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C7A-MedDCM-OCT-S44-C181, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.743
cgcctgcaacacctttatcaaaagcgttctccgtg CRISPR spacer
ctgctgcaacagctttatccaaagcgttagcagaa Protospacer
* ******** ******* ******** * * .
129. spacer 5.16|925908|35|CP034721|CRT matches to AP013528 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G3, isolate: uvMED-CGR-C7A-MedDCM-OCT-S41-C23) position: , mismatch: 9, identity: 0.743
cgcctgcaacacctttatcaaaagcgttctccgtg CRISPR spacer
ctgctgcaacagctttatccaaagcgttagcagaa Protospacer
* ******** ******* ******** * * .
130. spacer 5.16|925908|35|CP034721|CRT matches to KT997859 (Uncultured Mediterranean phage uvDeep-CGR2-KM19-C184, complete genome) position: , mismatch: 9, identity: 0.743
cgcctgcaacacctttatcaaaagcgttctccgtg CRISPR spacer
ctgctgcaacagctttatccaaagcgttggcagaa Protospacer
* ******** ******* ******** * * .
131. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP028537 (Enterobacter hormaechei strain SCEH020042 plasmid pQnrB4_020042, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
132. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_AP023191 (Escherichia coli strain TUM18530 plasmid pMTY18530-1_lncHI2, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
133. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MN539017 (Salmonella sp. strain PJM1 plasmid pPJM1, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
134. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MN539018 (Salmonella sp. strain OYZ4 plasmid pOYZ4, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
135. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MT077888 (Escherichia coli plasmid p65, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
136. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_009838 (Escherichia coli APEC O1 plasmid pAPEC-O1-R, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
137. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP044306 (Escherichia coli strain C27A plasmid pC27A-CTX-M-55, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
138. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP039170 (Salmonella enterica subsp. enterica serovar Goldcoast strain Sal-5364 plasmid pSal-5364, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
139. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to CP048299 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL_SAL-A00527 plasmid pN1566-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
140. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to CP048303 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain WAPHL-SAL-A00375 plasmid p28945-2, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
141. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP037959 (Salmonella enterica subsp. enterica serovar Goldcoast strain R18.0877 plasmid pR18.0877_278k, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
142. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP039861 (Salmonella enterica subsp. enterica serovar 1,4,[5],12:i:- strain PNCS014880 plasmid p16-6773.1, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
143. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP048776 (Salmonella enterica subsp. enterica serovar Agona strain SG17-135 plasmid pSG17-135-HI2, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
144. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_019114 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH111_227, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
145. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_AP023198 (Escherichia coli strain TUM18780 plasmid pMTY18780-1_lncHI2, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
146. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
147. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP043223 (Salmonella enterica subsp. enterica serovar Bredeney strain SA20114778WT plasmid pET1.1-IncH, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
148. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP027411 (Salmonella enterica strain FDAARGOS_319 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgagaccgataccgaat Protospacer
********************** *
149. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to JQ807227 (Environmental Halophage eHP-6, partial genome) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cactggaaccgggaccgagaccgagaccgatg Protospacer
*.... ****.****************** .
150. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
caccgacgccgaggccgagaccgaggccgagg Protospacer
*..*. ..*****.***********.*****.
151. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NC_019201 (Streptomyces sp. x4(2010) plasmid pTSC1, complete sequence) position: , mismatch: 9, identity: 0.719
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
acgcgagactgagaccgagactgagaccgagc Protospacer
*. **.***********.*********
152. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to NC_029094 (Pseudoalteromonas phage H101, complete genome) position: , mismatch: 9, identity: 0.719
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
acaaaaaggcttacaattatgaatatcgatca Protospacer
* ******.******* ******** . *
153. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to AP013511 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-C117A-MedDCM-OCT-S32-C49) position: , mismatch: 9, identity: 0.719
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
actcgagattttagaattatgaatataacaaa Protospacer
* . .*.. **** *** **************
154. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to AP013877 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C117A-MedDCM-OCT-S27-C30, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 9, identity: 0.719
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
actcgagattttagaattatgaatataacaaa Protospacer
* . .*.. **** *** **************
155. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to NZ_CP028198 (Salmonella enterica subsp. enterica serovar Concord strain CFSAN018747 plasmid pGMI14-002_2, complete sequence) position: , mismatch: 9, identity: 0.719
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tgatgccagtgcaatccgtgccagctcacgaa Protospacer
.* *********.** *********** .
156. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to MH898687 (Edwardsiella phage Edno5, complete genome) position: , mismatch: 9, identity: 0.719
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
agacgccagcgcgatacgcgccagctctttgc Protospacer
* .*****.********.********* .
157. spacer 5.53|926697|31|CP034721|CRISPRCasFinder matches to NZ_CP010326 (Pantoea sp. PSNIH1 plasmid pPSP-3a9, complete sequence) position: , mismatch: 9, identity: 0.71
tcagcgtgatatcgcccgtcagcgccttgtt CRISPR spacer
agtgcgtgatctcccccgtcagcgccccggc Protospacer
******* ** ************..* .
158. spacer 5.53|926697|31|CP034721|CRISPRCasFinder matches to MG592643 (Vibrio phage 1.275.O._10N.286.54.E11, partial genome) position: , mismatch: 9, identity: 0.71
tcagcgtgatatcgcccgtcagcgccttgtt CRISPR spacer
atgccaatatatcgaccgtcagcgccttctt Protospacer
.. *. ****** ************* **
159. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP007798 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p5, complete sequence) position: , mismatch: 9, identity: 0.719
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
ggacgccagccccgaaccggcgctggtcgaag Protospacer
*.**** ******************......
160. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP007515 (Rubrobacter radiotolerans strain RSPS-4 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
cggcgcccgacccgaaccggcgcaactcgagt Protospacer
********* ************* . ....*
161. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 9, identity: 0.719
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
attcgcccgccccgaactgtcgctggccgcgg Protospacer
**************.* *******.. *.
162. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
ccccgccggccccgaaccggccctggacctgc Protospacer
* **** ************* **** . *
163. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP050953 (Rhodococcus sp. DMU1 plasmid unnamed) position: , mismatch: 9, identity: 0.719
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
ccccgccggccccgaaccggccctggacctgc Protospacer
* **** ************* **** . *
164. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP026494 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
165. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_KU355873 (Escherichia coli strain FAM22871 plasmid pFAM22871_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
166. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_KX276657 (Escherichia coli strain MRSN388634 plasmid pMR0516mcr, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
167. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to KR827684 (Escherichia coli plasmid pCERC3, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
168. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_KP119165 (Escherichia coli strain QT598 plasmid pEC598, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
169. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP038792 (Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
170. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_AP017611 (Escherichia coli strain 20Ec-P-124 plasmid pMRY16-002_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
171. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_AP023192 (Escherichia coli strain TUM18530 plasmid pMTY18530-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
172. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP010158 (Escherichia coli strain D10 plasmid A, complete genome) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
173. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP043952 (Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
174. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP010141 (Escherichia coli strain D3 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
175. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP025844 (Escherichia coli strain 720632 plasmid p720632_94, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
176. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP043219 (Escherichia coli O80:H26 strain EC-107 plasmid pET6.2-IncFII, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
177. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP049349 (Escherichia coli strain 3R plasmid p3R-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
178. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP021087 (Escherichia coli strain 13P460A plasmid p13P460A-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
179. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to CP043737 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
180. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LS992167 (Escherichia coli isolate Escherichia coli str. TO6 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
181. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP053606 (Escherichia coli strain NEB_Turbo plasmid F', complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
182. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP053608 (Escherichia coli strain NEB5-alpha_F'Iq plasmid F'Iq, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
183. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP019282 (Escherichia coli strain 13P484A plasmid p13P484A-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
184. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP048296 (Escherichia coli strain CVM N18EC0432 plasmid pN18EC0432-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
185. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP021728 (Escherichia coli strain Combat11I9 plasmid pCombat11I9-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
186. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP005931 (Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
187. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP049082 (Escherichia coli strain p10A plasmid p10A_p1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
188. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MN158992 (Escherichia coli strain TREC9 plasmid pTREC9, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
189. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP029748 (Escherichia coli strain 2016C-3878 plasmid pMCR1-PA, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
190. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP049355 (Escherichia coli strain T28R plasmid pT28R-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
191. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP024055 (Escherichia coli strain SMN197SH3 plasmid pO177A3, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
192. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP024617 (Escherichia coli strain SMN152SH1 plasmid pO177A1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
193. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP032263 (Escherichia coli strain AR_0089 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
194. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MN158991 (Escherichia coli strain TREC8 plasmid pTREC8, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
195. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP044348 (Escherichia coli strain P225M plasmid pP225M-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
196. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP027357 (Escherichia coli strain 2013C-4991 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
197. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041421 (Escherichia coli strain STEC711 plasmid pSTEC711_5, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
198. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041438 (Escherichia coli strain STEC005 plasmid pSTEC005, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
199. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP019018 (Escherichia coli strain Ecol_244 plasmid pEC244_2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
200. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP042619 (Escherichia coli strain NCYU-26-73 plasmid pNCYU-26-73-4, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
201. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP019007 (Escherichia coli strain Ecol_AZ159 plasmid pECAZ159_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
202. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP019456 (Escherichia coli strain FHI_NMBU_03 plasmid pFHI_NMBU_03_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
203. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041436 (Escherichia coli strain STEC309 plasmid pSTEC309, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
204. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MK492260 (Escherichia coli strain MG1655 K12 plasmid F-Tn10, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
205. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP043415 (Escherichia coli strain EC42405 plasmid pNTEC2-42405, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
206. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041303 (Escherichia coli strain MSHS 133 plasmid pCys-11, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
207. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP026754 (Escherichia coli strain AR_0077 plasmid tig00000042_pilon, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
208. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LT985252 (Escherichia coli strain 666 plasmid RCS51_p, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
209. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
210. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_004998 (Escherichia coli plasmid p1658/97, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
211. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP017221 (Escherichia coli strain FAM21845 plasmid pFAM21845_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
212. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LT985319 (Escherichia coli strain ECOR 30 genome assembly, plasmid: RCS96_pII) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
213. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_024956 (Escherichia coli strain K-12 plasmid pDM0133, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
214. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_025179 (Escherichia coli plasmid pC59-153, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
215. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to CP042897 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_01, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
216. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP027448 (Escherichia coli strain 2014C-3075 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
217. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_010862 (Escherichia coli plasmid pMAR7, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
218. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP024827 (Escherichia coli strain CREC-544 plasmid pCREC-544_1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
219. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP030782 (Escherichia albertii strain 07-3866 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
220. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to KU932025 (Escherichia coli plasmid pEC14I, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
221. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP050647 (Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
222. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_025175 (Escherichia coli plasmid pH2332-166, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
223. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_025139 (Escherichia coli plasmid pH2291-144, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
224. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP027256 (Escherichia coli strain EC11 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
225. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP013027 (Escherichia coli strain 2009C-3133 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
226. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP010149 (Escherichia coli strain D6 plasmid A, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
227. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_019122 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH163_120, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
228. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP023674 (Escherichia coli strain SMN013SH2 plasmid pO177A2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
229. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MN158989 (Escherichia coli strain TREC1 plasmid pTREC1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
230. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to CP050167 (Escherichia coli plasmid Carbapenemase(NDM-4)_IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
231. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP022166 (Escherichia coli strain M160133 plasmid pM160133_p2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
232. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP009167 (Escherichia coli 1303 plasmid p1303_109, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
233. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to CP022610 (Escherichia coli strain ATCC 700415 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
234. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP042247 (Escherichia coli strain BCE049 plasmid pBCE049-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
235. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP047577 (Escherichia coli strain 94EC plasmid p94EC-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
236. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP010345 (Escherichia coli ECC-1470 plasmid pECC-1470_100, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
237. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP023384 (Escherichia coli strain 1223 plasmid p147, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
238. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_002483 (Escherichia coli K-12 plasmid F DNA, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
239. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP020934 (Escherichia coli strain HB-Coli0 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
240. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP048440 (Escherichia coli strain NBRC 3301 plasmid putative_pEcol1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
241. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MH061383 (Pseudomonas aeruginosa plasmid pP6qnrS1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
242. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LR025097 (Escherichia coli isolate EC-7215 plasmid 2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
243. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP030791 (Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
244. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MN823988 (Escherichia coli strain 14406 plasmid p14406-FII, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
245. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LR740777 (Escherichia coli strain BEN2908 isolate 1 day old chicken plasmid pAPEC2908) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
246. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP011496 (Escherichia coli strain NCM3722 isolate K-12 plasmid F, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
247. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041299 (Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
248. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP031107 (Escherichia coli strain AMSCJX02 plasmid pAMSC2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
249. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
250. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_011603 (Escherichia coli O127:H6 str. E2348/69 plasmid pMAR2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
251. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_019117 (Salmonella enterica subsp. enterica serovar Heidelberg plasmid pSH696_117, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
252. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP048026 (Escherichia coli strain GZEC065 plasmid pTEM1-GZEC065, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
253. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP029744 (Escherichia coli strain AR_0085 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
254. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_AP023199 (Escherichia coli strain TUM18780 plasmid pMTY18780-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
255. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_022885 (Escherichia coli strain LK-NARMP plasmid pKPC-LKEc, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
256. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NC_012944 (Escherichia coli Vir68 plasmid pVir68, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
257. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041920 (Escherichia coli strain Ec40743 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
258. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP041997 (Escherichia coli strain AR Bank #0349 plasmid pAR349, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
259. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP032891 (Escherichia coli strain SCEC020022 plasmid pVir_020022, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
260. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP024140 (Escherichia coli strain 14EC020 plasmid p14EC020b, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
261. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP014271 (Escherichia coli K-12 strain K-12 DHB4 plasmid F128-(DHB4), complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
262. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP019909 (Escherichia coli strain MDR_56 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
263. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP031295 (Escherichia coli strain EC17GD31 plasmid pGD31-F1928, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
264. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP049102 (Escherichia coli strain EC28 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
265. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP026930 (Escherichia coli strain CFS3246 plasmid pCFS3246-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
266. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
267. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
268. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP014273 (Escherichia coli K-12 strain K-12 C3026 plasmid F128-(C3026), complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
269. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_LT985293 (Escherichia coli strain 4410-1 plasmid RCS79_p, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
270. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP026934 (Escherichia coli strain CFS3273 plasmid pCFS3273-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
271. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MN807689 (Escherichia coli strain A241 plasmid pA241-TEM, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
272. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MK878890 (Escherichia coli strain J53 plasmid pMG337, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
273. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP006635 (Escherichia coli PCN033 plasmid p3PCN033, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
274. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MF370216 (Escherichia coli strain J53 plasmid pOX38-Gen, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
275. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MF474175 (Escherichia coli strain J53/pNIT-HK plasmid pNIT-HK, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
276. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MG825372 (Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
277. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MG825378 (Escherichia coli strain 1108 plasmid p1108-IncFIB, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
278. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MF174860 (Escherichia coli strain 6/14/6b plasmid pIncF-MU4, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
279. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MG385063 (Escherichia coli strain WF5-29 plasmid pWF5-29, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
280. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_MH202955 (Escherichia coli strain HXH-1 plasmid pHXH-1, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
281. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
282. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
283. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to NZ_CP044190 (Salmonella enterica subsp. enterica strain AR-0401 plasmid pAR-0401-2, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
284. spacer 5.60|927117|32|CP034721|CRISPRCasFinder matches to MN816372 (Escherichia coli strain A130 plasmid pA130-TEM, complete sequence) position: , mismatch: 9, identity: 0.719
gctggagtgttacgccctgactcataatttga CRISPR spacer
caaccagtgctgcgccctgactcataattgca Protospacer
****.*.***************** *
285. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
286. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
287. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to NC_007814 (Bacillus phage Fah, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
288. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to KY963370 (Bacillus phage Negev_SA, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
289. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ150593 (Bacillus anthracis bacteriophage Fah, complete sequence) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
290. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ222853 (Bacillus anthracis phage Gamma isolate 51, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
291. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ221100 (Bacteriophage gamma putative terminase small subunit, putative terminase large subunit, putative portal protein, putative prohead protease, putative phage structural protein, putative DNA packaging protein, putative head-tail adaptor, phage related proteins, putative major tail protein, phage related protein, putative tail tape measure protein, phage related protein, putative minor structural protein, putative holin, N-acetylmuramoyl-L-alanine amidase (PlyG), putative lipoprotein, putative transcriptional regulator, conserved hypothetical proteins, FtsK/SpoIIIE family protein, phage related protein, conserved hypothetical protein, putative transcriptional regulator, putative site-specific recombinase, conserved hypothetical protein, putative transcriptional regulators, putative antirepressor, conserved hypothetical protein, putative DNA replication proteins, conserved hypothetical protein, phage related proteins, conserved hypothetical protein, putative transglycosylase, and putative endonuclease genes, complete cds) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
292. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ222851 (Bacillus anthracis phage Cherry, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
293. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to DQ289556 (Bacillus anthracis phage Gamma isolate d'Herelle, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
294. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
295. spacer 5.61|927178|32|CP034721|CRISPRCasFinder matches to NC_007458 (Bacillus phage Gamma, complete genome) position: , mismatch: 9, identity: 0.719
aagataactcctgtctttccatcattcgaagc CRISPR spacer
atgttaactcctgtccttccatccttcatcct Protospacer
* * ***********.******* ***. .
296. spacer 3.11|908196|32|CP034721|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggaggcaacgcctttaccggcaccggtggt CRISPR spacer
acaagtacaacgccattaccggccccggtgac Protospacer
*... .******* ******** ******..
297. spacer 3.19|908189|32|CP034721|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.688
ccggaggcaacgcctttaccggcaccggtggt CRISPR spacer
acaagtacaacgccattaccggccccggtgac Protospacer
*... .******* ******** ******..
298. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_KY689633 (Escherichia coli strain 100R plasmid p100R, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
299. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_KY689632 (Escherichia coli strain 19-M12 plasmid p19M12, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
300. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP045446 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 9355 plasmid p280_9355, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
301. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_KU743384 (Escherichia coli strain SA26 plasmid pSA26-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
302. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_KU254578 (Escherichia coli strain YD786 plasmid pYD786-1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
303. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_KX129782 (Escherichia coli strain S38 plasmid pS38, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
304. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP015833 (Escherichia coli O157 strain 180-PT54 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
305. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to LT221036 (Yersinia pseudotuberculosis strain Yps.F1, plasmid pYps.F1 complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
306. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to CP019195 (Salmonella enterica subsp. enterica serovar Senftenberg str. ATCC 43845 plasmid pATCC43845, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
307. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP045449 (Salmonella enterica subsp. enterica serovar Schwarzengrund strain 12888 plasmid p280_12888, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
308. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP015096 (Pelagibaca abyssi strain JLT2014 plasmid pPABY8, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------gaccgaggccgagaccgaggacgagaccgagg Protospacer
******.***********. *****
309. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to MN732922 (Escherichia coli strain 49K plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
310. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP020493 (Salmonella enterica subsp. enterica strain 08-00436 plasmid pSE08-00436-1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
311. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to CP031284 (Escherichia fergusonii strain 40A plasmid p280_40A, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
312. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to CP042895 (Escherichia coli strain CFSAN061772 plasmid pCFSAN061772_02, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
313. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP022735 (Escherichia coli strain SA186 plasmid pSA186_MCR1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
314. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to CP042898 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_02, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
315. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP022165 (Escherichia coli strain M160133 plasmid pM160133_p1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
316. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP012931 (Salmonella enterica subsp. enterica serovar Heidelberg strain N13-01290 plasmid pN13-01290_23, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
317. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP023143 (Escherichia coli strain CFSAN061770 plasmid pEGY1-MCR-1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
318. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP026936 (Escherichia coli strain CFS3292 plasmid pCFS3292-1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
319. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP025402 (Escherichia coli strain MS8345 plasmid pMS8345A, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
320. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP026933 (Escherichia coli strain CFS3273 plasmid pCFS3273-1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
321. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_MH924589 (Escherichia coli strain RDB9 plasmid pRDB9, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
322. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_MH208235 (Escherichia coli strain APECA2 plasmid pJMA2, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
323. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_MK169211 (Escherichia coli strain DUK14-2 plasmid pMOO-32, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
324. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP016838 (Salmonella enterica subsp. enterica serovar Senftenberg strain 775W (ATCC 43845) plasmid pSSE-ATCC-43845, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga------ CRISPR spacer
------atccgagaccgagaccgataccgataccgata Protospacer
**************** ***** *
325. spacer 5.41|925849|32|CP034721|CRISPRCasFinder matches to NZ_CP045074 (Paracoccus kondratievae strain BJQ0001 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
cgtcactaccgagaccgagaccgagaccgaga CRISPR spacer
cgccacaaccgagaccgagaccgggctgcgcg Protospacer
**.*** ****************.* . . .
326. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594187 (Siphovirus contig89 strain Day2AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
327. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594193 (Siphovirus contig89 strain Day30Noon, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
328. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594192 (Siphovirus contig89 strain Day30AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
329. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594185 (Siphovirus contig89 strain Day1Noon, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
330. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594191 (Siphovirus contig89 strain Day14AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
331. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594186 (Siphovirus contig89 strain Day1PM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
332. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594194 (Siphovirus contig89 strain Day60AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
333. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594184 (Siphovirus contig89 strain Day1AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
334. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594189 (Siphovirus contig89 strain Day7AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
335. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594188 (Siphovirus contig89 strain Day4AM, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
336. spacer 5.43|926088|32|CP034721|CRISPRCasFinder matches to KF594190 (Siphovirus contig89 strain Day7Noon, partial genome) position: , mismatch: 10, identity: 0.688
cgaaaatcatcgccgctaagacgctatttcgc CRISPR spacer
tcaaaatcagcaccgctaagacgctcagcgac Protospacer
. ******* *.************* . .*
337. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to NZ_CP022446 (Bacillus cereus C1L plasmid pC1L1, complete sequence) position: , mismatch: 10, identity: 0.688
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
ttttatctttttacaatgatgaatatgaaaaa Protospacer
. * *****************.* ***
338. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to NC_017318 (Edwardsiella tarda FL6-60 plasmid pFL6-60, complete sequence) position: , mismatch: 10, identity: 0.688
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
tttagccagcgcgatacgcgccagctctttgc Protospacer
. . *****.********.********* .
339. spacer 5.55|926817|31|CP034721|CRISPRCasFinder matches to MG945695 (UNVERIFIED: Microviridae sp. isolate 1600-1702, complete genome) position: , mismatch: 10, identity: 0.677
tcgtatgaaggcgatgcgtagaagctgaacc CRISPR spacer
tcgtatgaaagcgctgcgtagaaaggtcgtg Protospacer
*********.*** *********. ..
340. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP039920 (Agrobacterium tumefaciens strain CFBP6626 plasmid pAtCFBP6626c, complete sequence) position: , mismatch: 10, identity: 0.688
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
gatcgcctgccccgagccggcgctggccgccg Protospacer
. ****.*******.***********.. .
341. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP048637 (Rhizobium oryzihabitans strain M15 plasmid p5, complete sequence) position: , mismatch: 10, identity: 0.688
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
gatcgcctgccccgagccggcgctggccgccg Protospacer
. ****.*******.***********.. .
342. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NC_009670 (Ochrobactrum anthropi ATCC 49188 plasmid pOANT02, complete sequence) position: , mismatch: 10, identity: 0.688
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
gatcgcctgccccgagccggcgctggccgccg Protospacer
. ****.*******.***********.. .
343. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP025431 (Paracoccus zhejiangensis strain J6 plasmid pPZ01, complete sequence) position: , mismatch: 10, identity: 0.688
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
gcccgcccggcccgaacaggcgctggaaatcc Protospacer
****** ******* ******** *
344. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP031163 (Deinococcus wulumuqiensis strain NEB 479 plasmid pDrdI, complete sequence) position: , mismatch: 10, identity: 0.688
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
cctaccccgccccggaacggcgctggctgccg Protospacer
* *********.* ***********. .
345. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
acgcgcccgacgcgaaccggcgctgtggttca Protospacer
******* * ************* *
346. spacer 5.15|925847|38|CP034721|CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 11, identity: 0.711
cgcgtcactaccgagaccgagaccgagaccgagagtgt CRISPR spacer
acccagacaaccgagaccgagaccgagacccagaccca Protospacer
* ** ********************* *** .
347. spacer 5.22|926269|38|CP034721|CRT matches to KY709687 (Salmonella phage 29485, complete genome) position: , mismatch: 11, identity: 0.711
cgcgctgccagtgcgatacgtgccagctctaactgtgt CRISPR spacer
agcgctgccagcgctatacgtgccagctcctccgcctc Protospacer
**********.** **************. * . .
348. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to NZ_CP021670 (Bacillus licheniformis strain SRCM100141 plasmid pBL141-2 sequence) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
gttaaaagatttagaatgatgaatatgtttct Protospacer
. .*****.**** ************. .
349. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to NZ_CP035189 (Bacillus licheniformis strain SRCM103914 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
gttaaaagatttagaatgatgaatatgtttct Protospacer
. .*****.**** ************. .
350. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to NZ_CP014843 (Bacillus licheniformis strain SCDB 14 plasmid pSCDB14, complete sequence) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
gttaaaagatttagaatgatgaatatgtttct Protospacer
. .*****.**** ************. .
351. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to MG592473 (Vibrio phage 1.101.O._10N.261.45.C6, partial genome) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
cagaaaaggtttacactgaagaatattctggt Protospacer
. ************ *** ****** ...
352. spacer 5.45|926210|32|CP034721|CRISPRCasFinder matches to MG592459 (Vibrio phage 1.084.O._10N.261.49.F5, partial genome) position: , mismatch: 11, identity: 0.656
agcaaaaggtttacaatgatgaatataacaaa CRISPR spacer
cagaaaaggtttacactgaagaatattctggt Protospacer
. ************ *** ****** ...
353. spacer 5.46|926271|32|CP034721|CRISPRCasFinder matches to LR134122 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 2) position: , mismatch: 11, identity: 0.656
cgctgccagtgcgatacgtgccagctctaact CRISPR spacer
aatagccagtgcgatacgcgacagctcgccgc Protospacer
.. **************.* ****** .
354. spacer 5.59|927056|32|CP034721|CRISPRCasFinder matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
cggcgcccgccccgaaccggcgctggctagga CRISPR spacer
gcccgcccggcccgaacaggcgctggaagtcg Protospacer
****** ******* ******** . .
355. spacer 5.62|927239|32|CP034721|CRISPRCasFinder matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 11, identity: 0.656
aggggcgttccgcagtcggcaagggctgaaaa CRISPR spacer
tcgggcatcccgcagtcggcaagggtgcggcg Protospacer
****.*.****************. .. .
