1. spacer 2.3|2549707|33|CP025836|PILER-CR matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 6, identity: 0.818
aataggcaaccgggcggcctgcctcgctctcta CRISPR spacer
cataggccaccgggcggccggcctcgcacacca Protospacer
****** *********** ******* * *.*
2. spacer 2.32|2549703|33|CP025836|CRISPRCasFinder,CRT matches to NZ_CP049142 (Pseudomonas nitroreducens strain HBP1 plasmid pPniHBP1_1, complete sequence) position: , mismatch: 6, identity: 0.818
aataggcaaccgggcggcctgcctcgctctcta CRISPR spacer
cataggccaccgggcggccggcctcgcacacca Protospacer
****** *********** ******* * *.*
3. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040996 (Klebsiella pneumoniae strain FDAARGOS_775 plasmid unnamed4) position: , mismatch: 7, identity: 0.794
catcttgt-tgttcataatgttttcctttctttta CRISPR spacer
-atttactgtattcataatgctttcctttttttta Protospacer
**.* * *.*********.********.*****
4. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to NC_019555 (Agrobacterium tumefaciens strain F64/95 plasmid pAoF64/95, complete sequence) position: , mismatch: 7, identity: 0.794
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
ctgacaacttcaacaagaaagggaacatcatgaa Protospacer
**.* * * .************.*****.*****
5. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to HQ918180 (Klebsiella phage KP27, complete genome) position: , mismatch: 8, identity: 0.765
catcttgttgttcataatgttttcctttctttta CRISPR spacer
tttattgatgttcatgatgttttcctttctctgt Protospacer
. * *** *******.**************.*
6. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030069 (Klebsiella pneumoniae strain IA565 plasmid pDA11912.4, complete sequence) position: , mismatch: 8, identity: 0.765
catcttgttgttcataatgttttcctttctttta CRISPR spacer
aatgtatttcttcataatgttttccttttttatt Protospacer
** * ** ******************.** *
7. spacer 1.14|2060604|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to KU886268 (Freshwater phage uvFW-CGR-AMD-COM-C203, complete genome) position: , mismatch: 8, identity: 0.765
aaagccaaaagaagccaaaagaagccaaaagaag CRISPR spacer
catcgaaaaagaagccaaaggaagccaaatgaaa Protospacer
* *************.********* ***.
8. spacer 2.7|2549982|33|CP025836|PILER-CR matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
aagaaatataacaatggataatcagttctacgg Protospacer
******** *******.*******. ** *
9. spacer 2.24|2551156|34|CP025836|PILER-CR matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.765
aacaatgaacaatcaaatcaaattgcaagaaggt CRISPR spacer
ctaaatgaaaaatcgaatcaaattgcaagatact Protospacer
****** ****.*************** . *
10. spacer 2.29|2551500|34|CP025836|PILER-CR matches to NC_015969 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence) position: , mismatch: 8, identity: 0.765
gattccgttgctggtggaggggtcaggccgtccg CRISPR spacer
caagcccgcgctggcggaggggtcaggccgtgcg Protospacer
* ** .*****.**************** **
11. spacer 2.36|2549970|33|CP025836|CRISPRCasFinder,CRT matches to NZ_CP028286 (Enterococcus faecalis strain FDAARGOS_324 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.758
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
aagaaatataacaatggataatcagttctacgg Protospacer
******** *******.*******. ** *
12. spacer 2.53|2551110|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP053657 (Bacillus cereus strain CTMA_1571 plasmid p.1, complete sequence) position: , mismatch: 8, identity: 0.765
aacaatgaacaatcaaatcaaattgcaagaaggt CRISPR spacer
ctaaatgaaaaatcgaatcaaattgcaagatact Protospacer
****** ****.*************** . *
13. spacer 2.58|2551444|34|CP025836|CRISPRCasFinder,CRT matches to NC_015969 (UNVERIFIED_ORG: Enterobacter soli plasmid pENTAS02, complete sequence) position: , mismatch: 8, identity: 0.765
gattccgttgctggtggaggggtcaggccgtccg CRISPR spacer
caagcccgcgctggcggaggggtcaggccgtgcg Protospacer
* ** .*****.**************** **
14. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to MN850582 (Escherichia phage ityhuna, complete genome) position: , mismatch: 8, identity: 0.765
