Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034930 Apibacter sp. HY041 chromosome, complete genome 3 crisprs NA 0 2 0 0

Results visualization

1. CP034930
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034930_1 712303-712375 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034930_2 1634025-1634335 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034930_3 2029219-2029452 Orphan NA
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034930_3 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT 2029255-2029284 30 NZ_CP014149 Paeniclostridium sordellii strain AM370 plasmid pRSJ16_1, complete sequence 32064-32093 6 0.8
CP034930_3 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT 2029255-2029284 30 NC_017472 Lactobacillus amylovorus GRL1118 plasmid p2, complete sequence 42923-42952 7 0.767
CP034930_3 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT 2029255-2029284 30 NZ_CP013691 Myroides odoratimimus strain PR63039 plasmid p63039, complete sequence 32909-32938 7 0.767
CP034930_3 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT 2029255-2029284 30 MN694000 Marine virus AFVG_250M989, complete genome 15245-15274 7 0.767
CP034930_3 3.3|2029387|30|CP034930|PILER-CR,CRISPRCasFinder,CRT 2029387-2029416 30 NZ_MG205641 Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence 16956-16985 9 0.7
CP034930_3 3.3|2029387|30|CP034930|PILER-CR,CRISPRCasFinder,CRT 2029387-2029416 30 NZ_MG205642 Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence 16956-16985 9 0.7

1. spacer 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014149 (Paeniclostridium sordellii strain AM370 plasmid pRSJ16_1, complete sequence) position: , mismatch: 6, identity: 0.8 

agaaaaaccttgaatttgttttaattcaga	CRISPR spacer
aaaaaaaccttgtatttgttctaatgtagg	Protospacer
*.********** *******.**** .**.

2. spacer 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT matches to NC_017472 (Lactobacillus amylovorus GRL1118 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.767 

agaaaaaccttgaatttgttttaattcaga	CRISPR spacer
aagcttatcttcaatttgttttaattcaga	Protospacer
*..   *.*** ******************

3. spacer 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013691 (Myroides odoratimimus strain PR63039 plasmid p63039, complete sequence) position: , mismatch: 7, identity: 0.767 

agaaaaaccttgaatttgttttaattcaga	CRISPR spacer
gggaaatccttgtatttgttttaattcgtc	Protospacer
.*.*** ***** **************.

4. spacer 3.1|2029255|30|CP034930|PILER-CR,CRISPRCasFinder,CRT matches to MN694000 (Marine virus AFVG_250M989, complete genome) position: , mismatch: 7, identity: 0.767 

agaaaaaccttgaatttgttttaattcaga	CRISPR spacer
aatcaaatcttgaatttgttgtaattctta	Protospacer
*.  ***.************ ******  *

5. spacer 3.3|2029387|30|CP034930|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG205641 (Paeniclostridium sordellii strain 7508-A plasmid pCS1-7, complete sequence) position: , mismatch: 9, identity: 0.7 

caaaactagaaactccataatgccttagtc	CRISPR spacer
aaatactagaaacttcataatgccaactat	Protospacer
 ** **********.*********     .

6. spacer 3.3|2029387|30|CP034930|PILER-CR,CRISPRCasFinder,CRT matches to NZ_MG205642 (Paeniclostridium sordellii strain 7543-A plasmid pCS1-6, complete sequence) position: , mismatch: 9, identity: 0.7 

caaaactagaaactccataatgccttagtc	CRISPR spacer
aaatactagaaacttcataatgccaactat	Protospacer
 ** **********.*********     .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage