Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034908 len=6284063 3 crisprs WYL,DEDDh,csa3 0 2 1 0

Results visualization

1. CP034908
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034908_1 342230-342343 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034908_2 3652840-3652939 Orphan NA
1 spacers
DEDDh

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034908_3 5935610-5935810 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034908_2 2.1|3652865|50|CP034908|CRISPRCasFinder 3652865-3652914 50 NZ_CP042268 Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence 63791-63840 2 0.96
CP034908_3 3.2|5935766|23|CP034908|PILER-CR 5935766-5935788 23 AP014204 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S42-C31, *** SEQUENCING IN PROGRESS *** 32703-32725 2 0.913
CP034908_3 3.2|5935766|23|CP034908|PILER-CR 5935766-5935788 23 AP014203 Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS *** 10290-10312 2 0.913

1. spacer 2.1|3652865|50|CP034908|CRISPRCasFinder matches to NZ_CP042268 (Pseudomonas aeruginosa strain HOU1 plasmid pHOU1-1, complete sequence) position: , mismatch: 2, identity: 0.96

aacggcgg-gcgaaagctgggaaccctccgcgtagggcgcataacgccgga	CRISPR spacer
-acggcggagcgaaagctgggaaccctccgcgtagggcgaataacgccgga	Protospacer
 ******* ****************************** ***********

2. spacer 3.2|5935766|23|CP034908|PILER-CR matches to AP014204 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S42-C31, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.913

tcgcggccgcggatttcgccaca	CRISPR spacer
tcgcggccgatgatttcgccaca	Protospacer
*********  ************

3. spacer 3.2|5935766|23|CP034908|PILER-CR matches to AP014203 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-C76-MedDCM-OCT-S35-C25, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 2, identity: 0.913

tcgcggccgcggatttcgccaca	CRISPR spacer
tcgcggccgatgatttcgccaca	Protospacer
*********  ************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 632523 : 687433 20 Pseudomonas_phage(50.0%) tRNA,tail NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage