Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034766 Rhodococcus sp. X156 chromosome, complete genome 5 crisprs NA 0 3 0 0

Results visualization

1. CP034766
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034766_1 82652-82812 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034766_2 2833758-2833820 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034766_3 2834082-2834158 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034766_4 3564050-3564217 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034766_5 3655995-3656179 Orphan NA
4 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034766_5 5.1|3656018|22|CP034766|CRISPRCasFinder 3656018-3656039 22 CP040467 Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence 186444-186465 1 0.955
CP034766_5 5.1|3656018|22|CP034766|CRISPRCasFinder 3656018-3656039 22 NC_010311 Streptomyces sp. HK1 plasmid pSHK1, complete sequence 34404-34425 2 0.909
CP034766_5 5.1|3656018|22|CP034766|CRISPRCasFinder 3656018-3656039 22 NZ_CP026489 Streptomyces sp. 604F plasmid unnamed, complete sequence 53406-53427 2 0.909
CP034766_5 5.1|3656018|22|CP034766|CRISPRCasFinder 3656018-3656039 22 NZ_CP030772 Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence 522564-522585 2 0.909
CP034766_5 5.1|3656018|22|CP034766|CRISPRCasFinder 3656018-3656039 22 NZ_CP029339 Streptomyces sp. SM17 plasmid pSM17A, complete sequence 135511-135532 2 0.909
CP034766_3 3.1|2834105|31|CP034766|CRISPRCasFinder 2834105-2834135 31 NZ_CP009155 Burkholderia pseudomallei strain TSV202 plasmid 1, complete sequence 110934-110964 6 0.806
CP034766_3 3.1|2834105|31|CP034766|CRISPRCasFinder 2834105-2834135 31 NZ_CP007795 Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence 113651-113681 7 0.774
CP034766_3 3.1|2834105|31|CP034766|CRISPRCasFinder 2834105-2834135 31 NZ_CP032323 Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence 50531-50561 7 0.774
CP034766_1 1.2|82750|33|CP034766|PILER-CR 82750-82782 33 NC_015169 Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence 215048-215080 8 0.758
CP034766_3 3.1|2834105|31|CP034766|CRISPRCasFinder 2834105-2834135 31 NZ_LR134459 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence 44899-44929 8 0.742
CP034766_3 3.1|2834105|31|CP034766|CRISPRCasFinder 2834105-2834135 31 NZ_CP021119 Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence 59564-59594 9 0.71
CP034766_3 3.1|2834105|31|CP034766|CRISPRCasFinder 2834105-2834135 31 MF477236 Nocardia phage NTR1, complete genome 12480-12510 9 0.71

1. spacer 5.1|3656018|22|CP034766|CRISPRCasFinder matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 1, identity: 0.955 

cggtcctggtcgtcgtccgcgg	CRISPR spacer
cggtcctggccgtcgtccgcgg	Protospacer
*********.************

2. spacer 5.1|3656018|22|CP034766|CRISPRCasFinder matches to NC_010311 (Streptomyces sp. HK1 plasmid pSHK1, complete sequence) position: , mismatch: 2, identity: 0.909 

cggtcctggtcgtcgtccgcgg	CRISPR spacer
tggtcctgctcgtcgtccgcgg	Protospacer
.******* *************

3. spacer 5.1|3656018|22|CP034766|CRISPRCasFinder matches to NZ_CP026489 (Streptomyces sp. 604F plasmid unnamed, complete sequence) position: , mismatch: 2, identity: 0.909 

cggtcctggtcgtcgtccgcgg	CRISPR spacer
tggtcctgctcgtcgtccgcgg	Protospacer
.******* *************

4. spacer 5.1|3656018|22|CP034766|CRISPRCasFinder matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 2, identity: 0.909 

cggtcctggtcgtcgtccgcgg	CRISPR spacer
gggtcctggccgtcgtccgcgg	Protospacer
 ********.************

5. spacer 5.1|3656018|22|CP034766|CRISPRCasFinder matches to NZ_CP029339 (Streptomyces sp. SM17 plasmid pSM17A, complete sequence) position: , mismatch: 2, identity: 0.909 

cggtcctggtcgtcgtccgcgg	CRISPR spacer
tggtcctgctcgtcgtccgcgg	Protospacer
.******* *************

6. spacer 3.1|2834105|31|CP034766|CRISPRCasFinder matches to NZ_CP009155 (Burkholderia pseudomallei strain TSV202 plasmid 1, complete sequence) position: , mismatch: 6, identity: 0.806 

tagagcggctcccactccgccaccagctcgt	CRISPR spacer
ccgtccggcacccactccgtcaccagctcgt	Protospacer
. *  **** *********.***********

7. spacer 3.1|2834105|31|CP034766|CRISPRCasFinder matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.774 

tagagcgg-----ctcccactccgccaccagctcgt	CRISPR spacer
-----cggctgtccttccactccgccaccagatcgt	Protospacer
     ***     **.*************** ****

8. spacer 3.1|2834105|31|CP034766|CRISPRCasFinder matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.774 

tagagcgg-----ctcccactccgccaccagctcgt	CRISPR spacer
-----cggctgtccttccactccgccaccagatcgt	Protospacer
     ***     **.*************** ****

9. spacer 1.2|82750|33|CP034766|PILER-CR matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 8, identity: 0.758 

gctggtgtccgtctcggcgggggtgctcgcggc	CRISPR spacer
gcgggtgtccgcctcggcgggggtgtcggcctg	Protospacer
** ********.*************.. **

10. spacer 3.1|2834105|31|CP034766|CRISPRCasFinder matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 8, identity: 0.742 

tagagcggctcccactccgccaccagctcgt	CRISPR spacer
gcgccgggctccgactcctccaccagctcgg	Protospacer
  *   ****** ***** ***********

11. spacer 3.1|2834105|31|CP034766|CRISPRCasFinder matches to NZ_CP021119 (Streptomyces sp. CLI2509 strain CLI2905 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

tagagcggctcccactccgccaccagctcgt	CRISPR spacer
ctcggcgtctcccactcggccaccagccggg	Protospacer
.  .*** ********* *********. *

12. spacer 3.1|2834105|31|CP034766|CRISPRCasFinder matches to MF477236 (Nocardia phage NTR1, complete genome) position: , mismatch: 9, identity: 0.71 

tagagcggctcccactccgccaccagctcgt	CRISPR spacer
gccatgcgctcgaactccgccaccagctcgg	Protospacer
   *   ****  *****************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage