Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP032666 Streptococcus pyogenes strain MGAS28085 chromosome, complete genome 3 crisprs DEDDh,cas3,cas5,cas8c,cas7,cas4,cas1,cas2,csn2,cas9,csm6,DinG,csa3 0 6 6 0

Results visualization

1. CP032666
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032666_1 603906-604068 TypeI I-C
2 spacers
cas2,cas1,cas4,cas7,cas8c,cas5,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032666_2 1056080-1056313 TypeII II-A
3 spacers
csn2,cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP032666_3 1809454-1809550 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448871 Streptococcus phage Javan196, complete genome 33084-33113 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448697 Streptococcus phage Javan185, complete genome 33084-33113 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448693 Streptococcus phage Javan177, complete genome 33084-33113 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448772 Streptococcus phage Javan483, complete genome 32792-32821 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448696 Streptococcus phage Javan183, complete genome 33084-33113 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 NC_009819 Streptococcus phage P9, complete genome 32033-32062 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448793 Streptococcus phage Javan523, complete genome 33428-33457 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448868 Streptococcus phage Javan188, complete genome 33085-33114 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448866 Streptococcus phage Javan184, complete genome 33084-33113 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448954 Streptococcus phage Javan476, complete genome 31815-31844 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448699 Streptococcus phage Javan189, complete genome 33084-33113 0 1.0
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448867 Streptococcus phage Javan186, complete genome 33084-33113 0 1.0
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448775 Streptococcus phage Javan489, complete genome 25298-25327 0 1.0
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448794 Streptococcus phage Javan525, complete genome 22421-22450 0 1.0
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448953 Streptococcus phage Javan474, complete genome 27019-27048 0 1.0
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448765 Streptococcus phage Javan459, complete genome 22420-22449 0 1.0
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448957 Streptococcus phage Javan484, complete genome 27899-27928 0 1.0
CP032666_2 2.3|1056248|30|CP032666|CRT,PILER-CR 1056248-1056277 30 MK448662 Streptococcus satellite phage Javan97, complete genome 6081-6110 0 1.0
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448522 Streptococcus satellite phage Javan519, complete genome 1870-1914 0 1.0
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448330 Streptococcus satellite phage Javan136, complete genome 2770-2814 0 1.0
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448328 Streptococcus satellite phage Javan130, complete genome 2770-2814 0 1.0
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448513 Streptococcus satellite phage Javan479, complete genome 1870-1914 0 1.0
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448332 Streptococcus satellite phage Javan142, complete genome 2777-2821 0 1.0
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448331 Streptococcus satellite phage Javan138, complete genome 2777-2821 0 1.0
CP032666_1 1.1|603939|33|CP032666|PILER-CR 603939-603971 33 MK448762 Streptococcus phage Javan447, complete genome 57-89 1 0.97
CP032666_1 1.1|603939|33|CP032666|PILER-CR 603939-603971 33 MK448798 Streptococcus phage Javan533, complete genome 57-89 1 0.97
CP032666_1 1.1|603939|33|CP032666|PILER-CR 603939-603971 33 MK448793 Streptococcus phage Javan523, complete genome 57-89 1 0.97
CP032666_1 1.1|603939|33|CP032666|PILER-CR 603939-603971 33 MK448967 Streptococcus phage Javan510, complete genome 57-89 1 0.97
CP032666_1 1.1|603939|33|CP032666|PILER-CR 603939-603971 33 MK448954 Streptococcus phage Javan476, complete genome 57-89 1 0.97
CP032666_1 1.1|603939|33|CP032666|PILER-CR 603939-603971 33 NC_004588 Streptococcus prophage 315.5, complete genome 206-238 1 0.97
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448771 Streptococcus phage Javan481, complete genome 6936-6967 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448681 Streptococcus phage Javan141, complete genome 6534-6565 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448944 Streptococcus phage Javan452, complete genome 11200-11231 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448672 Streptococcus phage Javan117, complete genome 6782-6813 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448849 Streptococcus phage Javan128, complete genome 6685-6716 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448774 Streptococcus phage Javan487, complete genome 6921-6952 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448958 Streptococcus phage Javan486, complete genome 9165-9196 1 0.969
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448742 Streptococcus phage Javan37, complete genome 9157-9188 1 0.969
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448946 Streptococcus phage Javan456, complete genome 36512-36541 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448779 Streptococcus phage Javan497, complete genome 31741-31770 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448795 Streptococcus phage Javan527, complete genome 38519-38548 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448944 Streptococcus phage Javan452, complete genome 35553-35582 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448968 Streptococcus phage Javan512, complete genome 31741-31770 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 NC_004584 Streptococcus prophage 315.1, complete genome 31585-31614 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448797 Streptococcus phage Javan531, complete genome 31741-31770 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448978 Streptococcus phage Javan532, complete genome 31479-31508 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448785 Streptococcus phage Javan507, complete genome 31480-31509 1 0.967
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 NC_004589 Streptococcus prophage 315.6, complete genome 31838-31867 1 0.967
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448946 Streptococcus phage Javan456, complete genome 26948-26977 1 0.967
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448333 Streptococcus satellite phage Javan145, complete genome 2769-2813 1 0.978
CP032666_3 3.1|1809480|45|CP032666|CRISPRCasFinder 1809480-1809524 45 MK448340 Streptococcus satellite phage Javan156, complete genome 2769-2813 1 0.978
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448767 Streptococcus phage Javan467, complete genome 6874-6905 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448973 Streptococcus phage Javan522, complete genome 8841-8872 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448862 Streptococcus phage Javan178, complete genome 6910-6941 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448942 Streptococcus phage Javan448, complete genome 6873-6904 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK449010 Streptococcus phage Javan90, complete genome 9369-9400 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK449012 Streptococcus phage Javan94, complete genome 8203-8234 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 NC_004586 Streptococcus pyogenes phage 315.3, complete genome 6979-7010 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448969 Streptococcus phage Javan514, complete genome 9629-9660 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448943 Streptococcus phage Javan450, complete genome 6874-6905 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448972 Streptococcus phage Javan520, complete genome 6683-6714 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448786 Streptococcus phage Javan509, complete genome 6874-6905 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448778 Streptococcus phage Javan493, complete genome 8856-8887 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448963 Streptococcus phage Javan498, complete genome 3463-3494 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448773 Streptococcus phage Javan485, complete genome 9629-9660 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448851 Streptococcus phage Javan14, complete genome 12142-12173 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448833 Streptococcus phage Javan87, complete genome 9369-9400 2 0.938
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448673 Streptococcus phage Javan119, complete genome 9948-9979 2 0.938
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448771 Streptococcus phage Javan481, complete genome 26991-27020 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448942 Streptococcus phage Javan448, complete genome 18422-18451 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448794 Streptococcus phage Javan525, complete genome 32018-32047 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448964 Streptococcus phage Javan502, complete genome 27279-27308 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 M19348 Streptococcus pyogenes phage H4489A hyaluronidase (hylP) and hypothetical protein genes, complete cds 511-540 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448951 Streptococcus phage Javan470, complete genome 32170-32199 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448765 Streptococcus phage Javan459, complete genome 32016-32045 2 0.933
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448764 Streptococcus phage Javan457, complete genome 25122-25151 2 0.933
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MK448933 Streptococcus phage Javan420, complete genome 26823-26852 2 0.933
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448964 Streptococcus phage Javan502, complete genome 6853-6884 3 0.906
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 NZ_CP020429 Streptococcus sp. FDAARGOS_192 plasmid unnamed1, complete sequence 100887-100918 4 0.875
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 NZ_CP020439 Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence 133702-133733 4 0.875
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 NZ_CP018188 Streptococcus salivarius strain ICDC2 plasmid, complete sequence 108973-109004 4 0.875
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MN480762 Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence 18924-18955 4 0.875
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MN480763 Streptococcus salivarius strain YU10 plasmid pSsal-YU10, complete sequence 119912-119943 4 0.875
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448698 Streptococcus phage Javan187, complete genome 27333-27362 4 0.867
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448845 Streptococcus phage Javan118, complete genome 8663-8694 5 0.844
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448767 Streptococcus phage Javan467, complete genome 27472-27501 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 NC_004586 Streptococcus pyogenes phage 315.3, complete genome 27577-27606 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448976 Streptococcus phage Javan528, complete genome 32036-32065 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448943 Streptococcus phage Javan450, complete genome 27472-27501 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448972 Streptococcus phage Javan520, complete genome 27647-27676 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448786 Streptococcus phage Javan509, complete genome 27472-27501 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448963 Streptococcus phage Javan498, complete genome 23094-23123 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448773 Streptococcus phage Javan485, complete genome 28601-28630 5 0.833
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MK448950 Streptococcus phage Javan464, complete genome 32684-32713 6 0.8
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 MN693570 Marine virus AFVG_25M8, complete genome 48011-48040 6 0.8
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 NZ_CP014852 Bacillus thuringiensis strain HD12 plasmid pHD120161, complete sequence 135700-135729 7 0.767
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 NC_010895 Bacillus thuringiensis serovar tenebrionis plasmid pBMB175, complete sequence 869-898 7 0.767
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 CP020760 Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-21, complete sequence 3892-3921 7 0.767
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 NC_005567 Bacillus thuringiensis H1.1 plasmid pGI3, complete sequence 1823-1852 7 0.767
CP032666_1 1.2|604005|32|CP032666|PILER-CR 604005-604036 32 MK448704 Streptococcus phage Javan213, complete genome 8201-8232 8 0.75
CP032666_2 2.1|1056116|30|CP032666|CRT 1056116-1056145 30 NC_013792 Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence 63431-63460 8 0.733
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 NZ_CP031836 Lactobacillus amylolyticus strain L5 plasmid p1, complete sequence 84673-84702 8 0.733
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 NZ_CP020458 Lactobacillus amylolyticus strain L6 plasmid pL6-1, complete sequence 86560-86589 8 0.733
CP032666_2 2.3|1056248|30|CP032666|CRT,PILER-CR 1056248-1056277 30 NC_021559 Prochlorococcus phage P-SSM3 genomic sequence 77011-77040 8 0.733
CP032666_2 2.2|1056182|30|CP032666|CRT,PILER-CR 1056182-1056211 30 MN694808 Marine virus AFVG_250M14, complete genome 476-505 9 0.7

1. spacer 2.1|1056116|30|CP032666|CRT matches to MK448871 (Streptococcus phage Javan196, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

2. spacer 2.1|1056116|30|CP032666|CRT matches to MK448697 (Streptococcus phage Javan185, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

3. spacer 2.1|1056116|30|CP032666|CRT matches to MK448693 (Streptococcus phage Javan177, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

4. spacer 2.1|1056116|30|CP032666|CRT matches to MK448772 (Streptococcus phage Javan483, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

5. spacer 2.1|1056116|30|CP032666|CRT matches to MK448696 (Streptococcus phage Javan183, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

6. spacer 2.1|1056116|30|CP032666|CRT matches to NC_009819 (Streptococcus phage P9, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

7. spacer 2.1|1056116|30|CP032666|CRT matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

8. spacer 2.1|1056116|30|CP032666|CRT matches to MK448868 (Streptococcus phage Javan188, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

9. spacer 2.1|1056116|30|CP032666|CRT matches to MK448866 (Streptococcus phage Javan184, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

10. spacer 2.1|1056116|30|CP032666|CRT matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

11. spacer 2.1|1056116|30|CP032666|CRT matches to MK448699 (Streptococcus phage Javan189, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

12. spacer 2.1|1056116|30|CP032666|CRT matches to MK448867 (Streptococcus phage Javan186, complete genome) position: , mismatch: 0, identity: 1.0

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctctatt	Protospacer
******************************

13. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448775 (Streptococcus phage Javan489, complete genome) position: , mismatch: 0, identity: 1.0

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatttcta	Protospacer
******************************

14. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448794 (Streptococcus phage Javan525, complete genome) position: , mismatch: 0, identity: 1.0

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatttcta	Protospacer
******************************

15. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448953 (Streptococcus phage Javan474, complete genome) position: , mismatch: 0, identity: 1.0

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatttcta	Protospacer
******************************

16. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448765 (Streptococcus phage Javan459, complete genome) position: , mismatch: 0, identity: 1.0

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatttcta	Protospacer
******************************

17. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448957 (Streptococcus phage Javan484, complete genome) position: , mismatch: 0, identity: 1.0

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatttcta	Protospacer
******************************

18. spacer 2.3|1056248|30|CP032666|CRT,PILER-CR matches to MK448662 (Streptococcus satellite phage Javan97, complete genome) position: , mismatch: 0, identity: 1.0

aataatcagtttaaaaatccatctggagca	CRISPR spacer
aataatcagtttaaaaatccatctggagca	Protospacer
******************************

19. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448522 (Streptococcus satellite phage Javan519, complete genome) position: , mismatch: 0, identity: 1.0

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	Protospacer
*********************************************

20. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448330 (Streptococcus satellite phage Javan136, complete genome) position: , mismatch: 0, identity: 1.0

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	Protospacer
*********************************************

21. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448328 (Streptococcus satellite phage Javan130, complete genome) position: , mismatch: 0, identity: 1.0

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	Protospacer
*********************************************

22. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448513 (Streptococcus satellite phage Javan479, complete genome) position: , mismatch: 0, identity: 1.0

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	Protospacer
*********************************************

23. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448332 (Streptococcus satellite phage Javan142, complete genome) position: , mismatch: 0, identity: 1.0

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	Protospacer
*********************************************

24. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448331 (Streptococcus satellite phage Javan138, complete genome) position: , mismatch: 0, identity: 1.0

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	Protospacer
*********************************************

25. spacer 1.1|603939|33|CP032666|PILER-CR matches to MK448762 (Streptococcus phage Javan447, complete genome) position: , mismatch: 1, identity: 0.97

taaataattacatgactagccaatacacccaca	CRISPR spacer
caaataattacatgactagccaatacacccaca	Protospacer
.********************************

26. spacer 1.1|603939|33|CP032666|PILER-CR matches to MK448798 (Streptococcus phage Javan533, complete genome) position: , mismatch: 1, identity: 0.97

taaataattacatgactagccaatacacccaca	CRISPR spacer
caaataattacatgactagccaatacacccaca	Protospacer
.********************************

27. spacer 1.1|603939|33|CP032666|PILER-CR matches to MK448793 (Streptococcus phage Javan523, complete genome) position: , mismatch: 1, identity: 0.97

taaataattacatgactagccaatacacccaca	CRISPR spacer
caaataattacatgactagccaatacacccaca	Protospacer
.********************************

28. spacer 1.1|603939|33|CP032666|PILER-CR matches to MK448967 (Streptococcus phage Javan510, complete genome) position: , mismatch: 1, identity: 0.97

taaataattacatgactagccaatacacccaca	CRISPR spacer
caaataattacatgactagccaatacacccaca	Protospacer
.********************************

29. spacer 1.1|603939|33|CP032666|PILER-CR matches to MK448954 (Streptococcus phage Javan476, complete genome) position: , mismatch: 1, identity: 0.97

taaataattacatgactagccaatacacccaca	CRISPR spacer
caaataattacatgactagccaatacacccaca	Protospacer
.********************************

30. spacer 1.1|603939|33|CP032666|PILER-CR matches to NC_004588 (Streptococcus prophage 315.5, complete genome) position: , mismatch: 1, identity: 0.97

taaataattacatgactagccaatacacccaca	CRISPR spacer
caaataattacatgactagccaatacacccaca	Protospacer
.********************************

31. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

32. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448681 (Streptococcus phage Javan141, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

33. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

34. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448672 (Streptococcus phage Javan117, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

35. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448849 (Streptococcus phage Javan128, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

36. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448774 (Streptococcus phage Javan487, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

37. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448958 (Streptococcus phage Javan486, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

38. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448742 (Streptococcus phage Javan37, complete genome) position: , mismatch: 1, identity: 0.969

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttactctcaaagtaagag	Protospacer
.*******************************

39. spacer 2.1|1056116|30|CP032666|CRT matches to MK448946 (Streptococcus phage Javan456, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtttagctctatt	Protospacer
*******************.**********

40. spacer 2.1|1056116|30|CP032666|CRT matches to MK448779 (Streptococcus phage Javan497, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

41. spacer 2.1|1056116|30|CP032666|CRT matches to MK448795 (Streptococcus phage Javan527, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

42. spacer 2.1|1056116|30|CP032666|CRT matches to MK448944 (Streptococcus phage Javan452, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

43. spacer 2.1|1056116|30|CP032666|CRT matches to MK448968 (Streptococcus phage Javan512, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

44. spacer 2.1|1056116|30|CP032666|CRT matches to NC_004584 (Streptococcus prophage 315.1, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

45. spacer 2.1|1056116|30|CP032666|CRT matches to MK448797 (Streptococcus phage Javan531, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

46. spacer 2.1|1056116|30|CP032666|CRT matches to MK448978 (Streptococcus phage Javan532, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

47. spacer 2.1|1056116|30|CP032666|CRT matches to MK448785 (Streptococcus phage Javan507, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

48. spacer 2.1|1056116|30|CP032666|CRT matches to NC_004589 (Streptococcus prophage 315.6, complete genome) position: , mismatch: 1, identity: 0.967

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gccaaactcaattttttgtctagctctatt	Protospacer
*.****************************

49. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448946 (Streptococcus phage Javan456, complete genome) position: , mismatch: 1, identity: 0.967

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatttctg	Protospacer
*****************************.

50. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448333 (Streptococcus satellite phage Javan145, complete genome) position: , mismatch: 1, identity: 0.978

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgccaagat	Protospacer
**************************************.******

51. spacer 3.1|1809480|45|CP032666|CRISPRCasFinder matches to MK448340 (Streptococcus satellite phage Javan156, complete genome) position: , mismatch: 1, identity: 0.978

ttttgcaaaatctatattaacgcaaataaatttggttgtcaagat	CRISPR spacer
ttttgcaaaatctatattaacgcaaataaatttggttgccaagat	Protospacer
**************************************.******

52. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448767 (Streptococcus phage Javan467, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

53. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448973 (Streptococcus phage Javan522, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

54. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448862 (Streptococcus phage Javan178, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagctgctttactctcaaagtaagag	Protospacer
.********** ********************

55. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448942 (Streptococcus phage Javan448, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

56. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK449010 (Streptococcus phage Javan90, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

57. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK449012 (Streptococcus phage Javan94, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

58. spacer 1.2|604005|32|CP032666|PILER-CR matches to NC_004586 (Streptococcus pyogenes phage 315.3, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

59. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448969 (Streptococcus phage Javan514, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagctgctttactctcaaagtaagag	Protospacer
.********** ********************

60. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448943 (Streptococcus phage Javan450, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

61. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagctgctttactctcaaagtaagag	Protospacer
.********** ********************

62. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448786 (Streptococcus phage Javan509, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

63. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448778 (Streptococcus phage Javan493, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

64. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448963 (Streptococcus phage Javan498, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

65. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagctgctttactctcaaagtaagag	Protospacer
.********** ********************

66. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448851 (Streptococcus phage Javan14, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagctgctttactctcaaagtaagag	Protospacer
.********** ********************

67. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448833 (Streptococcus phage Javan87, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttactctcaaagtaagag	Protospacer
.***********.*******************

68. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448673 (Streptococcus phage Javan119, complete genome) position: , mismatch: 2, identity: 0.938

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagctgctttactctcaaagtaagag	Protospacer
.********** ********************

69. spacer 2.1|1056116|30|CP032666|CRT matches to MK448771 (Streptococcus phage Javan481, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

70. spacer 2.1|1056116|30|CP032666|CRT matches to MK448942 (Streptococcus phage Javan448, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

71. spacer 2.1|1056116|30|CP032666|CRT matches to MK448794 (Streptococcus phage Javan525, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

72. spacer 2.1|1056116|30|CP032666|CRT matches to MK448964 (Streptococcus phage Javan502, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

73. spacer 2.1|1056116|30|CP032666|CRT matches to M19348 (Streptococcus pyogenes phage H4489A hyaluronidase (hylP) and hypothetical protein genes, complete cds) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

74. spacer 2.1|1056116|30|CP032666|CRT matches to MK448951 (Streptococcus phage Javan470, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaattcaattttttgtttagctctatt	Protospacer
******.************.**********

75. spacer 2.1|1056116|30|CP032666|CRT matches to MK448765 (Streptococcus phage Javan459, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

76. spacer 2.1|1056116|30|CP032666|CRT matches to MK448764 (Streptococcus phage Javan457, complete genome) position: , mismatch: 2, identity: 0.933

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gttaagctcaattttttgtctagctctatt	Protospacer
**.**.************************

77. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MK448933 (Streptococcus phage Javan420, complete genome) position: , mismatch: 2, identity: 0.933

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
agacaaaagaaaaagcattgtcaatctctg	Protospacer
*************************.***.

78. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448964 (Streptococcus phage Javan502, complete genome) position: , mismatch: 3, identity: 0.906

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttttttaccctcaaagtaagag	Protospacer
.***********.*****.*************

79. spacer 1.2|604005|32|CP032666|PILER-CR matches to NZ_CP020429 (Streptococcus sp. FDAARGOS_192 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttagtctcaaaataagaa	Protospacer
.**************** *******.*****.

80. spacer 1.2|604005|32|CP032666|PILER-CR matches to NZ_CP020439 (Streptococcus equinus strain FDAARGOS_251 plasmid unamed1 sequence) position: , mismatch: 4, identity: 0.875

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttagtctcaaaataagaa	Protospacer
.**************** *******.*****.

81. spacer 1.2|604005|32|CP032666|PILER-CR matches to NZ_CP018188 (Streptococcus salivarius strain ICDC2 plasmid, complete sequence) position: , mismatch: 4, identity: 0.875

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttattctcaaaataagaa	Protospacer
.****************.*******.*****.

82. spacer 1.2|604005|32|CP032666|PILER-CR matches to MN480762 (Streptococcus salivarius strain NU10 plasmid pSsal-NU10, complete sequence) position: , mismatch: 4, identity: 0.875

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttattctcaaaataagaa	Protospacer
.****************.*******.*****.

83. spacer 1.2|604005|32|CP032666|PILER-CR matches to MN480763 (Streptococcus salivarius strain YU10 plasmid pSsal-YU10, complete sequence) position: , mismatch: 4, identity: 0.875

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
cttcatgagcttctttagtctcaaaataagaa	Protospacer
.**************** *******.*****.

84. spacer 2.1|1056116|30|CP032666|CRT matches to MK448698 (Streptococcus phage Javan187, complete genome) position: , mismatch: 4, identity: 0.867

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttttgtctagctttgca	Protospacer
*************************.*.. 

85. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448845 (Streptococcus phage Javan118, complete genome) position: , mismatch: 5, identity: 0.844

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
tggaataagctgctttactctcaaagtaagag	Protospacer
*   **.**** ********************

86. spacer 2.1|1056116|30|CP032666|CRT matches to MK448767 (Streptococcus phage Javan467, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

87. spacer 2.1|1056116|30|CP032666|CRT matches to NC_004586 (Streptococcus pyogenes phage 315.3, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

88. spacer 2.1|1056116|30|CP032666|CRT matches to MK448976 (Streptococcus phage Javan528, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

89. spacer 2.1|1056116|30|CP032666|CRT matches to MK448943 (Streptococcus phage Javan450, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

90. spacer 2.1|1056116|30|CP032666|CRT matches to MK448972 (Streptococcus phage Javan520, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

91. spacer 2.1|1056116|30|CP032666|CRT matches to MK448786 (Streptococcus phage Javan509, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

92. spacer 2.1|1056116|30|CP032666|CRT matches to MK448963 (Streptococcus phage Javan498, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

93. spacer 2.1|1056116|30|CP032666|CRT matches to MK448773 (Streptococcus phage Javan485, complete genome) position: , mismatch: 5, identity: 0.833

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaatttttcgtctagctttgca	Protospacer
****************.********.*.. 

94. spacer 2.1|1056116|30|CP032666|CRT matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 6, identity: 0.8

gtcaaactcaattttttgtctagctctatt	CRISPR spacer
gtcaaactcaattttccgtctagctttgca	Protospacer
***************..********.*.. 

95. spacer 2.1|1056116|30|CP032666|CRT matches to MN693570 (Marine virus AFVG_25M8, complete genome) position: , mismatch: 6, identity: 0.8

gtcaaactcaattttttgtctagc-tctatt	CRISPR spacer
attaaactcaattttttgactagcatgtaa-	Protospacer
.*.*************** ***** * **  

96. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to NZ_CP014852 (Bacillus thuringiensis strain HD12 plasmid pHD120161, complete sequence) position: , mismatch: 7, identity: 0.767

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
caccagaagcaaaagcattgtcaatttccg	Protospacer
 . **.*** ******************..

97. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to NC_010895 (Bacillus thuringiensis serovar tenebrionis plasmid pBMB175, complete sequence) position: , mismatch: 7, identity: 0.767

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
aaagaaaagaaaaagaattatcaatttact	Protospacer
*.* *********** ***.******* . 

98. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to CP020760 (Bacillus thuringiensis strain ATCC 10792 plasmid pLDW-21, complete sequence) position: , mismatch: 7, identity: 0.767

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
aaagaaaagaaaaagaattatcaatttacc	Protospacer
*.* *********** ***.******* . 

99. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to NC_005567 (Bacillus thuringiensis H1.1 plasmid pGI3, complete sequence) position: , mismatch: 7, identity: 0.767

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
aaagaaaagaaaaagaattatcaatttacc	Protospacer
*.* *********** ***.******* . 

100. spacer 1.2|604005|32|CP032666|PILER-CR matches to MK448704 (Streptococcus phage Javan213, complete genome) position: , mismatch: 8, identity: 0.75

tttcatgagcttctttactctcaaagtaagag	CRISPR spacer
ttgcatgagcttctttgctctcaaatgcgctg	Protospacer
** *************.********   .  *

101. spacer 2.1|1056116|30|CP032666|CRT matches to NC_013792 (Bacillus pseudofirmus OF4 plasmid pBpOF4-01, complete sequence) position: , mismatch: 8, identity: 0.733

---gtcaaactcaattttttgtctagctctatt	CRISPR spacer
ccttttga---taatttcttgtctagctctatt	Protospacer
    *..*   .*****.***************

102. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to NZ_CP031836 (Lactobacillus amylolyticus strain L5 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.733

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
taaaaaaagaaaaagcatcgtcaattagac	Protospacer
 .* **************.*******    

103. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to NZ_CP020458 (Lactobacillus amylolyticus strain L6 plasmid pL6-1, complete sequence) position: , mismatch: 8, identity: 0.733

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
taaaaaaagaaaaagcatcgtcaattagac	Protospacer
 .* **************.*******    

104. spacer 2.3|1056248|30|CP032666|CRT,PILER-CR matches to NC_021559 (Prochlorococcus phage P-SSM3 genomic sequence) position: , mismatch: 8, identity: 0.733

aataatcagtttaaaaatccatctggagca	CRISPR spacer
tataagaagtttaaaaatccatctcaaatg	Protospacer
 ****  ***************** .*...

105. spacer 2.2|1056182|30|CP032666|CRT,PILER-CR matches to MN694808 (Marine virus AFVG_250M14, complete genome) position: , mismatch: 9, identity: 0.7

agacaaaagaaaaagcattgtcaatttcta	CRISPR spacer
caggaaaagaaaaaggattgtcaataccct	Protospacer
 .. *********** ********* .*. 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36552 : 48865 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 781219 : 880807 113 Streptococcus_phage(40.91%) capsid,head,portal,terminase,transposase,tRNA,integrase,tail attL 801190:801249|attR 847360:847455
DBSCAN-SWA_3 1200807 : 1211411 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_4 1489344 : 1495218 8 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_5 1757924 : 1778149 27 Streptococcus_phage(56.25%) integrase,holin attL 1761123:1761143|attR 1775450:1775470
DBSCAN-SWA_6 1804559 : 1814547 15 Streptococcus_phage(75.0%) integrase attL 1804133:1804147|attR 1811695:1811709
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage