1. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP027239 (Dietzia sp. oral taxon 368 strain W5195 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.875
agttc--gacgcgctggccgggccagttgtcgga CRISPR spacer
--ttcgagacgcgcgggccgggcgagttgtcgga Protospacer
*** ******* ******** **********
2. spacer 1.78|68427|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to LN610574 (Pseudomonas phage vB_PaeP_PAO1_Ab05, complete genome) position: , mismatch: 4, identity: 0.875
gcaccgggccatgcgacggctgcatcgaccat- CRISPR spacer
gcaccgggtcatgcgacggctgcgtcg-caatc Protospacer
********.**************.*** * **
3. spacer 1.78|68427|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MN871483 (UNVERIFIED: Pseudomonas phage PaSz-8_45_42k, complete genome) position: , mismatch: 4, identity: 0.875
gcaccgggccatgcgacggctgcatcgaccat- CRISPR spacer
gcaccgggtcatgcgacggctgcgtcg-caatc Protospacer
********.**************.*** * **
4. spacer 1.78|68427|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to FN263372 (Pseudomonas phage phikF77, complete genome) position: , mismatch: 4, identity: 0.875
gcaccgggccatgcgacggctgcatcgaccat- CRISPR spacer
gcaccgggtcatgcgacggctgcgtcg-caatc Protospacer
********.**************.*** * **
5. spacer 1.78|68427|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_047952 (Pseudomonas phage PAXYB1, complete genome) position: , mismatch: 4, identity: 0.875
gcaccgggccatgcgacggctgcatcgaccat- CRISPR spacer
gcaccgggtcatgcgacggctgcgtcg-caatc Protospacer
********.**************.*** * **
6. spacer 1.78|68427|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_022091 (Pseudomonas phage MPK7, complete genome) position: , mismatch: 4, identity: 0.875
gcaccgggccatgcgacggctgcatcgaccat- CRISPR spacer
gcaccgggtcatgcgacggctgcgtcg-caatc Protospacer
********.**************.*** * **
7. spacer 1.15|64584|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 5, identity: 0.844
atgaacgcggcgagcgcgtacaag-ctccggta CRISPR spacer
atgatcgcggcgagcgcgaacaagcctcccgc- Protospacer
**** ************* ***** **** *.
8. spacer 1.15|64584|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022749 (Sphingobium hydrophobicum strain C1 plasmid p3, complete sequence) position: , mismatch: 5, identity: 0.844
atgaacgcggcgagcgcgtacaag-ctccggta CRISPR spacer
atgatcgcggcgagcgcgaacaagcctcccgc- Protospacer
**** ************* ***** **** *.
9. spacer 1.15|64584|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015989 (Sphingobium sp. EP60837 plasmid pEP2, complete sequence) position: , mismatch: 5, identity: 0.844
atgaacgcggcgagcgcgtacaag-ctccggta CRISPR spacer
atgatcgcggcgagcgcgaacaagcctcccgc- Protospacer
**** ************* ***** **** *.
10. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 5, identity: 0.844
-gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
ggcctgcg-cgccctcgccatcgcggccaccct Protospacer
**** ** ***** **.**************
11. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.844
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
tactcgaccacgcgctcgtcgacatcggcgtc Protospacer
* ****** ******************. * *
12. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020331 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM593, complete sequence) position: , mismatch: 5, identity: 0.844
tttgccgatgtcgcgggtatcga-gatcgcgtc CRISPR spacer
ttcgccgatgtcgcgggcatcgaccatcgcga- Protospacer
**.**************.***** ******
13. spacer 1.78|68427|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_047953 (Pseudomonas phage vB_PaeP_130_113, complete genome) position: , mismatch: 5, identity: 0.844
gcaccgggccatgcgacggctgcatcgaccat- CRISPR spacer
gcaccgggtcatgcgacggctgcgccg-caatc Protospacer
********.**************..** * **
14. spacer 1.83|68732|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_008697 (Nocardioides sp. JS614 plasmid pNOCA01, complete sequence) position: , mismatch: 5, identity: 0.844
aagacgctggccgacgaggaagcctcccagct CRISPR spacer
acgtcactgaccgacgagcaagcctcccagct Protospacer
* * *.***.******** *************
15. spacer 1.4|63913|32|CP034929|CRISPRCasFinder,CRT matches to LR134125 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 5) position: , mismatch: 6, identity: 0.812
gtggtgtgcgcggtggtcgtcggctcaatgcc CRISPR spacer
gtggtttgcgcggtggttgtcggcggactggc Protospacer
***** ***********.****** * ** *
16. spacer 1.20|64889|32|CP034929|CRISPRCasFinder,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812
cactgcgacgcagacgcgtttgcagtacccgc--- CRISPR spacer
ctctgcgacgcagacacgtttgcag---ccgtaag Protospacer
* *************.********* ***.
17. spacer 1.39|66048|32|CP034929|CRISPRCasFinder,CRT matches to KM659098 (Sinorhizobium sp. LM21 plasmid pLM21S1, complete sequence) position: , mismatch: 6, identity: 0.812
ctacgaccccctcgcggggatctactgacccg-- CRISPR spacer
ctacgacccgctcacggggatct--ttactcgca Protospacer
********* ***.********* * **.**
18. spacer 1.47|66536|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP047899 (Pseudarthrobacter sp. YJ56 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
atcgacgcggccaaggcagcgaagacgaacgc CRISPR spacer
ctcaacgcggccaaggcagcgaagaacgacga Protospacer
**.********************* .***
19. spacer 1.47|66536|32|CP034929|CRISPRCasFinder,CRT matches to NC_019326 (Arthrobacter sp. 31-32 plasmid p3132-53, complete sequence) position: , mismatch: 6, identity: 0.812
atcgacgcggccaaggcagcgaagacgaacgc CRISPR spacer
ctcaacgcggccaaggcagcgaagaacgacga Protospacer
**.********************* .***
20. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009112 (Rhodococcus opacus strain 1CP plasmid pR1CP1, complete sequence) position: , mismatch: 6, identity: 0.812
--gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
ccgcgttcg--gccagcgtcaccgcggccacccg Protospacer
** *.** *** ******.************
21. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP050096 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b3, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
22. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP050102 (Rhizobium leguminosarum bv. trifolii strain 9B plasmid pRL9b2, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
23. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP050107 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b1, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
24. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP039913 (Agrobacterium tumefaciens strain CFBP6625 plasmid pAtCFBP6625b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
25. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_007762 (Rhizobium etli CFN 42 plasmid p42a, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
26. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021027 (Rhizobium sp. TAL182 plasmid pRetTAL182c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
27. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013555 (Rhizobium phaseoli strain N931 plasmid pRphaN931c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
28. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013587 (Rhizobium phaseoli strain N161 plasmid pRphaN161b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
29. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013598 (Rhizobium sp. N741 plasmid pRspN741c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
30. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013561 (Rhizobium phaseoli strain N841 plasmid pRphaN841d, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
31. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013578 (Rhizobium phaseoli strain N671 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
32. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013550 (Rhizobium phaseoli strain R611 plasmid pRetR611c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
33. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013530 (Rhizobium phaseoli strain R723 plasmid pRphaR723c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
34. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013535 (Rhizobium phaseoli strain R650 plasmid pRphaR650c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
35. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013540 (Rhizobium phaseoli strain R630 plasmid pRphaR630c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
36. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013544 (Rhizobium phaseoli strain R620 plasmid pRphaR620b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
37. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013566 (Rhizobium phaseoli strain N831 plasmid pRphaN831c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
38. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013502 (Rhizobium esperanzae strain N561 plasmid pRspN561b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
39. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP050112 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b5, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
40. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013583 (Rhizobium phaseoli strain N261 plasmid pRphaN261c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
41. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013508 (Rhizobium sp. N1341 plasmid pRspN1341c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
42. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013519 (Rhizobium sp. N113 plasmid pRspN113b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
43. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013572 (Rhizobium phaseoli strain N771 plasmid pRphaN671d, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
44. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013492 (Rhizobium sp. N6212 plasmid pRspN6212b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
45. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013514 (Rhizobium sp. N1314 plasmid pRspN1314c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
46. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013497 (Rhizobium sp. N621 plasmid pRspN621b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
47. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013592 (Rhizobium sp. N871 plasmid pRspN871b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
48. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_010996 (Rhizobium etli CIAT 652 plasmid pB, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
49. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013604 (Rhizobium sp. N731 plasmid pRspN731c, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
50. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017243 (Rhizobium etli 8C-3 plasmid pRsp8C3b, complete sequence) position: , mismatch: 6, identity: 0.812
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcatcgacgcgctcttcgacatcgagcgc Protospacer
.** *. ********** *********** **
51. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 6, identity: 0.812
--tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cgagctcga--acgcgctggtcgagatcgagggc Protospacer
***** ******* ***** *********
52. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ctggccgacgcccgcgcccaggcagatgaccg- CRISPR spacer
gcagccgacgcccgcgcccgggaaga-gaccgc Protospacer
..****************.** *** *****
53. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_022049 (Paracoccus aminophilus JCM 7686 plasmid pAMI4, complete sequence) position: , mismatch: 6, identity: 0.812
aaggtcgcgaccagcggcaaggtccagggcga- CRISPR spacer
gcggtggcgaccatcggcaaggtcca-tgcgat Protospacer
. *** ******* ************ ****
54. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033971 (Cupriavidus pauculus strain FDAARGOS_614 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgatatcgtcgggcacgccgacgcggccca Protospacer
* ** ***************.******* *
55. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_009339 (Mycolicibacterium gilvum PYR-GCK plasmid pMFLV01, complete sequence) position: , mismatch: 6, identity: 0.812
gacgcgatcgtcgggcacgccaacgcggcgcc- CRISPR spacer
gacgcgatcgtcgcccacgccaa-gaagcgcta Protospacer
************* ******** * .****.
56. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_023285 (Streptomyces sp. F8 plasmid pFRL5, complete sequence) position: , mismatch: 6, identity: 0.812
gtgggcggcgagacagtcggcgatggagcgtt-- CRISPR spacer
gtgggcggcgagatggtcggcga--gcgcggtca Protospacer
*************..******** * *** *
57. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MH370478 (Pseudomonas phage SRT6, complete genome) position: , mismatch: 6, identity: 0.812
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
tccccttacgggtcgccgctgccctgttctca Protospacer
* ***.*.*********************.
58. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MH791408 (UNVERIFIED: Pseudomonas aeruginosa hage PaZq-1, complete genome) position: , mismatch: 6, identity: 0.812
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
tccccttgcgggtcgtcgctgccctgttctca Protospacer
* ***.*********.*************.
59. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK443265 (Pseudomonas phage JHP, complete genome) position: , mismatch: 6, identity: 0.812
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
tccccttgcgggtcgtcgctgccctgttctca Protospacer
* ***.*********.*************.
60. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MH791416 (UNVERIFIED: Pseudomonas phage PaSzW-1, complete genome) position: , mismatch: 6, identity: 0.812
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
tccccttgcgggtcgtcgctgccctgttctca Protospacer
* ***.*********.*************.
61. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.781
ctggggctgcccgtgccggtgacc-tatgaccg CRISPR spacer
atggggctgctcgttccggtgaccatctggct- Protospacer
*********.*** ********* * **.*.
62. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 7, identity: 0.781
ctggggctgcccgtgccggtgacctatgaccg---- CRISPR spacer
ctggtgctgaccgtgccggtgac----gatcgccgc Protospacer
**** **** ************* **.**
63. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to MH067967 (Arthrobacter sp. strain ANT_H19B plasmid pA19BH1, complete sequence) position: , mismatch: 7, identity: 0.781
atgggggcgacggcctcgccgga--tgaggcggt CRISPR spacer
atgtgggtgacggcctcgccggagttcgggtg-- Protospacer
*** ***.*************** * .**.*
64. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP020329 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p3-JPH1, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
65. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015271 (Mycobacterium chimaera strain ZUERICH-2 plasmid unnamed 4, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
66. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015277 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 5, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
67. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_005016 (Mycobacterium avium plasmid pVT2, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
68. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012888 (Mycobacterium chimaera strain AH16 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
69. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022225 (Mycobacterium chimaera strain SJ42 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
70. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP045968 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_05, complete sequence) position: , mismatch: 7, identity: 0.781
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tgctcgacgcgctggccgtgccagtttctgta Protospacer
*.*************** ******* ..* *
71. spacer 1.8|64157|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
cagcatcctgagcggcgagattgctgctcagg CRISPR spacer
ccgcatcctgagcggcgagatcgctggcaaca Protospacer
* *******************.**** . * .
72. spacer 1.15|64584|32|CP034929|CRISPRCasFinder,CRT matches to MT613935 (Pseudomonas phage Persinger, complete genome) position: , mismatch: 7, identity: 0.781
atgaacgcggcgagcgcgtacaagctccggta CRISPR spacer
ttgagcgcggcgagcgcgtacacgcggcagtc Protospacer
***.***************** ** *.**
73. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 7, identity: 0.781
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gccgtgaccacccgcgccgtgctcgcgatgcc Protospacer
***.******************.** .**.
74. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781
gccatgaccacccgcgccgtgcccggcgtgtg- CRISPR spacer
gacatgaccgcccgcgtcgtgcccggc-cacgc Protospacer
* *******.******.********** ...*
75. spacer 1.25|65194|32|CP034929|CRISPRCasFinder,CRT matches to MN657140 (Cryobacterium sp. strain ANT_H26B plasmid pA26BH1, complete sequence) position: , mismatch: 7, identity: 0.781
cacttcgatcacgtccacgtctcctttaagcc----- CRISPR spacer
cacttcgatcacgtccacgtcacc-----accgtcgg Protospacer
********************* ** .**
76. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP047377 (Aeromonas salmonicida subsp. salmonicida strain J410 plasmid p1AsJ410, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
77. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP048224 (Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
78. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP048224 (Aeromonas salmonicida subsp. salmonicida strain J223 plasmid pASal5, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
79. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022183 (Aeromonas salmonicida strain S68 plasmid pS68-2, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
80. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NC_009350 (Aeromonas salmonicida subsp. salmonicida A449 plasmid 5, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
81. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP038103 (Aeromonas salmonicida subsp. salmonicida strain SHY16-3432 plasmid pAsa5-3432, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
82. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017145 (Aeromonas salmonicida subsp. masoucida strain RFAS1 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
83. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022178 (Aeromonas salmonicida strain S44 plasmid pS44-3, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
84. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022172 (Aeromonas salmonicida strain S121 plasmid pS121-3, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
85. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP047375 (Aeromonas salmonicida subsp. salmonicida strain J409 plasmid p1AsJ409, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
86. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_KY555069 (Aeromonas salmonicida subsp. salmonicida strain 01-B526 plasmid pAsa5, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
87. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to CP052035 (Aeromonas salmonicida subsp. salmonicida strain J411 plasmid p1AsJ411, complete sequence) position: , mismatch: 7, identity: 0.781
--ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
atccgt--agcagcctcaagcgctacatctgcta Protospacer
**** .************* *** *****
88. spacer 1.47|66536|32|CP034929|CRISPRCasFinder,CRT matches to NC_009508 (Sphingomonas wittichii RW1 plasmid pSWIT02, complete sequence) position: , mismatch: 7, identity: 0.781
atcgacgcggccaaggcagcgaagacgaacgc CRISPR spacer
ctcgatgcggccaaggcatcgaagcacatcgc Protospacer
****.************ ***** * ***
89. spacer 1.48|66597|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP011518 (Pandoraea oxalativorans strain DSM 23570 plasmid pPO70-1, complete sequence) position: , mismatch: 7, identity: 0.781
ctggacaag--atcgccggcgtcccgtcggccat CRISPR spacer
--agccaggtcatcgccggcgcgccgtcggccat Protospacer
.* **.* **********. ***********
90. spacer 1.48|66597|32|CP034929|CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.781
ctggacaagatcgccggcgtcccg-tcggccat CRISPR spacer
gtggccaagatcgccggcgttccgctctaccg- Protospacer
*** ***************.*** ** .**.
91. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134457 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 15, complete sequence) position: , mismatch: 7, identity: 0.781
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gccgtgaccacccgcgccgtgctcgcgatgcc Protospacer
***.******************.** .**.
92. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781
gccatgaccacccgcgccgtgcccggcgtgtg- CRISPR spacer
gacatgaccgcccgcgtcgtgcccggc-cacgc Protospacer
* *******.******.********** ...*
93. spacer 1.50|66719|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040453 (Halomonas sp. PA16-9 plasmid p_unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
aggtgcccctggccgtcgatgggctggaagag CRISPR spacer
aggtgcccctggccggcgctgggctccagaat Protospacer
*************** ** ****** *..*
94. spacer 1.50|66719|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP046575 (Rhodococcus sp. WAY2 plasmid pRWAY03, complete sequence) position: , mismatch: 7, identity: 0.781
-aggtgcccctggccgtcgatgggctggaagag CRISPR spacer
ccggtg-tcctggccgtcgacgagctggaaggt Protospacer
**** .************.*.********.
95. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tccgatttcgaccgcgtcatcgcggccatccg Protospacer
** . *** *****************.***
96. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.781
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gacgtcctggcccgcgtgatcgtggccacccg Protospacer
* * .* * ******** ****.*********
97. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ctctggacgatgcgctcgtcgacatcgagcag Protospacer
..** *****.****************** .
98. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
99. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
100. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
101. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
102. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
103. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
104. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agcacgccgacgcgctcgccgacatcgaggtg Protospacer
* ** ***********.***********
105. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134450 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 8, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
acatcgacgacacgctcgtcgacaccgacgca Protospacer
* ********.************.*** *
106. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_008271 (Rhodococcus jostii RHA1 plasmid pRHL3, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
gctgggacgacgcgctcgacgacatcgcggcc Protospacer
*. ************* ******** ** *
107. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP052758 (Cellulosimicrobium sp. BI34T plasmid pCPRO01, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cgctcgtcgacgcgctcgtcgacgtcgtgctc Protospacer
. **** ****************.*** * *
108. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP039896 (Rhizobium pusense strain CFBP5875 plasmid pAtCFBP5875, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cccgcattgacgcgctcttcgacatcgagcgc Protospacer
.** *. .********* *********** **
109. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_007765 (Rhizobium etli CFN 42 plasmid p42e, complete sequence) position: , mismatch: 7, identity: 0.781
---tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
aggtgct---cgacgtgcccgtcgacatcgaggac Protospacer
* ** *****.**.**************.*
110. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020909 (Rhizobium etli strain NXC12 plasmid pRetNXC12c, complete sequence) position: , mismatch: 7, identity: 0.781
---tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
aggtgct---cgacgtgcccgtcgacatcgaggac Protospacer
* ** *****.**.**************.*
111. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_021908 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1d, complete sequence) position: , mismatch: 7, identity: 0.781
---tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
aggtgct---cgacgtgcccgtcgacatcgaggac Protospacer
* ** *****.**.**************.*
112. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP045120 (Rubrobacter sp. SCSIO 52909 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcctcgacgacgcgctcgtcgacatcgagggc--- CRISPR spacer
acctcgacgacgtgctcgccgaca---aggcctcg Protospacer
***********.*****.***** *** *
113. spacer 1.54|66963|32|CP034929|CRISPRCasFinder,CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 7, identity: 0.781
ctccaggt--caaggtcaccgcactggatgtcca CRISPR spacer
--gcggttcgcaaggccaccggactggatgtcca Protospacer
*.* * *****.***** ************
114. spacer 1.54|66963|32|CP034929|CRISPRCasFinder,CRT matches to NC_022995 (Burkholderia sp. M701 plasmid pM7012 DNA, complete sequence) position: , mismatch: 7, identity: 0.781
ctccaggt--caaggtcaccgcactggatgtcca CRISPR spacer
--gcggttcgcaaggccaccggactggatgtcca Protospacer
*.* * *****.***** ************
115. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 7, identity: 0.781
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
ctcggcgatgtcgccgatatcgagatcgcacc Protospacer
.*.* ********* *.************..*
116. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctcgccgacgcccgcgcccaggcaggccgcta Protospacer
** **********************.. .*..
117. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_017958 (Tistrella mobilis KA081020-065 plasmid pTM3, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg- CRISPR spacer
gcggccgccgccctcgcccaggcaga-ggcggc Protospacer
.***** ***** ************ *.* *
118. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctggcagacgcccgtgcccaggccaaaggcct Protospacer
***** ********.******** .* *.**
119. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg- CRISPR spacer
ctggccgacgcccgcgccatggc-ggcggcggc Protospacer
****************** *** *..*.* *
120. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039640 (Azospirillum sp. TSH100 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctggccgccgccggcgcccaggc--ctgcctgct Protospacer
******* **** ********** ** *.*
121. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctggccgccgccggcgcccaggc--ctgcctgct Protospacer
******* **** ********** ** *.*
122. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AB981169 (Ralstonia phage RSY1 DNA, complete genome) position: , mismatch: 7, identity: 0.781
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctggccgaggcccgcgcgcaggccgcccactg Protospacer
******** ******** ***** * . **.*
123. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034911 (Ensifer alkalisoli strain YIC4027 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
ccgacgacgatcggcggcctcctgtcggccat Protospacer
*.*. * ***** **** *************
124. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.781
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
atggccaggatcgccggcgtcctgcgcgccct Protospacer
*** **.****************. *** *
125. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
ctggtggtcatcggcggcggcctgtcggccat Protospacer
**** . **** ***** ************
126. spacer 1.67|67756|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017427 (Methylobacterium sp. XJLW plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ctcccgaacaccacgaagccccaggctgtggc CRISPR spacer
atgctgaacaccacgaagccccagcccgtcac Protospacer
* *.******************* *.** .*
127. spacer 1.67|67756|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 7, identity: 0.781
ctcccgaacaccacgaagccccaggctgtggc CRISPR spacer
atgctgaacaccacgaagccccagcccgtcac Protospacer
* *.******************* *.** .*
128. spacer 1.67|67756|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013266 (Sphingobium baderi strain DE-13 plasmid pDE2, complete sequence) position: , mismatch: 7, identity: 0.781
ctcccgaacaccacgaagccccaggctgtggc CRISPR spacer
atgctgaacaccacgaagccccagcccgtcac Protospacer
* *.******************* *.** .*
129. spacer 1.67|67756|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037914 (Sphingomonas sp. AAP5 plasmid p213, complete sequence) position: , mismatch: 7, identity: 0.781
ctcccgaacaccacgaagccccaggctgtggc CRISPR spacer
atgctgaacaccacgaagccccagcccgtcac Protospacer
* *.******************* *.** .*
130. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022195 (Yangia pacifica strain YSBP01 plasmid unnamed5, complete sequence) position: , mismatch: 7, identity: 0.781
aaggtcgcgaccagcggcaaggtccagggcga- CRISPR spacer
gcggttgcgaccagcggcacggtcc-ggatgac Protospacer
. ***.************* ***** **..**
131. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to JX495041 (Pseudomonas phage JBD18, complete genome) position: , mismatch: 7, identity: 0.781
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
acgctgcccaccagcggccaggtcgagggcga Protospacer
* * * * ********* ***** *******
132. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045331 (Labrenzia sp. THAF191b plasmid pTHAF191b_c, complete sequence) position: , mismatch: 7, identity: 0.781
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
gctttggcgagttcggcctcatcgatgtcgag Protospacer
* ***************** .***** * *
133. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045347 (Labrenzia sp. THAF187b plasmid pTHAF187b_c, complete sequence) position: , mismatch: 7, identity: 0.781
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
gctttggcgagttcggcctcatcgatgtcgag Protospacer
* ***************** .***** * *
134. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045336 (Labrenzia sp. THAF191a plasmid pTHAF191a_c, complete sequence) position: , mismatch: 7, identity: 0.781
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
gctttggcgagttcggcctcatcgatgtcgag Protospacer
* ***************** .***** * *
135. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045382 (Labrenzia sp. THAF35 plasmid pTHAF35_b, complete sequence) position: , mismatch: 7, identity: 0.781
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
gctttggcgagttcggcctcatcgatgtcgag Protospacer
* ***************** .***** * *
136. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MT446401 (UNVERIFIED: Escherichia virus TH27, complete genome) position: , mismatch: 7, identity: 0.781
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
tttgtggctagttcagcctcagtgaccacgcg Protospacer
* ****** *****.**********. ***
137. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020399 (Burkholderia multivorans strain FDAARGOS_246 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc- CRISPR spacer
ctcgcgatcgtcgggcgcgcgaacg-atcgccg Protospacer
**************.*** **** . ****
138. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccaatatcgtcgggcacgccgacgcggccca Protospacer
* *. ***************.******* *
139. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_020062 (Rhizobium tropici CIAT 899 plasmid pRtrCIAT899c, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
ggcgcgatcgtcgggcttgccaacgccctgct Protospacer
*.************** .******** .**.
140. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044079 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gacgcgatagtcggggacgccaacaaggatca Protospacer
******** ****** ********. ** *
141. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031079 (Paracoccus yeei strain CCUG 32053 plasmid pYEE1, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gacgcgatagtcggggacgccaacaaggatca Protospacer
******** ****** ********. ** *
142. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to KM083128 (Mycobacterium phage Sparky, complete genome) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gagcggcgcgtcgggcccgcgaacgcggcgcc Protospacer
** * ******** *** ***********
143. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024200 (Thalassospira marina strain CSC3H3 plasmid pCSC3H3, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgatatcatcgggcacaccaacgcggccca Protospacer
* ** ***.********.********** *
144. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
145. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134460 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 18, complete sequence) position: , mismatch: 7, identity: 0.781
gacgc-gatcgtcgggcacgccaacgcggcgcc CRISPR spacer
-atgctgatcgtccggcacgccaaggcgggccg Protospacer
*.** ******* ********** **** *
146. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgatatcgtcgggcaggccgacgcggccca Protospacer
* ** *********** ***.******* *
147. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
148. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
149. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032342 (Azospirillum brasilense strain MTCC4038 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
150. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033321 (Azospirillum brasilense strain Cd plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
151. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033315 (Azospirillum brasilense strain Sp 7 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
152. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032349 (Azospirillum brasilense strain MTCC4039 plasmid p3, complete sequence) position: , mismatch: 7, identity: 0.781
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgcgatcatcgggctcgccaacggcgggac Protospacer
* *******.****** ******** * * *
153. spacer 1.77|68366|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
gaagagtccgcgttctggatcgacgaacacgg CRISPR spacer
gacgagcccgcgttctggatcgactttctcga Protospacer
** ***.***************** * **.
154. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006369 (Aureimonas sp. AU20 plasmid pAU20b, complete sequence) position: , mismatch: 7, identity: 0.781
gaggccg--tgcaggacctcgtcacgatcgcgat CRISPR spacer
--tgccggatgcaggatctcgtcgcgatcgcggc Protospacer
**** *******.******.********..
155. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR723672 (Rhizobium flavum strain YW14 plasmid 3) position: , mismatch: 7, identity: 0.781
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
agcggcggcgagacagtgggcgatggatcggc Protospacer
. ************** ********* ** .
156. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034352 (Streptomyces sp. W1SF4 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagccagtcggcgttgcggagca Protospacer
************ ********* ** .* *.
157. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034781 (Pseudomonas sp. MPC6 plasmid pMPC6-47K, complete sequence) position: , mismatch: 7, identity: 0.781
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gagggcggtgaggcagtcggcgatgcgttgtt Protospacer
* ******.***.************ . .***
158. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048288 (Paenibacillus sp. 14171R-81 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
aagctcagggtcgggtaccggcggcggttccg Protospacer
* * . *.**** ** ****************
159. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
acgtcaccggtccggaaccggcggcggtgccg Protospacer
*.* *. ****.*************** ***
160. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
acgtcaccggtccggaaccggcggcggtgccg Protospacer
*.* *. ****.*************** ***
161. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016618 (Microvirga ossetica strain V5/3m plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
atggcga-aggtctggaaccggcggcggttccg CRISPR spacer
-cggcggcagttctggaaccggcggctgttcgc Protospacer
.****. ** *************** ****
162. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
tcgcccgcaccctggacggcgtcgaactcctc Protospacer
******* ************ **. ***.*
163. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
tcgcccgcaccctggacggcgtcgaactcctc Protospacer
******* ************ **. ***.*
164. spacer 1.90|69159|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF959998 (Marinobacter phage PS6, complete genome) position: , mismatch: 7, identity: 0.781
atcaccagtgatcgaaccagtgagcgagctgc CRISPR spacer
accaccagtgaacgaaccagtgatcgcgttca Protospacer
*.********* *********** ** *.*
165. spacer 1.1|63730|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013487 (Vibrio alginolyticus strain ATCC 33787 plasmid pMBL287, complete sequence) position: , mismatch: 8, identity: 0.75
tcttcgggggagtcgagccactttttgaagtg CRISPR spacer
tgataagcggagtcgagccacttttgcaagta Protospacer
* * .* ***************** ****.
166. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
atgcgcatgcccgtgccggtgtcctacgacat Protospacer
** * ************** ****.***
167. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
atgcgcatgcccgtgccggtgtcctacgacat Protospacer
** * ************** ****.***
168. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
atgcgcatgcccgtgccggtgtcctacgacat Protospacer
** * ************** ****.***
169. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
atgcgcatgcccatgccggtgtcctatgacat Protospacer
** * *****.******** ********
170. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
atgcgcatgcccatgccggtgtcctatgacat Protospacer
** * *****.******** ********
171. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
atgcgcatgcccgtgccggtgtcctacgacat Protospacer
** * ************** ****.***
172. spacer 1.4|63913|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017077 (Novosphingobium resinovorum strain SA1 plasmid pSA2, complete sequence) position: , mismatch: 8, identity: 0.75
gtggtgtgcgcggtggtcgtcggctcaatgcc CRISPR spacer
ctggtgtgcgcggtagtagtcggccacctgcg Protospacer
*************.** ******. ***
173. spacer 1.6|64035|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP030129 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
aagactg--gccctgaggttgccgagaccttggg CRISPR spacer
--caccgatgccctgagggtgccgagaccatgca Protospacer
**.* ********* ********** ** .
174. spacer 1.9|64218|32|CP034929|CRISPRCasFinder,CRT matches to NC_015063 (Rahnella sp. Y9602 plasmid pRAHAQ02, complete sequence) position: , mismatch: 8, identity: 0.75
tggaagcctcggcacttcaggttctggtcgaa CRISPR spacer
tcgtgttcccggcacttcaggatctgatcgaa Protospacer
* * . .*.************ ****.*****
175. spacer 1.13|64462|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024309 (Sinorhizobium fredii strain NXT3 plasmid pSfreNXT3b, complete sequence) position: , mismatch: 8, identity: 0.75
tgaggaa-----cggcacgctcaccctggctgaggcc CRISPR spacer
-----aatttttcggctcgctcaccctcgctgaggtc Protospacer
** **** ********** *******.*
176. spacer 1.13|64462|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024312 (Rhizobium sp. NXC24 plasmid pRspNXC24a, complete sequence) position: , mismatch: 8, identity: 0.75
tgaggaa-----cggcacgctcaccctggctgaggcc CRISPR spacer
-----aatttttcggcgcgctcaccctcgctgaggtc Protospacer
** ****.********** *******.*
177. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgcgcacccgcgccgtgcccggggcaga Protospacer
***** ****************** *.. .
178. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
ttcgtgaccacccgcaccgtgaccggccggcg Protospacer
.*.***********.***** ***** *.*
179. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gcaatgaccacgcgcgccgtgccctacgccgt Protospacer
** ******** ************ .**.
180. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gacagcgccgcccgcgccatgcccggcgtgat Protospacer
* ** .**.********.***********
181. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gtcatgaccagccgcgccgttcccgtcagccg Protospacer
*.******** ********* **** *. .*
182. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018081 (Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gacagcgccgcccgcgccatgcccggcgtgat Protospacer
* ** .**.********.***********
183. spacer 1.25|65194|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP049751 (Rhodococcus fascians A21d2 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cacttcgatcacgtccacgtctcctttaagcc----- CRISPR spacer
cacttcgaccacgtccacgtcacc-----accgtcgg Protospacer
********.************ ** .**
184. spacer 1.28|65377|32|CP034929|CRISPRCasFinder,CRT matches to AP014350 (Uncultured Mediterranean phage uvMED isolate uvMED-GF-U-MedDCM-OCT-S39-C22, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 8, identity: 0.75
gcctggcagttcttcaacgtctccacgtcgtg CRISPR spacer
catcgcctgttcatcaacgtctccgcgtcgtg Protospacer
..* * **** ***********.*******
185. spacer 1.29|65438|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP025615 (Niveispirillum cyanobacteriorum strain TH16 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
cagacgggggacgtcgccgccaccgaagatgg CRISPR spacer
cagccgggcgacgtcgccgccacctgcgccga Protospacer
*** **** *************** . * .*.
186. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
187. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
188. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
189. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
190. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
191. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
192. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
193. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
194. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcaccgactgcctccaagc Protospacer
. ** ******************** **
195. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP011296 (Rhodococcus erythropolis strain BG43 plasmid pRLCBG43, complete sequence) position: , mismatch: 8, identity: 0.75
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggcagtgccgtccgcactgactgcctcgaaag Protospacer
. * *. **.*******.************ *
196. spacer 1.38|65987|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 8, identity: 0.75
atctcatcacgccggcccagctcgcacgagca- CRISPR spacer
gcctgatcacaccggcccagctcgc-tggtcag Protospacer
..** *****.************** .*. **
197. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP026333 (Pseudomonas sp. XWY-1 plasmid pXWY, complete sequence) position: , mismatch: 8, identity: 0.75
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
tttttttcggcgtcgctgacgttgctcgtatg Protospacer
.****************** *** ***.. .
198. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 8, identity: 0.75
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
gcgaattcggcgtcgctggccttgagcgtcgg Protospacer
** *************.****** **. *.
199. spacer 1.41|66170|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgcagcatcccagcgccgaggcgccc CRISPR spacer
acaccatgcagcatcccatcgccgaggaattc Protospacer
.*.** ************ ******** ...*
200. spacer 1.41|66170|32|CP034929|CRISPRCasFinder,CRT matches to CP048435 (Collinsella aerofaciens ATCC 25986 strain JCM 10188 plasmid putative_pCaero2, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgcagcatcccagcgccgaggcgccc CRISPR spacer
gcgccccgcagcttcccagcgcccaatctcgg Protospacer
******.***** ********** *. * *
201. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
gcccccgccaccgcctcggacacgatccgggc Protospacer
. ************.*** ******** * .
202. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.75
ccgtccggcagcctcaagcgatacctctgcac CRISPR spacer
ccgtccggccgcctcaggcgataccgggcttc Protospacer
********* ******.******** . *
203. spacer 1.47|66536|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP048288 (Paenibacillus sp. 14171R-81 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
atcgacgcggccaaggcagcgaagacgaacgc CRISPR spacer
atcgacgccgtcaaggcagcgaatgcgcagct Protospacer
******** *.************ .** * .
204. spacer 1.47|66536|32|CP034929|CRISPRCasFinder,CRT matches to HQ332136 (Dunaliella viridis virus SI2 genomic sequence) position: , mismatch: 8, identity: 0.75
atcgacgcggccaaggcagcgaa-gacgaacgc CRISPR spacer
atcgccgcggccaaggctgcgaaccgcgggca- Protospacer
**** ************ ***** .**..*.
205. spacer 1.48|66597|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggacaagatcgccggcgtcccgtcggccat CRISPR spacer
tatgagatcatccccggcgtcccctcggccat Protospacer
. ** * *** ********** ********
206. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgcgcacccgcgccgtgcccggggcaga Protospacer
***** ****************** *.. .
207. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040819 (Paraoceanicella profunda strain D4M1 plasmid pD4M1A, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
ttcgtgaccacccgcaccgtgaccggccggcg Protospacer
.*.***********.***** ***** *.*
208. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gcaatgaccacgcgcgccgtgccctacgccgt Protospacer
** ******** ************ .**.
209. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021915 (Sagittula sp. P11 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gacagcgccgcccgcgccatgcccggcgtgat Protospacer
* ** .**.********.***********
210. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gtcatgaccagccgcgccgttcccgtcagccg Protospacer
*.******** ********* **** *. .*
211. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018081 (Sulfitobacter sp. AM1-D1 plasmid unnamed5, complete sequence) position: , mismatch: 8, identity: 0.75
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
gacagcgccgcccgcgccatgcccggcgtgat Protospacer
* ** .**.********.***********
212. spacer 1.50|66719|32|CP034929|CRISPRCasFinder,CRT matches to NC_023555 (Edwardsiella phage eiAU-183, complete genome) position: , mismatch: 8, identity: 0.75
---aggtgcccctggccgtcgatgggctggaagag CRISPR spacer
attacgta---ctggccgtcgagggcctggaagac Protospacer
* **. *********** ** ********
213. spacer 1.50|66719|32|CP034929|CRISPRCasFinder,CRT matches to NC_042029 (Edwardsiella phage eiAU, complete genome) position: , mismatch: 8, identity: 0.75
---aggtgcccctggccgtcgatgggctggaagag CRISPR spacer
attacgta---ctggccgtcgagggcctggaagac Protospacer
* **. *********** ** ********
214. spacer 1.51|66780|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007256 (Rhodococcus erythropolis R138 plasmid pCRE138, complete sequence) position: , mismatch: 8, identity: 0.75
cacaccccggagcagaaccccctccccgcctc CRISPR spacer
tccgcgccggcgcagaatcccctccccgctcc Protospacer
. *.* **** ******.***********..*
215. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017191 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid p_XCV_1, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
216. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023287 (Xanthomonas citri pv. citri strain 03-1638-1-1 plasmid pP2, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
217. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018464 (Xanthomonas euvesicatoria strain LMG930 plasmid pLMG930.1, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
218. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018860 (Xanthomonas citri pv. citri strain LH201 plasmid pLH201.2, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
219. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018852 (Xanthomonas citri pv. citri strain LJ207-7 plasmid pLJ207-7.2, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
220. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018849 (Xanthomonas citri pv. citri strain LL074-4 plasmid pLL074-4.2, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
221. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012003 (Xanthomonas citri pv. aurantifolii strain 1566 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
222. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_005240 (Xanthomonas citri plasmid pXcB, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
223. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP011164 (Xanthomonas citri pv. aurantifolii strain FDC 1609 plasmid pXfc37, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
224. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018856 (Xanthomonas citri pv. citri strain LH276 plasmid pLH276.2, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
225. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024030 (Xanthomonas citri pv. citri strain Xcc49 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
226. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009012 (Xanthomonas citri pv. citri strain JX4 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
227. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020888 (Xanthomonas citri pv. citri strain TX160149 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
228. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP008997 (Xanthomonas citri pv. citri strain MN12 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
229. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013664 (Xanthomonas citri pv. citri strain jx-6 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
230. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009000 (Xanthomonas citri pv. citri strain MN11 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
231. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024033 (Xanthomonas citri pv. citri strain Xcc29-1 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
232. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023156 (Xanthomonas citri pv. malvacearum strain AR81009 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
233. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020978 (Xanthomonas phaseoli pv. phaseoli strain CFBP6982 plasmid pD) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
234. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gagatcgacgtccgcgtcatcgcggccaccaa Protospacer
* .** **.******************* .
235. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP011162 (Xanthomonas citri pv. aurantifolii strain FDC 1559 plasmid pXfc38, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
236. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009030 (Xanthomonas citri pv. citri strain AW13 plasmid pXCAW58, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
237. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009039 (Xanthomonas citri pv. citri strain AW16 plasmid pXCAW58, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
238. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009015 (Xanthomonas citri pv. citri strain GD3 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
239. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_007507 (Xanthomonas campestris pv. vesicatoria str. 85-10 plasmid pXCV183, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
240. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP008994 (Xanthomonas citri pv. citri strain NT17 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
241. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009009 (Xanthomonas citri pv. citri strain JX5 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
242. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013005 (Xanthomonas citri pv. malvacearum strain XcmH1005 plasmid pXcmH, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
243. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013007 (Xanthomonas citri pv. malvacearum strain XcmN1003 plasmid pXcmN, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
244. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020966 (Xanthomonas phaseoli pv. phaseoli strain CFBP412 plasmid pD, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
245. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020966 (Xanthomonas phaseoli pv. phaseoli strain CFBP412 plasmid pD, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
246. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009003 (Xanthomonas citri pv. citri strain MN10 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
247. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009018 (Xanthomonas citri pv. citri strain GD2 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
248. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009021 (Xanthomonas citri pv. citri strain FB19 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
249. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP008988 (Xanthomonas citri pv. citri strain UI7 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
250. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_020797 (Xanthomonas axonopodis Xac29-1 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
251. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009006 (Xanthomonas citri pv. citri strain MF20 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
252. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP046020 (Xanthomonas citri pv. malvacearum strain HD-1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
253. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP008991 (Xanthomonas citri subsp. citri UI6 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
254. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_003922 (Xanthomonas citri pv. citri str. 306 plasmid pXAC64, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtaatcgcggccaacga Protospacer
* .************ ********** * .
255. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP011251 (Xanthomonas citri pv. aurantifolii strain FDC 1561 plasmid pXfb33, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgcgtgatcgcggccaacga Protospacer
* .************ ********** * .
256. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gccgccggcgcccgcgtcatcgcgacggcgga Protospacer
*** *** ****************.* .* .
257. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
cgcaccgtcgcccccgccatcgcggccgcgtg Protospacer
* ********* **.**********.* .*
258. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020949 (Rhizobium sp. CIAT894 plasmid pRheCIAT894b, complete sequence) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gtcgcgctcacccgcgtcatcggggccaccgc Protospacer
*.* * **.************ *******
259. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to MT451983 (Microbacterium phage Ixel, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gagggcatcggccgcgtcatcgaggccaccgg Protospacer
* *.*** *********** ******* *
260. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to LR743531 (Xanthomonas phage Tenjo genome assembly, chromosome: 1) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
atcccgctggcccgcgccatcgcggccatccg Protospacer
..*.* * *******.***********.***
261. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to KT221034 (Streptomyces phage SF3, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tccgacagcgcccgcgccatcgcggcgaccct Protospacer
** *. ********.********* ****
262. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to KT221033 (Streptomyces phage SF1, complete genome) position: , mismatch: 8, identity: 0.75
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tccgacagcgcccgcgccatcgcggcgaccct Protospacer
** *. ********.********* ****
263. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ggcctgaggacgcgctcgccgacatcgagcgg Protospacer
*..** **********.********** *
264. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to MT771342 (Gordonia phage Matteo, complete genome) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
gcggcgacgccgcgctcgtcgacaccgtcgcc Protospacer
* ***** **************.** * *
265. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_047816 (Ralstonia phage RS-PI-1, complete genome) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
atgacgacgacccgctcggcgacatcgagtga Protospacer
. ******* ****** ********** *
266. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP042263 (Litoreibacter sp. LN3S51 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
acttcgacgacacgcccgtcgacatcgcgctg Protospacer
*.********.***.*********** *
267. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ggcccgacgacgagctcgtcgccatcgaagag Protospacer
*.******** ******** ******.*.
268. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_012811 (Methylorubrum extorquens AM1 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
tcctcggcgacgcgcgcgtcgacccggccgtc Protospacer
******.******** ******* . * * *
269. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024582 (Roseomonas sp. FDAARGOS_362 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
gctgcgacggcgcgctcgtcgagatcgggacc Protospacer
*. *****.************ ****.*. *
270. spacer 1.54|66963|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 8, identity: 0.75
ctccaggtcaaggtcaccgcactggatgtcca--- CRISPR spacer
ggccaggtcaaggtcaccgccgtg---gtctacat Protospacer
****************** ** ***.*
271. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgccggtatcgacgaagccaa Protospacer
************** ******** . **
272. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 8, identity: 0.75
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tgccgcgatgtcgcgggtatcgggatggcgct Protospacer
* . *****************.*** ***..
273. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013516 (Rhizobium sp. N1314 plasmid pRspN1314e, complete sequence) position: , mismatch: 8, identity: 0.75
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tgccgcgatgtcgcgggtatcgggatggcgct Protospacer
* . *****************.*** ***..
274. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016619 (Microvirga ossetica strain V5/3m plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
ctcggcgatgtcgcgcgtgtcgagatcggacc Protospacer
.*.* ********** **.********* ..*
275. spacer 1.59|67268|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MH834598 (Arthrobacter phage Auxilium, complete genome) position: , mismatch: 8, identity: 0.75
actgatggacaagtcggatgcctccctggcca CRISPR spacer
gctcggcgacaagtcagatgcctccatggccg Protospacer
.** . ********.********* *****.
276. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031166 (Euzebya sp. DY32-46 plasmid pEDY32-46I, complete sequence) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gtctccgacgccggcgcccaggcaggtgtgca Protospacer
* ******** ************.** *.
277. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029643 (Arthrobacter dokdonellae isolate rhizosphere plasmid pDCT5, complete sequence) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
atggacgccgcccgcgcccaggcacgcgccct Protospacer
*** ** **************** ..* **
278. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029830 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg- CRISPR spacer
gccgccgccgcccgcgcccaggcgga-ggcggc Protospacer
. **** ***************.** *.* *
279. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_016623 (Azospirillum lipoferum 4B plasmid AZO_p3, complete sequence) position: , mismatch: 8, identity: 0.75
---ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gtcctgat---agccctcgcccagccagatgaccg Protospacer
***.. **** ******* **********
280. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039965 (Pseudorhodobacter sp. S12M18 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
aactccgacgcccgcgccaaggccgat--ccgac Protospacer
************** **** *** ***
281. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gcggccgatgcccccgcccaggcagcgcaccc Protospacer
.******.**** *********** ***
282. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417913 (Uncultured Caudovirales phage clone 9S_2, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
283. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417916 (Uncultured Caudovirales phage clone 7S_13, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
284. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417911 (Uncultured Caudovirales phage clone 9AX_3, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
285. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417918 (Uncultured Caudovirales phage clone 7F_17, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
286. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417915 (Uncultured Caudovirales phage clone 8AX_8, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
287. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417914 (Uncultured Caudovirales phage clone 8S_2, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
288. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417920 (Uncultured Caudovirales phage clone 10F_8, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
289. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417898 (Uncultured Caudovirales phage clone 7AX_6, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
290. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417896 (Uncultured Caudovirales phage clone 3S_18, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
291. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417912 (Uncultured Caudovirales phage clone 10AX_4, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
292. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF417910 (Uncultured Caudovirales phage clone 2AX_5, partial genome) position: , mismatch: 8, identity: 0.75
ctggccgacgcccgcgcccaggcagatgaccg-- CRISPR spacer
ctcgccgacgccctcgcccaggc--tttcctggc Protospacer
** ********** ********* * *.*
293. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134468 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 26, complete sequence) position: , mismatch: 8, identity: 0.75
ctggacaa---gatcgccggcgtcctgtcggccat CRISPR spacer
---gacgggccgatcgccgacgtcctgccggccac Protospacer
***.. ********.*******.******.
294. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
ctgctggtcatcggcggcggcctgtcggccat Protospacer
*** . **** ***** ************
295. spacer 1.68|67817|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 8, identity: 0.75
aatctgac---cggtttcgcgatgcccaagcaggt CRISPR spacer
---tcgaccgacggtttcgcgatgcgcaaccaggg Protospacer
..*** ************** *** ****
296. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015988 (Sphingobium sp. EP60837 plasmid pEP1, complete sequence) position: , mismatch: 8, identity: 0.75
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
gtttcagtgacgagcggcaaggtccagggcga Protospacer
. . *.*** ********************
297. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044991 (Deinococcus sp. AJ005 plasmid p115k, complete sequence) position: , mismatch: 8, identity: 0.75
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
tgtggggcggccagcggcaacgtccagggcgt Protospacer
. * ***.********** **********
298. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP016081 (Streptomyces sp. SAT1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
gcgttcctgaccagaggcagggtccagggcgc Protospacer
. * ** .****** ****.***********
299. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP000662 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA01, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gcccgccacgtcgggcacgcccacgcggcgca Protospacer
* * ************* *********
300. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
--gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
cggatctg--cgtcgagcacgccaacgcggagca Protospacer
**. .* *****.************** **
301. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
--gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
cggatctg--cgtcgagcacgccaacgcggagca Protospacer
**. .* *****.************** **
302. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
303. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
304. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
305. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
306. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
307. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
308. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
309. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
310. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
311. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
312. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
313. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
314. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
315. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgatatcgtcgggcacacccacgcggccga Protospacer
* ** ************.** *******
316. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.75
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gccgccatcgtcgggcgcgccaacggcaaggc Protospacer
* *** **********.******** . * *
317. spacer 1.76|68305|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024940 (Paraburkholderia hospita strain mHSR1 plasmid pmHSR1_P, complete sequence) position: , mismatch: 8, identity: 0.75
agggaaacggtcgacatgccgtcagcgtccta CRISPR spacer
cgattatcggtcgacacgccggcagcgtcctc Protospacer
*. * *********.**** *********
318. spacer 1.77|68366|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010991 (Pseudonocardia sp. EC080625-04 plasmid pFRP1-2, complete sequence) position: , mismatch: 8, identity: 0.75
gaagagtccgcgttctggatcgacgaacacgg CRISPR spacer
gcgttctacgagttctggatcgacgaacgcgg Protospacer
* . * ** *****************.***
319. spacer 1.77|68366|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75
gaagagtccgcgttctggatcgacgaacacgg CRISPR spacer
gcgttctacgagttctggatcgacgaacgcgg Protospacer
* . * ** *****************.***
320. spacer 1.77|68366|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012186 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-1, complete sequence) position: , mismatch: 8, identity: 0.75
gaagagtccgcgttctggatcgacgaacacgg CRISPR spacer
gcgttctacgagttctggatcgacgaacgcgg Protospacer
* . * ** *****************.***
321. spacer 1.77|68366|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75
gaagagtccgcgttctggatcgacgaacacgg CRISPR spacer
gcgttctacgagttctggatcgacgaacgcgg Protospacer
* . * ** *****************.***
322. spacer 1.77|68366|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 8, identity: 0.75
gaagagtccgcgttctggatcgacgaacacgg CRISPR spacer
gcgttctacgagttctggatcgacgaacgcgg Protospacer
* . * ** *****************.***
323. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to JN968479 (Haloarcula hispanica icosahedral virus 2, complete genome) position: , mismatch: 8, identity: 0.75
gaggccgtgcaggacctcgtcacgatcgcgat---- CRISPR spacer
gaggccgcgcaggacctcgcca----cgcagtacag Protospacer
*******.***********.** ***..*
324. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX364409 (Aeromonas salmonicida subsp. salmonicida strain M16474-11 plasmid pAsa8, complete sequence) position: , mismatch: 8, identity: 0.75
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
tcggccttgcaggacctcgtgacgacagcttt Protospacer
**** ************* ****. ** *
325. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 8, identity: 0.75
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
ggggccgtccaggtcctcgtcacgagcatcgt Protospacer
*.****** **** *********** *.. .*
326. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042333 (Bosea sp. F3-2 plasmid pB32-2, complete sequence) position: , mismatch: 8, identity: 0.75
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
gaggcggtgcagcacctcgtcacctttctgct Protospacer
***** ****** ********** *. .* *
327. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_024970 (Streptomyces aureofaciens strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagccagtcggcgttgcgcagca Protospacer
************ ********* ** . *.
328. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KJ396772 (Streptomyces lavendulae subsp. lavendulae strain CCM3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagccagtcggcgttgcgcagca Protospacer
************ ********* ** . *.
329. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024986 (Streptomyces lavendulae subsp. lavendulae strain CCM 3239 plasmid pSA3239, complete sequence) position: , mismatch: 8, identity: 0.75
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagccagtcggcgttgcgcagca Protospacer
************ ********* ** . *.
330. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MT770738 (Rhizobium phage B1VFA, complete genome) position: , mismatch: 8, identity: 0.75
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtggccggcgagatagtcggcgatgtcctggc Protospacer
**** ********.*********** .* .
331. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
atggcgaagggctggaactggcgctgctgtgg Protospacer
********** *******.**** .* * . *
332. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
atggcgaagggctggaactggcgctgctgtgg Protospacer
********** *******.**** .* * . *
333. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020385 (Rhodovulum sp. MB263 plasmid pRSMBA, complete sequence) position: , mismatch: 8, identity: 0.75
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
agatggaggatctggaaccggcggcggtggcg Protospacer
* . **.*.****************** **
334. spacer 1.83|68732|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 8, identity: 0.75
aagacgctggccgacgaggaagcctcccagct CRISPR spacer
gcgccgcttgccgacgagtaagcctccatgcg Protospacer
. * **** ********* ******** **
335. spacer 1.84|68793|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033227 (Sphingobium yanoikuyae strain SJTF8 plasmid pF1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgacctcggggccctgcagcctctccggagc CRISPR spacer
tcgacctcggggccgtgcggccttgcgggtag Protospacer
************** ***.****. * ** .
336. spacer 1.86|68915|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027023 (Streptomyces sp. WAC00288 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gcaaggaccgccggtcctccacccgactcacc CRISPR spacer
gcaaggacagccggtcctccgccgcgcactcg Protospacer
******** ***********.** .* * *
337. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
gcggccggaccctggacggcctcgcctggttc Protospacer
** *******************.** ..*
338. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
acccgtggaccctggacagcctcaccctcttc Protospacer
* * .***********.******** **..*
339. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 8, identity: 0.75
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
gtcactttagggtcgcctcggccctgttccat Protospacer
* *.* ******** * ************
340. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
agccccagcgggtcgccgctcccctcccgcag Protospacer
***** ************* **** .. **
341. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 8, identity: 0.75
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
gcgctcggcgggtcgccgctgccctcgtcctt Protospacer
*.* ****************** *** *
342. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to JN699011 (Mycobacterium phage Stinger, complete genome) position: , mismatch: 8, identity: 0.75
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
tacgcctgcggcacgccgctgccctgtacgcg Protospacer
*.* ******* ************** *
343. spacer 1.92|69281|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007130 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 2, complete sequence) position: , mismatch: 8, identity: 0.75
tggcggtgctcgtcgctccacgccaggaccgc CRISPR spacer
acgcggtgcacgtcgccccacgccacgtcgac Protospacer
******* ******.******** * * .*
344. spacer 1.92|69281|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR536451 (Methylocella tundrae isolate MTUNDRAET4 annotated genome plasmid 2) position: , mismatch: 8, identity: 0.75
tggcggtgctcgtcgctccacgccaggaccgc CRISPR spacer
tagtcacgctcgtcgatccgcgccaggacctc Protospacer
*.*. ..******** ***.********** *
345. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttcgcgacggctgtgtctgtggccg--cgaagca CRISPR spacer
atcgcaacggctgtgtcagtggccaatcttag-- Protospacer
****.*********** ******. * **
346. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
---ttcgcgacggctgtgtctgtggccgcgaagca CRISPR spacer
aagtacgcggcg---gtgtcggtggccgcgaaggc Protospacer
* ****.** ***** ************
347. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013739 (Streptomyces globisporus C-1027 plasmid SGLP1, complete sequence) position: , mismatch: 8, identity: 0.75
ttcgcgacggctgtgtctgtggccg--cgaagca CRISPR spacer
atcgcaacggctgtgtcagtggccaatcttag-- Protospacer
****.*********** ******. * **
348. spacer 1.3|63852|32|CP034929|CRISPRCasFinder,CRT matches to NZ_KR997898 (Mycobacterium avium subsp. hominissuis strain 88Br plasmid pMA100, complete sequence) position: , mismatch: 9, identity: 0.719
ctggggctgcccgtgccggtgacctatgaccg CRISPR spacer
gtggggctgcgggtgccggtgacctcgaggca Protospacer
********* ************* .. *.
349. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP035092 (Paracoccus denitrificans strain ATCC 19367 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
ctgatccagacggccccgccggatgcggcggg Protospacer
**. *******.********* *****
350. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134454 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 12, complete sequence) position: , mismatch: 9, identity: 0.719
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
gcgcagcggacggcctcgccggatcacgcggg Protospacer
..* .* **************** * ****
351. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to NC_008688 (Paracoccus denitrificans PD1222 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
ctgatccagacggccccgccggatgcggcggg Protospacer
**. *******.********* *****
352. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032180 (Citrobacter freundii strain AR_0116 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
cacagggcgatggcctcaccggatgagcagga Protospacer
.******.******.********* **
353. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 9, identity: 0.719
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
ccgacgtcgacggcatcgccgaatgaggcgag Protospacer
.*. * ******* ******.********.
354. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP029050 (Miniimonas sp. S16 plasmid pS16-1, complete sequence) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
cgttcgacgcgctgcccggaccagcccaacga Protospacer
************* ****.****.. **
355. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279887 (Mycobacterium phage Timmi, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
356. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH651175 (Mycobacterium phage Gophee, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
357. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to GQ303264 (Mycobacterium phage Puhltonio, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
358. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG925339 (Mycobacterium phage Chunky, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
359. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to GU247134 (Mycobacterium phage Scoot17C, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
360. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX683293 (Mycobacterium phage Daffy, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
361. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279888 (Mycobacterium phage TomBombadil, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
362. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF957056 (Mycobacterium phage Thora, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
363. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT316463 (Mycobacterium phage Slatt, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
364. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX576645 (Mycobacterium phage Derpp, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
365. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH651184 (Mycobacterium phage Phareon, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
366. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN006063 (Mycobacterium phage Serendipity, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
367. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH779500 (Mycobacterium phage Crownjwl, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
368. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH230875 (Mycobacterium phage CheetO, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
369. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG962365 (Mycobacterium phage DoesntMatter, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
370. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919511 (Mycobacterium phage Kailash, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
371. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279882 (Mycobacterium phage Sophia, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
372. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX670813 (Mycobacterium phage MitKao, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
373. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH576970 (Mycobacterium phage DonSanchon, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
374. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279866 (Mycobacterium phage MRabcd, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
375. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH513973 (Mycobacterium phage Kwksand96, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
376. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK524512 (Mycobacterium phage Carthage, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
377. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN945899 (Mycobacterium phage Skippy, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
378. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279908 (Mycobacterium phage Roliet, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
379. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_023727 (Mycobacterium phage Vista, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
380. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT897909 (Mycobacterium phage Maru, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
381. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KM347890 (Mycobacterium phage Vivaldi, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
382. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH727555 (Mycobacterium phage Mulan, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
383. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT776813 (Mycobacterium phage Magic8, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
384. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG757164 (Mycobacterium phage PhenghisKhan, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
385. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KY006474 (Mycobacterium phage Prann, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
386. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_027985 (Mycobacterium phage UncleHowie, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
387. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN698990 (Mycobacterium phage IsaacEli, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
388. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KY965066 (Mycobacterium phage BlackStallion, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
389. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN703415 (Mycobacterium phage Mcshane, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
390. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX592589 (Mycobacterium phage Iridoclysis, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
391. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH051251 (Mycobacterium phage DuchessDung, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
392. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX576646 (Mycobacterium phage TyrionL, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
393. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279871 (Mycobacterium phage Plmatters, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
394. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279883 (Mycobacterium phage Struggle, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
395. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN096366 (Mycobacterium phage AbsoluteMadLad, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
396. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG757165 (Mycobacterium phage Phergie, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
397. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH371107 (Mycobacterium phage Doddsville, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
398. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_028942 (Mycobacterium phage Phipps, complete sequence) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
399. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ567044 (Mycobacterium phage EmpTee, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
400. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279881 (Mycobacterium phage Solosis, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
401. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG944223 (Mycobacterium phage Trypo, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
402. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT897902 (Mycobacterium phage Boehler, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
403. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279855 (Mycobacterium phage Haleema, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
404. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JX649096 (Mycobacterium phage Serpentine, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
405. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK494104 (Mycobacterium phage HenryJackson, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
406. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG944225 (Mycobacterium phage Xavier, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
407. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JX649099 (Mycobacterium phage Gyarad, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
408. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH450116 (Mycobacterium phage Buckeye, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
409. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN638753 (Mycobacterium phage Morgushi, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
410. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG757158 (Mycobacterium phage HighStump, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
411. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112539 (Mycobacterium phage Dione, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
412. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279873 (Mycobacterium phage QueenBeane, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
413. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF668276 (Mycobacterium phage Lulumae, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
414. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT897903 (Mycobacterium phage DirtJuice, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
415. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH513980 (Mycobacterium phage Roy17, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
416. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279879 (Mycobacterium phage SassyCat97, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
417. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN586058 (Mycobacterium phage Vaishali24, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
418. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT316460 (Mycobacterium phage Kimbrough, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
419. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF937097 (Mycobacterium phage Hertubise, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
420. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH230874 (Mycobacterium phage Banjo, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
421. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH651186 (Mycobacterium phage Podrick, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
422. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG962362 (Mycobacterium phage AltPhacts, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
423. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF704103 (Mycobacterium phage Vortex, complete sequence) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
424. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to FJ174694 (Mycobacterium phage Chah, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
425. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH051264 (Mycobacterium phage Cobra, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
426. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112536 (Mycobacterium phage Cannibal, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
427. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX578071 (Mycobacterium phage Mana, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
428. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919539 (Mycobacterium phage Virapocalypse, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
429. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KC661274 (Mycobacterium phage SDcharge11, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
430. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ194579 (Mycobacterium phage Swish, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
431. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH371114 (Mycobacterium phage Childish, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
432. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279910 (Mycobacterium phage Antonia, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
433. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279852 (Mycobacterium phage Fringe, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
434. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX576643 (Mycobacterium phage FriarPreacher, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
435. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KY385382 (Mycobacterium phage ImtiyazSitla, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
436. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN699010 (Mycobacterium phage TallGrassMM, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
437. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG757159 (Mycobacterium phage JangoPhett, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
438. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279891 (Mycobacterium phage Wallhey, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
439. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919503 (Mycobacterium phage Dingo, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
440. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KY676783 (Mycobacterium phage Chorkpop, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
441. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112527 (Mycobacterium phage Altwerkus, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
442. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JX649100 (Mycobacterium phage Alex, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
443. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_028691 (Mycobacterium phage Apizium, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
444. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH371125 (Mycobacterium phage Morty, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
445. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF937109 (Mycobacterium phage Yoshand, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
446. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279878 (Mycobacterium phage Samaymay, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
447. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH399786 (Mycobacterium phage PhrodoBaggins, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
448. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112551 (Mycobacterium phage Riggan, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
449. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN945903 (Mycobacterium phage Jiminy, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
450. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KM363597 (Mycobacteriophage Zonia, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
451. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KR816508 (Mycobacterium phage Phamished, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
452. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF937095 (Mycobacterium phage Harvey, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
453. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KF713485 (Mycobacterium phage Suffolk, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
454. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG770212 (Mycobacterium phage Haimas, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
455. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279861 (Mycobacterium phage Legolas, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
456. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279843 (Mycobacterium phage CamL, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
457. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279890 (Mycobacterium phage Veritas, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
458. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279846 (Mycobacterium phage Cosmolli16, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
459. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KM408320 (Mycobacterium phage Lasso, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
460. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KR029086 (Mycobacterium phage PDRPv, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
461. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KY385380 (Mycobacterium phage Ashraf, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
462. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH825705 (Mycobacterium phage Mesh1, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
463. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279864 (Mycobacterium phage Mag7, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
464. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT952849 (Mycobacterium phage Windsor, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
465. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH576954 (Mycobacterium phage HSavage, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
466. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112555 (Mycobacterium phage Zelda, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
467. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_028803 (Mycobacterium phage OSmaximus, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
468. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279904 (Mycobacterium phage RedMaple, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
469. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KR029087 (Mycobacterium phage PDRPxv, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
470. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN699009 (Mycobacterium phage ThreeOh3D2, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
471. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_005259 (Mycobacterium phage PG1, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
472. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH155874 (Mycobacterium phage PhrankReynolds, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
473. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112552 (Mycobacterium phage Spartan300, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
474. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX702319 (Mycobacterium phage Pinkman, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
475. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919523 (Mycobacterium phage Mikota, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
476. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KU867907 (Mycobacterium phage Potter, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
477. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH590588 (Mycobacterium phage Vaticameos, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
478. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279885 (Mycobacterium phage Surely, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
479. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279870 (Mycobacterium phage Omniscient, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
480. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN638752 (Mycobacterium phage Murdoc, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
481. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KT599441 (Mycobacterium phage Squid, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
482. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG925346 (Mycobacterium phage LeeLot, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
483. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG962375 (Mycobacterium phage ProfessorX, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
484. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG925348 (Mycobacterium phage Megatron, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
485. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH077582 (Mycobacterium phage Olive, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
486. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF155947 (Mycobacterium phage LemonSlice, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
487. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KP027209 (Mycobacterium phage Sigman, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
488. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH450122 (Mycobacterium phage KingTut, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
489. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279859 (Mycobacterium phage Kwadwo, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
490. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112546 (Mycobacterium phage LuckyMarjie, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
491. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX620786 (Mycobacterium phage Lego3393, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
492. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112544 (Mycobacterium phage Keitherie, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
493. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KP027197 (Mycobacterium phage FluffyNinja, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
494. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH651177 (Mycobacterium phage KlimbOn, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
495. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279877 (Mycobacterium phage Roscoe, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
496. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH576958 (Mycobacterium phage MichaelPhcott, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
497. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN698989 (Mycobacterium phage JacAttac, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
498. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH479918 (Mycobacterium phage Labeouficaum, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
499. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112553 (Mycobacterium Phage Squiggle, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
500. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_028907 (Mycobacterium phage Kikipoo, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
501. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279850 (Mycobacterium phage Durga, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
502. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK524526 (Mycobacterium phage Robyn, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
503. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279897 (Mycobacterium phage Bishoperium, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
504. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN585965 (Mycobacterium phage Duggie, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
505. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH316568 (Mycobacterium phage Phleuron, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
506. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT310868 (Mycobacterium phage Telesworld, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
507. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279865 (Mycobacterium phage Mecca, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
508. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KC576784 (Mycobacterium phage ShiVal, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
509. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ595576 (Mycobacterium phage Manad, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
510. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH479916 (Mycobacterium phage GeneCoco, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
511. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN444868 (Mycobacterium phage Prickles, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
512. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KY385383 (Mycobacterium phage Maskar, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
513. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH371117 (Mycobacterium phage Kahve, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
514. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH399773 (Mycobacterium phage Craff, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
515. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to GU247133 (Mycobacterium phage Fang, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
516. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX683292 (Mycobacterium phage Held, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
517. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_008197 (Mycobacterium phage Orion, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
518. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH479921 (Mycobacterium phage Placalicious, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
519. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT897901 (Mycobacterium phage Adriana, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
520. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN369744 (Mycobacterium phage Beaglebox, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
521. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KT364588 (Mycobacterium phage Hetaeria, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
522. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919530 (Mycobacterium phage Sheila, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
523. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG925356 (Mycobacterium phage OliverWalter, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
524. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JX649098 (Mycobacterium phage Nacho, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
525. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH926060 (Mycobacterium phage Schadenfreude, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
526. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT889369 (Mycobacterium phage Inchworm, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
527. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KP027208 (Mycobacterium phage Pipsqueak, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
528. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919519 (Mycobacterium phage Longacauda, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
529. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF704109 (Mycobacterium phage Oosterbaan, complete sequence) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
530. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX369585 (Mycobacterium phage PhatCats2014, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
531. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK310139 (Mycobacterium phage Emiris, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
532. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH576967 (Mycobacterium phage UAch1, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
533. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ194580 (Mycobacterium phage Badfish, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
534. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KX576647 (Mycobacterium phage CharlieGBrown, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
535. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN369738 (Mycobacterium phage Hocus, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
536. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279889 (Mycobacterium phage Valjean, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
537. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH399775 (Mycobacterium phage Gareth, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
538. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279894 (Mycobacterium phage YouGoGlencoco, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
539. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279895 (Mycobacterium phage Zaider, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
540. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MN585967 (Mycobacterium phage Kloppinator, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
541. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to GQ303259 (Mycobacterium phage Colbert, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
542. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK279858 (Mycobacterium phage JakeO, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
543. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_028681 (Mycobacterium phage Pops, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
544. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH744417 (Mycobacterium phage Grand2040, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
545. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JX649097 (Mycobacterium phage Piglet, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
546. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG925350 (Mycobacterium phage Mosaic, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
547. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH479914 (Mycobacterium phage FugateOSU, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
548. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH825702 (Mycobacterium phage Hamish, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
549. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF704091 (Mycobacterium phage ABU, complete sequence) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
550. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919528 (Mycobacterium phage Phunky, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
551. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_028690 (Mycobacterium phage Eremos, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
552. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MG962363 (Mycobacterium phage BatteryCK, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
553. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ538723 (Mycobacterium phage KingVeVeVe, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
554. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JN192463 (Mycobacterium phage Oline, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
555. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NC_021310 (Mycobacterium phage Newman, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
556. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MK112542 (Mycobacterium phage Jillium, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
557. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MT310867 (Mycobacterium phage Chaelin, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
558. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ194583 (Mycobacterium phage Numberten, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
559. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH590594 (Mycobacterium phage PinheadLarry, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
560. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to KJ174157 (Mycobacterium phage Soto, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
561. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH399780 (Mycobacterium phage Mutante, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
562. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to JF704099 (Mycobacterium phage KLucky39, complete sequence) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
563. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MH779516 (Mycobacterium phage Waterdiva, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
564. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to MF919507 (Mycobacterium phage Horchata, complete genome) position: , mismatch: 9, identity: 0.719
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
atgccgccgccctggccgggccagttggtgac Protospacer
* .** *** **************** .*.
565. spacer 1.12|64401|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
ttggtgaccttgctcttgtcgatgtggccgta CRISPR spacer
tccatgaccttggtctggtcgatgtggaaggt Protospacer
*. .******** *** ********** *
566. spacer 1.15|64584|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
atgaacgcggcgagcgcgtacaagctccggta CRISPR spacer
acggacgcggcgagcgcggacgagctcaaccg Protospacer
*.*.************** **.***** . ..
567. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP045036 (Lactobacillus mali strain LM596 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgaccaaccccgccgtgcccatcacccg Protospacer
********* ** **********. *.. .*
568. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.719
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgaccaaccccgccgtgcccatcacccg Protospacer
********* ** **********. *.. .*
569. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.719
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgaccaaccccgccgtgcccatcacccg Protospacer
********* ** **********. *.. .*
570. spacer 1.19|64828|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccctcgctacctccgaagctccagcggcatc CRISPR spacer
ctcaccactacctccgaagccccaacggcacg Protospacer
.* .*.*************.***.*****.
571. spacer 1.21|64950|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gacaccgggatggtgcgctccttgtagtagtc CRISPR spacer
cacagcgggatgctgcgctccttgcggccctt Protospacer
*** ******* ***********..*. *.
572. spacer 1.23|65072|32|CP034929|CRISPRCasFinder,CRT matches to CP000621 (Burkholderia vietnamiensis G4 plasmid pBVIE05, complete sequence) position: , mismatch: 9, identity: 0.719
cgtccacggtcgtttcctgagcgtgaacgggc CRISPR spacer
tgacgacggtcgtttcgtgcgcgtgaacatca Protospacer
.* * *********** ** ********.
573. spacer 1.25|65194|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cacttcgatcacgtccacgtctcctttaagcc CRISPR spacer
catttcgatcacgtccacgtcaccaccatcgg Protospacer
**.****************** ** ..*
574. spacer 1.25|65194|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015237 (Rhodococcus fascians D188 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cacttcgatcacgtccacgtctcctttaagcc CRISPR spacer
catttcgatcacgtccacgtcaccaccatcgg Protospacer
**.****************** ** ..*
575. spacer 1.25|65194|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009113 (Rhodococcus opacus strain 1CP plasmid pR1CP2, complete sequence) position: , mismatch: 9, identity: 0.719
cacttcgatcacgtccacgtctcctttaagcc CRISPR spacer
cacttcgaccacgtccacgtcaccacctcggg Protospacer
********.************ ** .. *
576. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009292 (Novosphingobium pentaromativorans US6-1 plasmid pLA3, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
gccgcccccatccgcaccgcgtgcctcggtca Protospacer
.** ************** *******. ..
577. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP051739 (Escherichia coli strain SCU-105 plasmid pSCU-105-1, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ttcagccccatccgcaccgagagcctcaacaa Protospacer
.* **************** *****.* .
578. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcgccgactgcctccaagc Protospacer
. ** ********.*********** **
579. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcgccgactgcctccaagc Protospacer
. ** ********.*********** **
580. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcgccgactgcctccaagc Protospacer
. ** ********.*********** **
581. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcgccgactgcctccaagc Protospacer
. ** ********.*********** **
582. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
ggatgagccatccgcgccgactgcctccaagc Protospacer
. ** ********.*********** **
583. spacer 1.34|65743|32|CP034929|CRISPRCasFinder,CRT matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 9, identity: 0.719
acctgccccatccgcaccgactgcctcgaatg CRISPR spacer
gccgcccccatccgcaccgcgtgcctcggtca Protospacer
.** ************** *******. ..
584. spacer 1.38|65987|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
atctcatcacgccggcccagctcgcacgagca CRISPR spacer
aggccatcatgccggcccagcacgcaccggag Protospacer
* .*****.*********** ***** .* .
585. spacer 1.38|65987|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024587 (Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence) position: , mismatch: 9, identity: 0.719
atctcatcacgccggcccagctcgcacgagca CRISPR spacer
aggccatcatgccggcccagcgcgcaccggag Protospacer
* .*****.*********** ***** .* .
586. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
-----gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
cagagg-----tcggcgtcggtggccttgatcgcgtc Protospacer
* ********* **.***********
587. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
acggcgtcggcgtcgatggccttgatcgccgc Protospacer
.* . ********* **.********** *
588. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to KP966108 (Burkholderia phage vB_BceM_AP3, complete genome) position: , mismatch: 9, identity: 0.719
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
agctgctcggcctcgctgaccttcatcgcgtc Protospacer
. .* .***** *********** ******
589. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP019604 (Croceicoccus marinus strain E4A9 plasmid pCME4A9II, complete sequence) position: , mismatch: 9, identity: 0.719
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
ggaatgagggcgtcgatgaccttgatcccggt Protospacer
* * ******* *********** ***
590. spacer 1.41|66170|32|CP034929|CRISPRCasFinder,CRT matches to NC_013193 (Candidatus Accumulibacter phosphatis clade IIA str. UW-1 plasmid pAph01, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccctgcagcatcccagcgccgaggcgccc---- CRISPR spacer
gcgcccttcagcatcccagagcca----gcttcgat Protospacer
******* *********** ***. **..
591. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 9, identity: 0.719
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
atgcccgccgacgccccggtcacgacgatccg Protospacer
* *******. **************. . *
592. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP032676 (Rhodococcus rhodochrous strain ATCC BAA870 plasmid pNit, complete sequence) position: , mismatch: 9, identity: 0.719
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
agtatcgccaccgccccggcgacgatccacca Protospacer
*. .**************. ******* *
593. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
gtctacgccaccgcgccgctcacgatcctggt Protospacer
. . ********* *** *********.* *
594. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
gtctacgccaccgcgccgctcacgatcctggt Protospacer
. . ********* *** *********.* *
595. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 9, identity: 0.719
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
ctggcccccaccgcgccggtcacgatcgaaca Protospacer
* ** ******* ************ .*
596. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP041157 (Leisingera aquaemixtae strain R2C4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
aaaacctccggctcgatccgtgccaacatgat Protospacer
. .*******************. ****.
597. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
598. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
599. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
600. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
601. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
602. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
603. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
604. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
605. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
606. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
607. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
608. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
609. spacer 1.44|66353|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggcagcctcaagcgatacctc-tgcac CRISPR spacer
agcgacggcagcctcagccgatacctcttgcg- Protospacer
***********. ********* ***.
610. spacer 1.48|66597|32|CP034929|CRISPRCasFinder,CRT matches to AP018486 (Mycobacterium phage PP DNA, complete genome) position: , mismatch: 9, identity: 0.719
ctggacaagatcgccggcgtcccgtcggccat CRISPR spacer
gggagctcgatcgctggcgtgccgtcggccag Protospacer
*..* ******.***** **********
611. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP045036 (Lactobacillus mali strain LM596 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgaccaaccccgccgtgcccatcacccg Protospacer
********* ** **********. *.. .*
612. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018177 (Lactobacillus hordei strain TMW 1.1822 plasmid pL11822-1, complete sequence) position: , mismatch: 9, identity: 0.719
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgaccaaccccgccgtgcccatcacccg Protospacer
********* ** **********. *.. .*
613. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP018181 (Lactobacillus nagelii strain TMW 1.1827 plasmid pL11827-1, complete sequence) position: , mismatch: 9, identity: 0.719
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
cccatgaccaaccccgccgtgcccatcacccg Protospacer
********* ** **********. *.. .*
614. spacer 1.50|66719|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR594663 (Variovorax sp. RA8 plasmid 2) position: , mismatch: 9, identity: 0.719
aggtgcccctggccgtcgatgggctggaagag CRISPR spacer
tcatgcccctggccatcgatgcgctgagcgtg Protospacer
.***********.****** ****.. * *
615. spacer 1.50|66719|32|CP034929|CRISPRCasFinder,CRT matches to KJ028219 (Mycobacterium phage 32HC, complete genome) position: , mismatch: 9, identity: 0.719
aggtgcccctggccgtcgatgggctggaagag CRISPR spacer
ggctgcccctggccggcgatcggctgctcggc Protospacer
.* ************ **** ***** *.
616. spacer 1.51|66780|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP031116 (Rubrobacter indicoceani strain SCSIO 08198 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cacaccccggagcagaaccccctccccgcctc CRISPR spacer
gccgaccccgagcagaacccccgccccgcaca Protospacer
*. *** ************* ****** .
617. spacer 1.51|66780|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 9, identity: 0.719
cacaccccggagcagaaccccctccccgcctc CRISPR spacer
tcctgaccggcgcagaaccccctgcccgcgcc Protospacer
. * **** ************ ***** .*
618. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP049158 (Caballeronia sp. SBC1 plasmid pSBC1_2, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gaaagattcgcccgcgtcaccgcggcctcccc Protospacer
* ************.******* ***
619. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP049318 (Caballeronia sp. SBC2 plasmid pSBC2-2, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gaaagattcgcccgcgtcaccgcggcctcccc Protospacer
* ************.******* ***
620. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tgcagcgacgcccgcgtcatcgcgtccactgc Protospacer
* ** **************** ****.
621. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tgcagcgacgcccgcgtcatcgcgtccactgc Protospacer
* ** **************** ****.
622. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
cgcaccgtcgcccccgccatcgcggcccagtg Protospacer
* ********* **.********** .*
623. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
cgcaccgtcgcccccgccatcgcggcccagtg Protospacer
* ********* **.********** .*
624. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP046573 (Rhodococcus sp. WAY2 plasmid pRWAY01, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gagtccgtcgcccgcgtcgtcgaggccggata Protospacer
* ***************.*** ****. ..
625. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022264 (Xanthomonas citri pv. vignicola strain CFBP7111 plasmid plA, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgtgtgatcgcggccaacga Protospacer
* .*********.** ********** * .
626. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to CP022268 (Xanthomonas citri pv. vignicola strain CFBP7112 plasmid plA, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgtgtgatcgcggccaacga Protospacer
* .*********.** ********** * .
627. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023161 (Xanthomonas citri pv. malvacearum strain MS14003 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgtgtgatcgcggccaacga Protospacer
* .*********.** ********** * .
628. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017022 (Xanthomonas citri pv. malvacearum strain MSCT plasmid pMSCT44kb, complete sequence) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tacgtcgtcgcccgtgtgatcgcggccaacga Protospacer
* .*********.** ********** * .
629. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to KY676784 (Streptomyces phage ToastyFinz, complete genome) position: , mismatch: 9, identity: 0.719
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
gccgccgtcgcccgcgtcgtcgccctggtcgg Protospacer
*** **************.**** . ..* *
630. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cgagcgacgacgcgctcagcgacatcgtcggg Protospacer
. *************. ******** **
631. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to MH051258 (Mycobacterium phage SamScheppers, complete genome) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
tgcgcgacgccgtgctcgtcgacatcgtcctg Protospacer
* * ***** **.**************
632. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013104 (Paraburkholderia caribensis strain MWAP64 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cgctcgacgacgtgctcgacgacatcacgctt Protospacer
. **********.***** *******. * .
633. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
tcctggacgtcgcgctcgtcgacccgcagctg Protospacer
**** **** ************* . **
634. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agggtgacgacgagcacgtcgacatcgagttc Protospacer
.******* ** ************* *
635. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012748 (Paraburkholderia caribensis MBA4 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
cgctcgacgacgtgctcgacgacatcacgctt Protospacer
. **********.***** *******. * .
636. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_007961 (Nitrobacter hamburgensis X14 plasmid 3, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
aaatcgacgacgcgcacgtcgagatcgtcttc Protospacer
************ ****** **** *
637. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP020333 (Martelella mediterranea DSM 17316 strain MACL11 plasmid pMM170, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
atcgcgaggacgcgctcatcgacatcgaactg Protospacer
.* *** *********.**********.
638. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023068 (Ensifer sojae CCBAU 05684 plasmid pSJ05684b, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ccaaggccgatgcgctcggcgacatcgaggcg Protospacer
.* * ***.******* ***********
639. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_016626 (Burkholderia sp. YI23 plasmid byi_1p, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ccgacgacgacgcgctcgtcgataccgccgcg Protospacer
.* ******************.*.** *
640. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to MH045559 (Microbacterium phage Etna, complete genome) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agatctacgacgcgctcatcgacatcctgtac Protospacer
** ***********.******** * .*
641. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ggctcgacgccgcgatcgtcgacatggccgag Protospacer
******* **** ********** * *.
642. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
gcctcgacgacgcgctggtcggcaaggcagag Protospacer
*************** ****.** * .*.
643. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
agaccaacgacgcgctcgtcaacgtcgagcgg Protospacer
.*.**************.**.***** *
644. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ccgacgacgacgcgctcgtcgataccgccgcg Protospacer
.* ******************.*.** *
645. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 9, identity: 0.719
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
ggctcgacgccgcgatcgtcgacatggccgag Protospacer
******* **** ********** * *.
646. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
cgccacgatgtcgcgggtatcgggatggcgct Protospacer
. . *****************.*** ***..
647. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042482 (Klebsiella pneumoniae strain C51 plasmid pC51_001, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgcgggtgtggatgaagccaa Protospacer
******************.* ** . **
648. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG917973 (Mycobacterium marinum E11 plasmid pRAW, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgtcgatgtcgccggtatcgatgatgaggt Protospacer
****.********* ******** . .* * .
649. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP031582 (Klebsiella pneumoniae strain N4b plasmid pIncHI1B-1502320, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgcgggtgtggatgaagccaa Protospacer
******************.* ** . **
650. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028549 (Klebsiella variicola strain WCHKP19 plasmid p1_020019, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgcgggtgtggatgaagccaa Protospacer
******************.* ** . **
651. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018497 (Mycobacterium marinum strain ATCC 927 plasmid pMMRN, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgtcgatgtcgccggtatcgatgatgaggt Protospacer
****.********* ******** . .* * .
652. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
ctggacgatgtcgcgggtttcgggatcgatcg Protospacer
.* * ************* ***.***** .
653. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032915 (Enterobacter roggenkampii strain ECY546 plasmid pY546, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgcgggtgtggatgaagccaa Protospacer
******************.* ** . **
654. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP052373 (Klebsiella pneumoniae strain D16KP0042 plasmid pD16KP0042-1, complete sequence) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgcgggtgtggatgaagccaa Protospacer
******************.* ** . **
655. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033758 (Klebsiella pneumoniae strain FDAARGOS_566 plasmid unnamed2) position: , mismatch: 9, identity: 0.719
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
tttgccgatgtcgcgggtgtggatgaagccaa Protospacer
******************.* ** . **
656. spacer 1.58|67207|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP053858 (Rhizobium pusense strain 76 plasmid pR76, complete sequence) position: , mismatch: 9, identity: 0.719
catgcgcgacgaaccctggacgcggcgcttct CRISPR spacer
ggtgatcgacgaaccctggacgggacgctgta Protospacer
.** **************** *.**** .
657. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gcggccgcctcccgcgcccaggcagaggcgtc Protospacer
.***** * **************** * .
658. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gacgccgacgcccgcgccccggccgacgccga Protospacer
**************** *** **.* * .
659. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gcagacgacgcccgcggccaggccgatgccga Protospacer
..* *********** ****** **** * .
660. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
gcagacgacgcccgcggccaggccgatgccga Protospacer
..* *********** ****** **** * .
661. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctggccgaagcccgcgccgaggcgatgggctc Protospacer
******** ********* ****.. *.*.
662. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctcgccgacgcccgcgaccaggcccgcacacg Protospacer
** ************* ****** ... **
663. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
accgccgccgcccgcgcccaggccgacgccgc Protospacer
. **** *************** **.* *
664. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MN693475 (Marine virus AFVG_25M183, complete genome) position: , mismatch: 9, identity: 0.719
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
atcggcgacgccggcgcccaggccgatgctgt Protospacer
* * ******* ********** **** .
665. spacer 1.62|67451|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to KR063280 (Gordonia phage GMA6, complete genome) position: , mismatch: 9, identity: 0.719
gcgtccgcgtctgacacgtcggggtgccagtg CRISPR spacer
ttctctgcgtcggacacgtcggggtggacgag Protospacer
. **.***** ************** * *
666. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049245 (Rhizobium pseudoryzae strain DSM 19479 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
ctggacacgatcgccgccgtcctgccaatgga Protospacer
******* ******** *******.*... .
667. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 9, identity: 0.719
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
caagtgaagatccacggcgtcctgtcggctcc Protospacer
* .* ****** ***************. .
668. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045662 (Klebsiella pneumoniae strain SMU18037509 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
caacaaaagatcgccgccgtcctgtccgctgc Protospacer
* . * ********** ********* **...
669. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013109 (Sinorhizobium americanum strain CFNEI 73 plasmid B, complete sequence) position: , mismatch: 9, identity: 0.719
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
tcgatgcagatcgccggcatcctctcggccgt Protospacer
..*. ***********.**** ******.*
670. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034811 (Paracoccus sp. Arc7-R13 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
ctggacaagatcgcccgcgccctcaaggatga Protospacer
*************** ***.*** ** ..
671. spacer 1.68|67817|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010016 (Burkholderia thailandensis 34 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
aatctgaccggtttcgcgatgcccaagcaggt CRISPR spacer
gtcatcaccgatttcgcgatgcccgagcagcc Protospacer
. . * ****.*************.***** .
672. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
gtcgatgcgaccagcggcaagctcaagggcct Protospacer
. * .*************** ** *****
673. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
cgtgccgcgaccagcggcgaggtgcaggacct Protospacer
. *.*************.**** ****.*
674. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
cgtgccgcgaccagcggcgaggtgcaggacct Protospacer
. *.*************.**** ****.*
675. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005085 (Sphingobium sp. TKS plasmid pTK1, complete sequence) position: , mismatch: 9, identity: 0.719
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
cgtgccgcgaccagcggcgaggtgcaggacct Protospacer
. *.*************.**** ****.*
676. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_015583 (Novosphingobium sp. PP1Y plasmid Mpl, complete sequence) position: , mismatch: 9, identity: 0.719
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
tcgaccacgagttcggccgcggtgatgtagct Protospacer
* .. .*********** *.**********
677. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP017627 (Pleomorphomonas sp. SM30 plasmid pSM30-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
atggcggcgagttcggcgtcggtgatgtgcgg Protospacer
*.************ **.*******. *
678. spacer 1.70|67939|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010865 (Marinovum algicola DG 898 plasmid pMaD10, complete sequence) position: , mismatch: 9, identity: 0.719
tgtgtggcgagttcggcctcagtgatgtagcg CRISPR spacer
acggcggcgagatcggcctcggtgatgtcctg Protospacer
*.****** ********.******* .*
679. spacer 1.71|68000|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049322 (Caballeronia sp. SBC2 plasmid pSBC2-6, complete sequence) position: , mismatch: 9, identity: 0.719
tgtcgtgcggctttgcggtcgctgatggcact CRISPR spacer
atgcgcgcggctttgcgttcgctgatttcatg Protospacer
**.*********** ******** **.
680. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 9, identity: 0.719
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gagcttgtcgttgggcacgccaaggcggcggg Protospacer
** . .****.*********** ******
681. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_015169 (Deinococcus proteolyticus MRP plasmid pDEIPR01, complete sequence) position: , mismatch: 9, identity: 0.719
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
gaatgcggcgtccagatggggaatggaaggtc Protospacer
**** ************* ****. ..*..*.
682. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX539265 (Vibrio parahaemolyticus strain VPS72 plasmid pVPS72-VEB, complete sequence) position: , mismatch: 9, identity: 0.719
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
ctgagtgtgcagcacctcgtcacggtcgcggg Protospacer
*. .****** ***********.*****.
683. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX575838 (Vibrio alginolyticus strain VAS24 plasmid pVAS24-VEB, complete sequence) position: , mismatch: 9, identity: 0.719
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
ctgagtgtgcagcacctcgtcacggtcgcggg Protospacer
*. .****** ***********.*****.
684. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_005312 (Actinobacillus pleuropneumoniae plasmid pMS260, complete sequence) position: , mismatch: 9, identity: 0.719
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
ctgagtgtgcagcacctcgtcacggtcgcggg Protospacer
*. .****** ***********.*****.
685. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040763 (Paracoccus sp. 2251 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
gaggccgtgcagaacctggtcaccgccgtcga Protospacer
************.**** ***** ..**. .
686. spacer 1.79|68488|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 9, identity: 0.719
gaggccgtgcaggacctcgtcacgatcgcgat CRISPR spacer
ggcatccggccggacctcatcacgatcgcgaa Protospacer
*. ..* ** *******.************
687. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_010070 (Burkholderia multivorans ATCC 17616 plasmid pBMUL01, complete sequence) position: , mismatch: 9, identity: 0.719
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagaacgtcggcgaggtaattgc Protospacer
************* ******** * *.. .
688. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagaccatcggcgagacggtgga Protospacer
************** .******* . .*.*
689. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagaacgtcggcgaggtaattgc Protospacer
************* ******** * *.. .
690. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_010802 (Burkholderia multivorans ATCC 17616 plasmid pTGL1, complete sequence) position: , mismatch: 9, identity: 0.719
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
gtgggcggcgagaacgtcggcgaggtaattgc Protospacer
************* ******** * *.. .
691. spacer 1.81|68610|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015420 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atggcgaaggtctggaaccggcggcggttccg CRISPR spacer
agatggaggatctggaaccggcggcggtggcc Protospacer
* . **.*.****************** *
692. spacer 1.83|68732|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594660 (Variovorax sp. PBL-H6 plasmid 2) position: , mismatch: 9, identity: 0.719
aagacgctggccgacgaggaagcctcccagct CRISPR spacer
ggatagctcgccgacgaggaagccacccagac Protospacer
... *** *************** ***** .
693. spacer 1.83|68732|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594667 (Variovorax sp. SRS16 plasmid 2) position: , mismatch: 9, identity: 0.719
aagacgctggccgacgaggaagcctcccagct CRISPR spacer
ggatagctcgccgacgaggaagccacccagac Protospacer
... *** *************** ***** .
694. spacer 1.83|68732|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594690 (Variovorax sp. WDL1 plasmid 2) position: , mismatch: 9, identity: 0.719
aagacgctggccgacgaggaagcctcccagct CRISPR spacer
ggatagctcgccgacgaggaagccacccagac Protospacer
... *** *************** ***** .
695. spacer 1.83|68732|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594672 (Variovorax sp. PBL-E5 plasmid 2) position: , mismatch: 9, identity: 0.719
aagacgctggccgacgaggaagcctcccagct CRISPR spacer
ggatagctcgccgacgaggaagccacccagac Protospacer
... *** *************** ***** .
696. spacer 1.86|68915|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035710 (Sphaerotilus natans subsp. sulfidivorans strain D-507 plasmid pSna507_unt10, complete sequence) position: , mismatch: 9, identity: 0.719
gcaaggaccgccggtcctccacccgactcacc CRISPR spacer
tcaaggcccgccggtcgtccacccgcggcctg Protospacer
***** ********* ******** * .
697. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
cggccgggagcctggacggcctcacgtaccgg Protospacer
. *** *** *************** **
698. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 9, identity: 0.719
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
cccccctgcgggtcgccgccgcgctgatggcg Protospacer
. *****************.** *** *
699. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010658 (Phaeobacter piscinae strain P71 plasmid pP71_b, complete sequence) position: , mismatch: 9, identity: 0.719
tgcccctgcgggtcgccgctgccc---tgttccat CRISPR spacer
cgcccctgcggatcgccgccgcccgcaagacc--- Protospacer
.**********.*******.**** * .*
700. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP010769 (Phaeobacter piscinae strain P13 plasmid pP13_b, complete sequence) position: , mismatch: 9, identity: 0.719
tgcccctgcgggtcgccgctgccc---tgttccat CRISPR spacer
cgcccctgcggatcgccgccgcccgcaagacc--- Protospacer
.**********.*******.**** * .*
701. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgcgacggctgtgtctgtggccgcgaagca CRISPR spacer
ccagcgacgactgtgtttgtggccgcagggaa Protospacer
.. ******.******.*********...* *
702. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP029452 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509b, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgcgacggctgtgtctgtggccgcgaagca CRISPR spacer
ccagcgacgactgtgtctgtgcccgcagggaa Protospacer
.. ******.*********** ****...* *
703. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgcgacggctgtgtctgtggccgcgaagca CRISPR spacer
ccagcgacgactgcgtctgtggccgcagggaa Protospacer
.. ******.***.************...* *
704. spacer 1.93|69342|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719
ttcgcgacggctgtgtctgtggccgcgaagca CRISPR spacer
ccagcgacgactgcgtctgtggccgcagggaa Protospacer
.. ******.***.************...* *
705. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to NC_016624 (Azospirillum lipoferum 4B plasmid AZO_p5, complete sequence) position: , mismatch: 10, identity: 0.688
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
tcgggggcgacggcctcgccggttgccagctc Protospacer
.******************** ** . .
706. spacer 1.5|63974|32|CP034929|CRISPRCasFinder,CRT matches to MK801724 (Gordonia phage PhrostedPhlake, complete genome) position: , mismatch: 10, identity: 0.688
atgggggcgacggcctcgccggatgaggcggt CRISPR spacer
gagatctcgaccgccacgccggatgaggcgac Protospacer
. *. **** *** **************..
707. spacer 1.7|64096|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.688
agttcgacgcgctggccgggccagttgtcgga CRISPR spacer
tcgtcgacgcactggccgagccagttttgccc Protospacer
*******.*******.******* *
708. spacer 1.12|64401|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP016820 (Rhodococcus sp. p52 plasmid pDF02, complete sequence) position: , mismatch: 10, identity: 0.688
ttggtgaccttgctcttgtcgatgtggccgta CRISPR spacer
gacgctgtcttgctcgtgtcgatgtgggcgtc Protospacer
*. ..******* *********** ***
709. spacer 1.15|64584|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688
atgaacgcggcgagcgcgtacaagctccggta CRISPR spacer
gagaacgcagcgaacgcgtacaagccgatttc Protospacer
. ******.****.***********. *
710. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 10, identity: 0.688
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
tgggtctccaccggcgccgtgaccggcgtgca Protospacer
.* ***** ******** ********..
711. spacer 1.18|64767|32|CP034929|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
acgcgcgccatccgcgccatgcccggcgtggc Protospacer
.* .***.*******.***********
712. spacer 1.24|65133|32|CP034929|CRISPRCasFinder,CRT matches to MF344569 (Pseudomonas aeruginosa plasmid p12939-PER, complete sequence) position: , mismatch: 10, identity: 0.688
agactgaagcgcttctcgccacccgtgagtcc CRISPR spacer
gccgtgaagcgctgctcgccgcccgtgaccaa Protospacer
. ********* ******.******* .
713. spacer 1.29|65438|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 10, identity: 0.688
cagacgggggacgtcgccgccaccgaagatgg CRISPR spacer
gagacggcggacgtcgccgccgcccgcccggc Protospacer
****** *************.** . *
714. spacer 1.29|65438|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 10, identity: 0.688
cagacgggggacgtcgccgccaccgaagatgg CRISPR spacer
gtagccctcgacgtcgccgccaccgccgatgg Protospacer
..* **************** *****
715. spacer 1.29|65438|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007797 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p4, complete sequence) position: , mismatch: 10, identity: 0.688
cagacgggggacgtcgccgccaccgaagatgg CRISPR spacer
gagacggcggacgtcgccgccgcccgccccgc Protospacer
****** *************.** . .*
716. spacer 1.29|65438|32|CP034929|CRISPRCasFinder,CRT matches to NC_011987 (Agrobacterium radiobacter K84 plasmid pAtK84c, complete sequence) position: , mismatch: 10, identity: 0.688
cagacgggggacgtcgccgccaccgaagatgg CRISPR spacer
cagacggaggacggcgccgccacttaccgaca Protospacer
*******.***** *********. * . .
717. spacer 1.29|65438|32|CP034929|CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 10, identity: 0.688
cagacgggggacgtcgccgccaccgaagatgg CRISPR spacer
gcgacgggcgacgccgccgccaccgtcagcgt Protospacer
****** ****.*********** ...*
718. spacer 1.38|65987|32|CP034929|CRISPRCasFinder,CRT matches to NC_008269 (Rhodococcus jostii RHA1 plasmid pRHL1, complete sequence) position: , mismatch: 10, identity: 0.688
atctcatcacgccggcccagctcgcacgagca CRISPR spacer
tgatcatcacgccggcctcgctcgcactgtag Protospacer
**************. ******** . .
719. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to NC_031922 (Synechococcus phage S-CAM9 isolate 1109NB16, complete genome) position: , mismatch: 10, identity: 0.688
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
tcaacagcggcgtcgatgaccttgattgcgag Protospacer
* . ******** **********.***..
720. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to MH629685 (Synechococcus virus S-PRM1, complete genome) position: , mismatch: 10, identity: 0.688
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
tcaacagcggcgtcgatgaccttgattgcgag Protospacer
* . ******** **********.***..
721. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to KU686204 (Synechococcus phage S-CAM9 isolate 0808SB05, complete genome) position: , mismatch: 10, identity: 0.688
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
tcaacagcggcgtcgatgaccttgattgcgag Protospacer
* . ******** **********.***..
722. spacer 1.40|66109|32|CP034929|CRISPRCasFinder,CRT matches to KU686205 (Synechococcus phage S-CAM9 isolate 0908SB82, complete genome) position: , mismatch: 10, identity: 0.688
gctttttcggcgtcgctgaccttgatcgcgga CRISPR spacer
tcaacagcggcgtcgatgaccttgattgcgag Protospacer
* . ******** **********.***..
723. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP022369 (Azospirillum sp. TSH58 plasmid TSH58_p05, complete sequence) position: , mismatch: 10, identity: 0.688
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
tgatccgccaccgccccggtcagtatctgacc Protospacer
...****************** ***. .*.
724. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 10, identity: 0.688
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
tgatccgccaccgccccggtcagtatctgacc Protospacer
...****************** ***. .*.
725. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 10, identity: 0.688
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
ttcgtcgccagcgccccggtcacgacccggtc Protospacer
.***** **************.** *..
726. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012918 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p4, complete sequence) position: , mismatch: 10, identity: 0.688
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
tgatccgccaccgccccggtcagtatctgacc Protospacer
...****************** ***. .*.
727. spacer 1.42|66231|32|CP034929|CRISPRCasFinder,CRT matches to NC_021347 (Rhodococcus phage E3, complete genome) position: , mismatch: 10, identity: 0.688
aagcccgccaccgccccggtcacgatcccgct CRISPR spacer
tcgcccgccaccgtctcggtcacgacctgtgg Protospacer
***********.*.*********.*.
728. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013597 (Rhizobium sp. N741 plasmid pRspN741b, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
729. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013501 (Rhizobium esperanzae strain N561 plasmid pRspN561a, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
730. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013507 (Rhizobium sp. N1341 plasmid pRspN1341b, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
731. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013518 (Rhizobium sp. N113 plasmid pRspN113a, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
732. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013491 (Rhizobium sp. N6212 plasmid pRspN6212a, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
733. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013513 (Rhizobium sp. N1314 plasmid pRspN1314b, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
734. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013496 (Rhizobium sp. N621 plasmid pRspN621a, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
735. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013591 (Rhizobium sp. N871 plasmid pRspN871a, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
736. spacer 1.43|66292|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP013603 (Rhizobium sp. N731 plasmid pRspN731b, complete sequence) position: , mismatch: 10, identity: 0.688
gctttctccggctcgatccgtgccgccatggg CRISPR spacer
tgccgcgccgcctcgatccgtaccgccatgtc Protospacer
.. * *** **********.********
737. spacer 1.48|66597|32|CP034929|CRISPRCasFinder,CRT matches to NC_019410 (Caulobacter phage CcrKarma, complete genome) position: , mismatch: 10, identity: 0.688
ctggacaagatcgccggcgtcccgtcggccat CRISPR spacer
gcctgctcgatcggcggcgtcgcgtcggccag Protospacer
. .* ***** ******* *********
738. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP028348 (Novosphingobium sp. THN1 plasmid pTHN, complete sequence) position: , mismatch: 10, identity: 0.688
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
tgggtctccaccggcgccgtgaccggcgtgca Protospacer
.* ***** ******** ********..
739. spacer 1.49|66658|32|CP034929|CRISPRCasFinder,CRT matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
gccatgaccacccgcgccgtgcccggcgtgtg CRISPR spacer
acgcgcgccatccgcgccatgcccggcgtggc Protospacer
.* .***.*******.***********
740. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 10, identity: 0.688
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
aaatccgtcgccggcgtcagcgcggctggtgg Protospacer
. ********* ****** ******.. . *
741. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 10, identity: 0.688
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
aaatccgtcgccggcgtcagcgcggctggtgg Protospacer
. ********* ****** ******.. . *
742. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP024166 (Salmonella enterica subsp. enterica serovar Gaminara strain CFSAN070644 plasmid pCFSAN024441_01, complete sequence) position: , mismatch: 10, identity: 0.688
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
aaagccgtcgccggcgtcatcgcgggcagtat Protospacer
. ******** ************ ** .
743. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP040720 (Rhodococcus pyridinivorans strain YF3 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
agccggctcgaccgcgccatcgcggccaccac Protospacer
. *. *** *****.*************
744. spacer 1.52|66841|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 10, identity: 0.688
gcctccgtcgcccgcgtcatcgcggccacccg CRISPR spacer
tgtgccgccgcccgcgccatcgcggccgcgtc Protospacer
. ***.********.**********.* .
745. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 10, identity: 0.688
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
gagacgacgccgcgctcgtcgacgtcgaattg Protospacer
***** *************.****.
746. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NC_021289 (Burkholderia insecticola plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
acctcgacggcacgctcgtcgacagtgtttat Protospacer
********.*.************ .* ..
747. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_AP014579 (Burkholderia sp. RPE67 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
atgccgacgacgggctcgtcgtcatcggcgtg Protospacer
. .******** ******** *****. *
748. spacer 1.53|66902|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 10, identity: 0.688
tcctcgacgacgcgctcgtcgacatcgagggc CRISPR spacer
gattggacgacgcgcttgccgacatcgacaag Protospacer
.* ***********.*.********* ..
749. spacer 1.54|66963|32|CP034929|CRISPRCasFinder,CRT matches to NC_019387 (Thermus oshimai JL-2 plasmid pTHEOS01, complete sequence) position: , mismatch: 10, identity: 0.688
ctccaggtcaaggtcaccgcactggatgtcca CRISPR spacer
gtggaggtcaaggtcaccgtcctggattgggg Protospacer
* ***************. ****** .
750. spacer 1.54|66963|32|CP034929|CRISPRCasFinder,CRT matches to MK737942 (Microbacterium phage Sucha, complete genome) position: , mismatch: 10, identity: 0.688
ctccaggtcaaggtcaccgcactggatgtcca CRISPR spacer
ctccaggtcaagggcaccggactctaccggtg Protospacer
************* ***** *** *. ..
751. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016287 (Rhizobium leguminosarum strain Vaf10 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
gatctcgatgtcgcggacatcgagatcgacgg Protospacer
* .***********..**********
752. spacer 1.57|67146|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 10, identity: 0.688
tttgccgatgtcgcgggtatcgagatcgcgtc CRISPR spacer
ggtgccgaaggcgcgggtatcgagagctttga Protospacer
****** * ************** * .
753. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.688
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctggccgatgccggcgcccaggcgatcctgct Protospacer
********.*** **********.. . *
754. spacer 1.60|67329|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 10, identity: 0.688
ctggccgacgcccgcgcccaggcagatgaccg CRISPR spacer
ctggccgatgccggcgcccaggcgatcctgct Protospacer
********.*** **********.. . *
755. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MH045556 (Microbacterium phage BonaeVitae, complete genome) position: , mismatch: 10, identity: 0.688
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
tagctgtcgatcgccggcgtcgtgccggccag Protospacer
. * ************* **.******
756. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MN234191 (Microbacterium phage Naby, complete genome) position: , mismatch: 10, identity: 0.688
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
tagctgtcgatcgccggcgtcgtgccggccag Protospacer
. * ************* **.******
757. spacer 1.65|67634|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016462 (Blastomonas sp. RAC04 plasmid pBSY18_1, complete sequence) position: , mismatch: 10, identity: 0.688
atgaactcgatcccgtgcccaggcttggcgat CRISPR spacer
gacacctcggtctcgtgcccaggcttggttgc Protospacer
. * ****.**.***************. ..
758. spacer 1.65|67634|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009431 (Sphingopyxis macrogoltabida strain 203 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaactcgatcccgtgcccaggcttggcgat CRISPR spacer
gacacctcggtctcgtgcccaggcttggttgc Protospacer
. * ****.**.***************. ..
759. spacer 1.65|67634|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012701 (Sphingopyxis macrogoltabida strain EY-1 isolate activated sludge plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
atgaactcgatcccgtgcccaggcttggcgat CRISPR spacer
gacacctcggtctcgtgcccaggcttggttgc Protospacer
. * ****.**.***************. ..
760. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 10, identity: 0.688
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
gcaagagcgaacagcggccaggtccagggctg Protospacer
. .. **** ******* *********** .
761. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015585 (Roseomonas gilardii strain U14-5 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
cgtgccgcgaccatcggcgaggtccaggatct Protospacer
. *.******** ****.*********..
762. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP021183 (Sphingomonas wittichii DC-6 plasmid pDC02, complete sequence) position: , mismatch: 10, identity: 0.688
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
ctcatgccgaccggcggcaagctccagggcag Protospacer
.* *****.******** ********..
763. spacer 1.69|67878|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MN813693 (Mycobacterium phage Imvubu, complete genome) position: , mismatch: 10, identity: 0.688
aaggtcgcgaccagcggcaaggtccagggcga CRISPR spacer
attaccgcgaccacccgcaaggtccaggcact Protospacer
* ..******** * ************
764. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX683283 (Escherichia coli strain EcU443 plasmid pECSE_01, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
765. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026494 (Escherichia coli strain HS13-1 plasmid pHS13-1-IncF, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
766. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_022651 (Escherichia coli JJ1886 plasmid pJJ1886_5, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
767. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT988018 (Escherichia coli strain V282 plasmid pEcoV282, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
768. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015077 (Escherichia coli strain Ecol_448 plasmid pEC448_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
769. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KP119165 (Escherichia coli strain QT598 plasmid pEC598, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
770. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038792 (Escherichia coli strain PF9285 plasmid pDW54_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
771. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023850 (Escherichia coli strain 4/0 plasmid p4_0.1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
772. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043952 (Escherichia coli strain ST95-32 plasmid pST95-32-2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
773. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030112 (Escherichia coli strain MCJCHV-1 plasmid pNMEC-O75A, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
774. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042600 (Escherichia coli strain NCYU-29-69 plasmid pNCYU-29-69-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
775. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048331 (Escherichia coli strain 10 plasmid p010_A, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
776. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049349 (Escherichia coli strain 3R plasmid p3R-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
777. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KT754164 (Shigella dysenteriae 1 strain 3099-85 plasmid p3099-85, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
778. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP048338 (Escherichia coli strain 142 plasmid p142_A-OXA181, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
779. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP043737 (Escherichia coli strain CVM N17EC0616 plasmid pN17EC0616-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
780. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS999561 (Escherichia coli isolate EC-TO143 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
781. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992182 (Escherichia coli isolate Escherichia coli str. TO124 plasmid 3, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
782. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR130556 (Escherichia coli strain MS14385 isolate MS14385 plasmid 2) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
783. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_013122 (Escherichia coli plasmid pEK499, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
784. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP005931 (Escherichia coli APEC IMT5155 plasmid p1ColV5155, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
785. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP036329 (Klebsiella pneumoniae strain BA28434 plasmid pIncFIA) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
786. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041619 (Shigella flexneri strain C32 plasmid pC32_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
787. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP040922 (Escherichia coli strain FC853_EC plasmid p853EC3, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
788. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013832 (Escherichia coli strain CD306 plasmid pCD306, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
789. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013833 (Escherichia coli strain JJ2434 plasmid pJJ2434_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
790. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027119 (Escherichia coli strain 26561 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
791. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019014 (Escherichia coli strain Ecol_AZ162 plasmid pECAZ162_KPC, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
792. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP037912 (Escherichia coli strain YSP8-1 plasmid pYSP8-1-CTX-M-14, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
793. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_022372 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT3 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
794. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP008715 (Escherichia coli strain ST648 plasmid pEC648_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
795. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022731 (Escherichia coli strain SA186 plasmid pSA186_2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
796. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP042897 (Escherichia coli strain CFSAN061771 plasmid pCFSAN061771_01, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
797. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP051721 (Escherichia coli strain SCU-116 plasmid pSCU-116-2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
798. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033948 (Klebsiella pneumoniae subsp. pneumoniae strain ARLG-3135 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
799. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009860 (Escherichia coli strain ECONIH1 plasmid pECO-824, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
800. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025737 (Salmonella enterica strain FORC_079 plasmid pFORC79_2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
801. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018978 (Escherichia coli strain Ecol_656 plasmid pEC656_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
802. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_019001 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pYT2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
803. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013657 (Escherichia coli strain uk_P46212 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
804. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_014385 (Escherichia coli plasmid pEC_L46, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
805. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_014384 (Escherichia coli plasmid pEC_L8, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
806. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP042972 (Escherichia coli strain CFSAN061769 plasmid pCFSAN061769_03, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
807. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022166 (Escherichia coli strain M160133 plasmid pM160133_p2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
808. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014566 (Salmonella enterica subsp. enterica serovar Typhimurium str. L-3553 plasmid pST3553, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
809. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP018960 (Escherichia coli strain Ecol_422 plasmid pEC422_2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
810. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023384 (Escherichia coli strain 1223 plasmid p147, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
811. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LS992191 (Escherichia coli isolate Escherichia coli str. TO148 plasmid 2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
812. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030791 (Escherichia coli strain APEC O2-211 plasmid pAPEC-O2-211A-ColV, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
813. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023361 (Escherichia coli strain 1943 plasmid p80, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
814. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP022364 (Escherichia coli E309 plasmid pE309_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
815. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP022366 (Escherichia coli E312 plasmid pE312_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
816. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP022368 (Escherichia coli E318 plasmid pE318_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
817. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP022369 (Escherichia coli E319 plasmid pE319_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
818. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG941719 (Escherichia coli O25b:H4-ST131 strain EC958 plasmid pEC958, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
819. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP022363 (Escherichia coli E303 plasmid pE303_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
820. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR740777 (Escherichia coli strain BEN2908 isolate 1 day old chicken plasmid pAPEC2908) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
821. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to AP022361 (Escherichia coli E301 plasmid pE301_IMP6 DNA, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
822. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020113 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1810 plasmid pSTY1-1810, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
823. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041299 (Escherichia coli O1:H42 strain CLSC36 plasmid pCys-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
824. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_006816 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pU302L, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
825. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR740759 (Escherichia coli strain BEN5202 isolate laying hen 51 weeks old plasmid paAPEC5202) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
826. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021937 (Escherichia coli strain AR_0055 plasmid unitig_3j3rc_linear, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
827. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033633 (Escherichia coli isolate ECCNB12-2 plasmid pTB-nb2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
828. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_019109 (Salmonella enterica subsp. enterica serovar Typhimurium plasmid pSal8934b, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
829. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023145 (Escherichia coli strain CFSAN061770 plasmid pEGY3, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
830. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029742 (Escherichia coli strain AR_0085 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
831. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MN335639 (Escherichia coli strain SFE059 plasmid pSFE059, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
832. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP054321 (Escherichia coli strain SCU-390 plasmid pSCU-390-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
833. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050735 (Salmonella enterica subsp. enterica serovar Typhimurium strain ST90 plasmid pST90-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
834. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR130546 (Escherichia coli strain B36 isolate B36 plasmid 2) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
835. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032395 (Salmonella enterica subsp. enterica serovar Dublin strain CVM 22453 plasmid p22453_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
836. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050770 (Salmonella enterica subsp. enterica serovar Indiana strain SI108 plasmid pSI108-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
837. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK649824 (Klebsiella pneumoniae strain BA6201 plasmid pBA6201_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
838. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022651 (Escherichia coli strain 09-02E plasmid p1-09-02E, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
839. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033761 (Escherichia coli strain FDAARGOS_536 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
840. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP054414 (Escherichia coli strain SCU-204 plasmid pSCU-204-1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
841. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295821 (Escherichia coli O25b:H4-ST131 strain B316 plasmid pB316, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
842. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295822 (Escherichia coli O25b:H4-ST131 strain 76 plasmid p76, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
843. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295823 (Escherichia coli O25b:H4-ST131 strain 461 plasmid p461, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
844. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295826 (Escherichia coli O25b:H4-ST131 strain 113 plasmid p113, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
845. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295829 (Escherichia coli O25b:H4-ST131 strain 13.1 plasmid p131, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
846. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295831 (Escherichia coli O25b:H4-ST131 strain 396 plasmid p396, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
847. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295833 (Escherichia coli O25b:H4-ST131 strain 418 plasmid p418, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
848. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049102 (Escherichia coli strain EC28 plasmid p2, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
849. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to JX127248 (Uncultured bacterium plasmid pRSB225, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
850. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042245 (Escherichia coli strain PU-1 plasmid pColV-PU1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
851. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014321 (Escherichia coli JJ1887 plasmid pJJ1887-4, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
852. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985271 (Escherichia coli strain 661 plasmid RCS59_p, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
853. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985213 (Escherichia coli strain 708 plasmid RCS102_p, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
854. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985221 (Escherichia coli strain TN03 plasmid RCS22_p, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
855. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LT985276 (Escherichia coli strain 707 plasmid RCS67_p, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
856. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MK295818 (Escherichia coli O25b:H4-ST131 strain U60 plasmid pU60, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
857. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MK797990 (Salmonella enterica subsp. enterica serovar Wien strain ZM3 plasmid pZM3, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
858. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018939 (Escherichia coli strain JSWP006 plasmid pJSWP006_1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
859. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044043 (Klebsiella pneumoniae strain FDAARGOS_629 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
860. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316135 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-16 plasmid pGDD25-16, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
861. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316136 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-21 plasmid pGDD25-21, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
862. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316133 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-3 plasmid pGDD25-3, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
863. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MH316134 (Salmonella enterica subsp. enterica serovar Indiana strain GDD25-5 plasmid pGDD25-5, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
864. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MF156697 (Escherichia coli strain BTR plasmid pBTR-CTXM, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
865. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_MG825372 (Escherichia coli strain 1106 plasmid p1106-IncFIB, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
866. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025329 (Escherichia coli strain ExPEC XM plasmid unnamed) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
867. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_023327 (Escherichia coli ACN001 plasmid pACN001-B, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
868. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_019105 (Salmonella enterica subsp. enterica serovar Dublin plasmid pSD_88, complete sequence) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
acggcgatcgccgggcacgccatcgccaccgg Protospacer
. *******.*********** *** .*
869. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MN807247 (Mycobacterium phage Chupacabra, complete genome) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gtgaacatcgtcggtgacgccaacgcggccaa Protospacer
* . ******** *************
870. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MF773750 (Mycobacterium phage OKCentral2016, complete genome) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gtgaacatcgtcggtgacgccaacgcggccaa Protospacer
* . ******** *************
871. spacer 1.72|68061|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to JX307704 (Mycobacterium virus Goose, complete genome) position: , mismatch: 10, identity: 0.688
gacgcgatcgtcgggcacgccaacgcggcgcc CRISPR spacer
gtgaacatcgtcggtgacgccaacgcggccaa Protospacer
* . ******** *************
872. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_017957 (Tistrella mobilis KA081020-065 plasmid pTM1, complete sequence) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
tgatccggcgcccagatccggaaccgggtccg Protospacer
.********.****** *******.*. .
873. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MT119367 (Pseudomonas phage misfit, complete genome) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
ctgtccggcgtccagatgcaggaccaaacgcc Protospacer
.****************.*.****.* ...
874. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MT133563 (Pseudomonas phage billy, complete genome) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
ctgtccggcgtccagatgcaggaccaaacgcc Protospacer
.****************.*.****.* ...
875. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to LC472882 (Pseudomonas phage R26 DNA, complete genome) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
ctgtccggcgtccagatgcaggaccaaacgcc Protospacer
.****************.*.****.* ...
876. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MT119370 (Pseudomonas phage steven, complete genome) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
ctgtccggcgtccagatgcaggaccaaacgcc Protospacer
.****************.*.****.* ...
877. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MH536736 (Pseudomonas phage E79, complete genome) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
ctgtccggcgtccagatgcaggaccaaacgcc Protospacer
.****************.*.****.* ...
878. spacer 1.73|68122|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to MT119378 (Pseudomonas phage datas, complete genome) position: , mismatch: 10, identity: 0.688
gaatccggcgtccagatgcggaaccagaaatt CRISPR spacer
ctgtccggcgtccagatgcaggaccaaacgcc Protospacer
.****************.*.****.* ...
879. spacer 1.80|68549|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016463 (Bosea sp. RAC05 plasmid pBSY19_1, complete sequence) position: , mismatch: 10, identity: 0.688
gtgggcggcgagacagtcggcgatggagcgtt CRISPR spacer
cgcaatgtagagccagtcggcgatggcgcgtt Protospacer
...* *** ************* *****
880. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP054921 (Streptomyces sp. NA03103 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
tcgcccgggccctggacggtctccacaatgat Protospacer
********.**********.*** *. . .
881. spacer 1.87|68976|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to CP054921 (Streptomyces sp. NA03103 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgcccggaccctggacggcctcaccgtcccc CRISPR spacer
ggtcccggaccctgcacggcctgaccaagcag Protospacer
*********** ******* ***. *
882. spacer 1.88|69037|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX156773 (Escherichia coli strain K-12 plasmid R16a, complete sequence) position: , mismatch: 10, identity: 0.688
ttcacgcccggaagcaagttcctcaacaagga CRISPR spacer
aacgacgccggtagcaagttcatcaacaagcc Protospacer
*. **** ********* ********
883. spacer 1.91|69220|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 10, identity: 0.688
tgcccctgcgggtcgccgctgccctgttccat CRISPR spacer
gccccctgcgggtcgccgcgtccctgccgatc Protospacer
***************** *****.. .
884. spacer 1.4|63913|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 11, identity: 0.656
gtggtgtgcgcggtggtcgtcggctcaatgcc CRISPR spacer
ctggtaggcgcggtggtcgtcggcctcccaga Protospacer
****. *****************.. ..
885. spacer 1.22|65011|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP010728 (Phaeobacter inhibens strain P88 plasmid pP88_c, complete sequence) position: , mismatch: 11, identity: 0.656
gtgcccacggacaccgaggtaacggccgtgga CRISPR spacer
tcgcccaaggacaccaaggtaacggtgccacc Protospacer
.***** *******.*********. ..
886. spacer 1.22|65011|32|CP034929|CRISPRCasFinder,CRT matches to NZ_CP021432 (Yoonia vestfoldensis strain SMR4r plasmid pSMR4r-1, complete sequence) position: , mismatch: 11, identity: 0.656
gtgcccacggacaccgaggtaacggccgtgga CRISPR spacer
tcgcccaaggacaccaaggtaacggtgccacc Protospacer
.***** *******.*********. ..
887. spacer 1.22|65011|32|CP034929|CRISPRCasFinder,CRT matches to KU530220 (Streptomyces phage Xkcd426, complete genome) position: , mismatch: 11, identity: 0.656
gtgcccacggacaccgaggtaacggccgtgga CRISPR spacer
agcgtcacggacgccgaggtcacggccgccct Protospacer
. .*******.******* *******.
888. spacer 1.38|65987|32|CP034929|CRISPRCasFinder,CRT matches to MH588547 (Caulobacter phage CcrSC, complete genome) position: , mismatch: 11, identity: 0.656
atctcatcacgccggcccagctcgcacgagca CRISPR spacer
ggctcgtcacgccggcccagcgcgccaagctg Protospacer
. ***.*************** *** .. ..
889. spacer 1.63|67512|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 11, identity: 0.656
ctggacaagatcgccggcgtcctgtcggccat CRISPR spacer
gaaaccaagatcgccgacgtcatgtcggaaga Protospacer
.. ***********.**** ****** .
890. spacer 1.71|68000|32|CP034929|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 11, identity: 0.656
tgtcgtgcggctttgcggtcgctgatggcact CRISPR spacer
ctggttgcggccgtgcggtcgctgatggagac Protospacer
. ******. *************** . .