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
cgaaacgaaccaacaaaaaaggaaaaattatgtc Protospacer
* *** ********.******** ******
15. spacer 2.78|2552782|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX785327 (Streptococcus suis strain 3366 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.765
ataataaaatcagttaaactaaaaccaccaacaa CRISPR spacer
ataaaaaaatcatttaaactaaaaacgaaagaaa Protospacer
**** ******* *********** *. *. **
16. spacer 2.78|2552782|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KX785329 (Streptococcus suis strain 3370 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.765
ataataaaatcagttaaactaaaaccaccaacaa CRISPR spacer
ataaaaaaatcatttaaactaaaaacgaaagaaa Protospacer
**** ******* *********** *. *. **
17. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NC_014389 (Butyrivibrio proteoclasticus B316 plasmid pCY360, complete sequence) position: , mismatch: 9, identity: 0.735
catcttgttgttcataatgttttcctttctttta CRISPR spacer
tccatatgtgatcatattgttttcctttctttta Protospacer
. . * ** ***** *****************
18. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NC_021529 (Vibrio phage nt-1, complete genome) position: , mismatch: 9, identity: 0.735
catcttgttgttcataatgttttcctttctttta CRISPR spacer
gtcgttgatgttcataatgttttcctttggtgtt Protospacer
. *** ******************** * *
19. spacer 1.10|2060345|33|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to MG945599 (UNVERIFIED: Microviridae sp. isolate 4382-1711, complete genome) position: , mismatch: 9, identity: 0.727
aaggccaaaagaagccaaaagaatccaaaggaa CRISPR spacer
aaaaacaaaagaagtcaaaacaatccaaaaagc Protospacer
**.. *********.***** ********...
20. spacer 1.16|2060734|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NC_014305 (Erwinia billingiae Eb661 plasmid pEB170, complete sequence) position: , mismatch: 9, identity: 0.735
----ctactaaacctatcggaattgtgattgaaggcat CRISPR spacer
tgcgctgc----attatcggtattgtgattgcaggcat Protospacer
**.* .****** ********** ******
21. spacer 2.7|2549982|33|CP025836|PILER-CR matches to AJ131519 (Lactobacillus bacteriophage phi adh complete genome) position: , mismatch: 9, identity: 0.727
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata Protospacer
. * ****** ************** ***
22. spacer 2.7|2549982|33|CP025836|PILER-CR matches to NC_000896 (Lactobacillus prophage phiadh, complete genome) position: , mismatch: 9, identity: 0.727
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata Protospacer
. * ****** ************** ***
23. spacer 2.7|2549982|33|CP025836|PILER-CR matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 9, identity: 0.727
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
acaggagaaaacaatgaataaacgaatcaaaaa Protospacer
* ...* ************** *.*******
24. spacer 2.14|2550466|34|CP025836|PILER-CR matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
tgcggcccgcaaggccttcaacattgcggatgat CRISPR spacer
tgcggccagcaatgccttcaacatgattgccgag Protospacer
******* **** *********** .. * .**
25. spacer 2.15|2550535|33|CP025836|PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727
ctctcacatgggcggtctacgaaaacggtgccg CRISPR spacer
cgatgcaccgggcggtcgacgaatacggtgccg Protospacer
* * .******** ***** *********
26. spacer 2.15|2550535|33|CP025836|PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.727
ctctcacatgggcggtctacgaaaacggtgccg CRISPR spacer
tgctgtggcgggcggtcgacgaacacggtgccg Protospacer
. ** ..******** ***** *********
27. spacer 2.36|2549970|33|CP025836|CRISPRCasFinder,CRT matches to AJ131519 (Lactobacillus bacteriophage phi adh complete genome) position: , mismatch: 9, identity: 0.727
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata Protospacer
. * ****** ************** ***
28. spacer 2.36|2549970|33|CP025836|CRISPRCasFinder,CRT matches to NC_000896 (Lactobacillus prophage phiadh, complete genome) position: , mismatch: 9, identity: 0.727
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
ttatcagaaaacattgaataatcaaatccaata Protospacer
. * ****** ************** ***
29. spacer 2.36|2549970|33|CP025836|CRISPRCasFinder,CRT matches to MK448686 (Streptococcus phage Javan157, complete genome) position: , mismatch: 9, identity: 0.727
aagaaataaaacaatgaataatcaaatcaaatt CRISPR spacer
acaggagaaaacaatgaataaacgaatcaaaaa Protospacer
* ...* ************** *.*******
30. spacer 2.43|2550440|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP042825 (Rhizobium sp. WL3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
tgcggcccgcaaggccttcaacattgcggatgat CRISPR spacer
tgcggccagcaatgccttcaacatgattgccgag Protospacer
******* **** *********** .. * .**
31. spacer 2.44|2550507|33|CP025836|CRISPRCasFinder,CRT matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.727
ctctcacatgggcggtctacgaaaacggtgccg CRISPR spacer
cgatgcaccgggcggtcgacgaatacggtgccg Protospacer
* * .******** ***** *********
32. spacer 2.44|2550507|33|CP025836|CRISPRCasFinder,CRT matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.727
ctctcacatgggcggtctacgaaaacggtgccg CRISPR spacer
tgctgtggcgggcggtcgacgaacacggtgccg Protospacer
. ** ..******** ***** *********
33. spacer 2.80|2552916|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to KU847400 (UNVERIFIED: Bacillus phage Crookii, complete genome) position: , mismatch: 9, identity: 0.735
atccctaccattttagtagggattccttgttcca CRISPR spacer
atccctaccattttagtaggaattaactttatgg Protospacer
********************.*** .* * . .
34. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029732 (Citrobacter sp. CRE-46 strain AR_0157 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706
catcttgttgttcataatgttttcctttctttta CRISPR spacer
ggtgttgtttttcataatgctttccttttagtag Protospacer
.* ***** *********.********. * .
35. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to KY653117 (Staphylococcus phage IME1323_01, complete genome) position: , mismatch: 10, identity: 0.706
catcttgttgttcataatgttttcctttctttta CRISPR spacer
aatcttgttgttcttaattttttccatagtgcct Protospacer
************ **** ****** * * ..
36. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to MN856080 (Bacteriophage sp. isolate 174, complete genome) position: , mismatch: 10, identity: 0.706
catcttgttgttcataatgttttcctttctttta CRISPR spacer
tctataactgtccatattgttttcctttctttct Protospacer
. * * ..***.**** ***************.
37. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to KY705281 (Streptococcus phage P7955, complete genome) position: , mismatch: 10, identity: 0.706
catcttgttgttcataatgttttcctttctttta CRISPR spacer
gtactcaaatttcataaatttttcctttctttta Protospacer
**.. ******* ***************
38. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to KY705280 (Streptococcus phage P7954, complete genome) position: , mismatch: 10, identity: 0.706
catcttgttgttcataatgttttcctttctttta CRISPR spacer
gtactcaaatttcataaatttttcctttctttta Protospacer
**.. ******* ***************
39. spacer 1.9|2060280|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NC_048847 (Alteromonas phage vB_AmeM_PT11-V22, complete genome) position: , mismatch: 10, identity: 0.706
tgcgtcatcatctacgttaaaggccttgcgggcc CRISPR spacer
agggtcatcatctacgataaaggctttcatagtt Protospacer
* ************* *******.** .*..
40. spacer 2.8|2550050|34|CP025836|PILER-CR matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 10, identity: 0.706
atatgcggcccgccgcgcgttcaacgttgaagct CRISPR spacer
gctatttgcccgccgcgcgtttaacgttgaaggc Protospacer
.. . **************.********** .
41. spacer 2.8|2550050|34|CP025836|PILER-CR matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 10, identity: 0.706
atatgcggcccgccgcgcgttcaacgttgaagct CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc Protospacer
. * . *********** **.********** .
42. spacer 2.8|2550050|34|CP025836|PILER-CR matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 10, identity: 0.706
atatgcggcccgccgcgcgttcaacgttgaagct CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc Protospacer
. * . *********** **.********** .
43. spacer 2.17|2550673|34|CP025836|PILER-CR matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gaacccgcatgatgacgcccccgccctgtcacgg CRISPR spacer
cgagccgcaggacgacgcccccgccctgcggacg Protospacer
.* ***** **.***************. . *
44. spacer 2.37|2550036|34|CP025836|CRISPRCasFinder,CRT matches to LR134132 (Klebsiella aerogenes strain NCTC10006 genome assembly, plasmid: 12) position: , mismatch: 10, identity: 0.706
atatgcggcccgccgcgcgttcaacgttgaagct CRISPR spacer
gctatttgcccgccgcgcgtttaacgttgaaggc Protospacer
.. . **************.********** .
45. spacer 2.37|2550036|34|CP025836|CRISPRCasFinder,CRT matches to MG065691 (UNVERIFIED: Campylobacter phage A11a, complete genome) position: , mismatch: 10, identity: 0.706
atatgcggcccgccgcgcgttcaacgttgaagct CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc Protospacer
. * . *********** **.********** .
46. spacer 2.37|2550036|34|CP025836|CRISPRCasFinder,CRT matches to MG065686 (UNVERIFIED: Campylobacter phage A18a, complete genome) position: , mismatch: 10, identity: 0.706
atatgcggcccgccgcgcgttcaacgttgaagct CRISPR spacer
cctttttgcccgccgcgcttttaacgttgaaggc Protospacer
. * . *********** **.********** .
47. spacer 2.46|2550641|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.706
gaacccgcatgatgacgcccccgccctgtcacgg CRISPR spacer
cgagccgcaggacgacgcccccgccctgcggacg Protospacer
.* ***** **.***************. . *
48. spacer 2.59|2551511|34|CP025836|CRISPRCasFinder,CRT matches to KY926699 (Lactococcus phage PLgY-30, complete genome) position: , mismatch: 10, identity: 0.706
taaactaaaaccactaaagaaaggaaacaattat CRISPR spacer
ccaaccaaaaccacaaaagaaaggaaaagacatg Protospacer
. ***.******** ************ .*.
49. spacer 2.59|2551511|34|CP025836|CRISPRCasFinder,CRT matches to KY888143 (Lactococcus phage PLgW-1, complete genome) position: , mismatch: 10, identity: 0.706
taaactaaaaccactaaagaaaggaaacaattat CRISPR spacer
ccaaccaaaaccacaaaagaaaggaaaagacatg Protospacer
. ***.******** ************ .*.
50. spacer 2.59|2551511|34|CP025836|CRISPRCasFinder,CRT matches to KY926698 (Lactococcus phage PLgY-16, complete genome) position: , mismatch: 10, identity: 0.706
taaactaaaaccactaaagaaaggaaacaattat CRISPR spacer
ccaaccaaaaccacaaaagaaaggaaaagacatg Protospacer
. ***.******** ************ .*.
51. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to NC_016570 (Escherichia phage vB_EcoM_CBA120, complete genome) position: , mismatch: 10, identity: 0.706
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat Protospacer
..* *********** *.**********. .*
52. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to JN593240 (Escherichia virus CBA120, complete genome) position: , mismatch: 10, identity: 0.706
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat Protospacer
..* *********** *.**********. .*
53. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to MG383452 (Escherichia phage FEC14, complete genome) position: , mismatch: 10, identity: 0.706
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat Protospacer
..* *********** *.**********. .*
54. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to KY630163 (Salmonella phage S8, complete genome) position: , mismatch: 10, identity: 0.706
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat Protospacer
..* *********** *.**********. .*
55. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to KY787213 (Salmonella phage BSP101, complete genome) position: , mismatch: 10, identity: 0.706
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
gcgataccaccaacaatagaggaaacattgaaat Protospacer
..* *********** *.**********. .*
56. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020950 (Rhizobium sp. CIAT894 plasmid pRheCIAT894c, complete sequence) position: , mismatch: 11, identity: 0.676
catcttgttgttcataatgttttcct-------ttctttta CRISPR spacer
gatcttgttgttcattatcttttcccgagcagat------- Protospacer
************** ** ******. *
57. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to MT939487 (Erwinia phage pEa_SNUABM_47, complete genome) position: , mismatch: 11, identity: 0.676
catcttgttgttcataatgttttcctttctttta CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt Protospacer
. . ************ .**********.. *
58. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to MT939486 (Erwinia phage pEa_SNUABM_12, complete genome) position: , mismatch: 11, identity: 0.676
catcttgttgttcataatgttttcctttctttta CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt Protospacer
. . ************ .**********.. *
59. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NC_041917 (Serratia phage BF, complete genome) position: , mismatch: 11, identity: 0.676
catcttgttgttcataatgttttcctttctttta CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt Protospacer
. . ************ .**********.. *
60. spacer 1.6|2060085|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to MT939488 (Erwinia phage pEa_SNUABM_50, complete genome) position: , mismatch: 11, identity: 0.676
catcttgttgttcataatgttttcctttctttta CRISPR spacer
ttcattgttgttcatatcgttttccttttcaatt Protospacer
. . ************ .**********.. *
61. spacer 1.8|2060215|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 11, identity: 0.676
aacgtaagcgaaaaggcccgccccctcgtaaaag CRISPR spacer
gacggaatcgaaaaggcccgccccccgcagtgcg Protospacer
.*** ** *****************. . . *
62. spacer 1.8|2060215|34|CP025836|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 11, identity: 0.676
aacgtaagcgaaaaggcccgccccctcgtaaaag CRISPR spacer
gacggaatcgaaaaggcccgccccccgcagtgcg Protospacer
.*** ** *****************. . . *
63. spacer 2.60|2551578|34|CP025836|CRISPRCasFinder,CRT matches to MN175388 (Cronobacter sp. strain CR-13-12 plasmid pCR-13-12-NDM-1, complete sequence) position: , mismatch: 11, identity: 0.676
tttagtggttttgttattcagcatcagggatatt CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca Protospacer
. ******** ********** ****..*..
64. spacer 2.60|2551578|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP048111 (Klebsiella michiganensis strain BD177 plasmid unnamed3) position: , mismatch: 11, identity: 0.676
tttagtggttttgttattcagcatcagggatatt CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca Protospacer
. ******** ********** ****..*..
65. spacer 2.60|2551578|34|CP025836|CRISPRCasFinder,CRT matches to NZ_MF190369 (Enterobacter cloacae strain A1137 plasmid pA1137, complete sequence) position: , mismatch: 11, identity: 0.676
tttagtggttttgttattcagcatcagggatatt CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca Protospacer
. ******** ********** ****..*..
66. spacer 2.60|2551578|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP021538 (Escherichia coli strain AR_0119 plasmid unitig_4, complete sequence) position: , mismatch: 11, identity: 0.676
tttagtggttttgttattcagcatcagggatatt CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca Protospacer
. ******** ********** ****..*..
67. spacer 2.60|2551578|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 11, identity: 0.676
tttagtggttttgttattcagcatcagggatatt CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca Protospacer
. ******** ********** ****..*..
68. spacer 2.60|2551578|34|CP025836|CRISPRCasFinder,CRT matches to NZ_CP030345 (Enterobacter hormaechei strain AR_038 plasmid unnamed1) position: , mismatch: 11, identity: 0.676
tttagtggttttgttattcagcatcagggatatt CRISPR spacer
ggccgtggtttttttattcagcaacaggagtgca Protospacer
. ******** ********** ****..*..
69. spacer 2.76|2552648|34|CP025836|CRISPRCasFinder,CRT,PILER-CR matches to MK496698 (Capybara microvirus Cap1_SP_87, complete genome) position: , mismatch: 11, identity: 0.676
ctaaaaccaccaacaagaaaggaaacattatgaa CRISPR spacer
ggcaaaccaccaacaagagaggatacaccacttt Protospacer
***************.**** ***..*.
