Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034969 Salmonella enterica subsp. enterica serovar Typhimurium strain B3589 plasmid p3589, complete sequence 0 crisprs NA 0 0 0 0
CP034968 Salmonella enterica subsp. enterica serovar Typhimurium strain B3589 chromosome, complete genome 5 crisprs DEDDh,cas3,DinG,WYL,RT,PD-DExK,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3 0 21 11 0

Results visualization

1. CP034968
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034968_1 1649161-1649249 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034968_3 3666996-3668245 TypeI-E I-E
20 spacers
cas3,cas8e

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034968_5 3685030-3685607 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034968_4 3684377-3684956 TypeI-E I-E
9 spacers
cas2,cas1,cas6e,cas5,cas7,cse2gr11,cas8e,cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034968_6 3876536-3876645 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034968_3 3.16|3667941|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667941-3667972 32 NZ_CP034699 Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence 177960-177991 1 0.969
CP034968_3 3.16|3667941|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667941-3667972 32 NZ_CP034710 Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence 67131-67162 1 0.969
CP034968_4 4.8|3684832|33|CP034968|PILER-CR 3684832-3684864 33 CP051275 Salmonella phage SW-37, complete genome 24294-24326 1 0.97
CP034968_4 4.8|3684832|33|CP034968|PILER-CR 3684832-3684864 33 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44003 1 0.97
CP034968_4 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT 3684833-3684864 32 CP051275 Salmonella phage SW-37, complete genome 24295-24326 1 0.969
CP034968_4 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT 3684833-3684864 32 KC139516 Salmonella phage FSL SP-016, partial genome 43971-44002 1 0.969
CP034968_4 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT 3684833-3684864 32 JQ182729 Enterobacterial phage mEp390, complete genome 23951-23982 3 0.906
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 CP023013 Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence 1387347-1387378 5 0.844
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP022766 Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence 1461559-1461590 5 0.844
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 CP023015 Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence 599340-599371 5 0.844
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NC_012528 Deinococcus deserti VCD115 plasmid 3, complete sequence 121315-121346 6 0.812
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP044078 Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence 135155-135186 7 0.781
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP031081 Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence 195902-195933 7 0.781
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP032322 Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence 581076-581107 7 0.781
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP022367 Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence 122557-122588 7 0.781
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP032346 Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence 529537-529568 7 0.781
CP034968_3 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667391-3667422 32 NZ_CP034156 Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence 327444-327475 7 0.781
CP034968_4 4.12|3684589|32|CP034968|CRISPRCasFinder,CRT 3684589-3684620 32 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29079 7 0.781
CP034968_4 4.12|3684589|32|CP034968|CRISPRCasFinder,CRT 3684589-3684620 32 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142294-142325 7 0.781
CP034968_4 4.14|3684711|32|CP034968|CRISPRCasFinder,CRT 3684711-3684742 32 NZ_CP054841 Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence 535406-535437 7 0.781
CP034968_5 5.1|3685059|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3685059-3685090 32 NZ_CP013929 Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence 188177-188208 7 0.781
CP034968_5 5.1|3685059|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3685059-3685090 32 CP013931 Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence 192938-192969 7 0.781
CP034968_5 5.1|3685059|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3685059-3685090 32 NC_019394 Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence 188204-188235 7 0.781
CP034968_3 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667208-3667239 32 NC_028940 Pectobacterium bacteriophage PM2, complete genome 79087-79118 8 0.75
CP034968_3 3.5|3667269|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667269-3667300 32 NZ_CP014942 Rhodococcus sp. BH4 plasmid, complete sequence 462005-462036 8 0.75
CP034968_3 3.13|3667758|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667758-3667789 32 CP024685 Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence 135469-135500 8 0.75
CP034968_3 3.13|3667758|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667758-3667789 32 NZ_CP031801 Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence 11654-11685 8 0.75
CP034968_4 4.4|3684588|33|CP034968|PILER-CR 3684588-3684620 33 NZ_CP041075 Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence 142293-142325 8 0.758
CP034968_4 4.4|3684588|33|CP034968|PILER-CR 3684588-3684620 33 NZ_CP024773 Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence 29048-29080 8 0.758
CP034968_4 4.13|3684650|32|CP034968|CRISPRCasFinder,CRT 3684650-3684681 32 NZ_CP016179 Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence 203354-203385 8 0.75
CP034968_5 5.8|3685486|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3685486-3685517 32 MN855803 Bacteriophage sp. isolate 108, partial genome 10057-10088 8 0.75
CP034968_3 3.8|3667452|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667452-3667483 32 NZ_CP021372 Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence 353298-353329 9 0.719
CP034968_3 3.8|3667452|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667452-3667483 32 AM749121 Streptococcus phage M102 complete genome 7893-7924 9 0.719
CP034968_3 3.8|3667452|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667452-3667483 32 NC_012884 Streptococcus phage M102, complete genome 7893-7924 9 0.719
CP034968_3 3.11|3667635|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667635-3667666 32 MN693046 Marine virus AFVG_25M413, complete genome 4323-4354 9 0.719
CP034968_3 3.11|3667635|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667635-3667666 32 MN693008 Marine virus AFVG_117M9, complete genome 4316-4347 9 0.719
CP034968_4 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT 3684467-3684498 32 MT162468 Synechococcus phage S-H25, complete genome 69929-69960 9 0.719
CP034968_3 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667208-3667239 32 NZ_CP042995 Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence 68697-68728 10 0.688
CP034968_3 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667208-3667239 32 NZ_CP026129 Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence 43950-43981 10 0.688
CP034968_3 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667208-3667239 32 NZ_CP038501 Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence 49131-49162 10 0.688
CP034968_3 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667208-3667239 32 NZ_CP046044 Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence 66631-66662 10 0.688
CP034968_3 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667208-3667239 32 NZ_CP048015 Acinetobacter towneri strain 205 plasmid pAT205, complete sequence 147167-147198 10 0.688
CP034968_3 3.9|3667513|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667513-3667544 32 NZ_CP030264 Ensifer adhaerens strain Corn53 plasmid AB, complete sequence 1134787-1134818 10 0.688
CP034968_3 3.17|3668002|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3668002-3668033 32 NZ_CP044072 Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence 99817-99848 10 0.688
CP034968_3 3.20|3668185|32|CP034968|CRISPRCasFinder,CRT 3668185-3668216 32 NZ_CP054615 Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence 146919-146950 10 0.688
CP034968_4 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT 3684467-3684498 32 LN681539 Clostridium phage phiCD505, complete genome 8933-8964 10 0.688
CP034968_4 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT 3684467-3684498 32 JX145341 Clostridium phage phiMMP02, complete genome 8932-8963 10 0.688
CP034968_4 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT 3684467-3684498 32 NC_011398 Clostridium phage phiCD27, complete genome 8924-8955 10 0.688
CP034968_4 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT 3684467-3684498 32 NC_048642 Clostridium phage CDKM9, complete genome 8871-8902 10 0.688
CP034968_4 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT 3684467-3684498 32 KX228400 Clostridium phage CDKM15, complete genome 9066-9097 10 0.688
CP034968_4 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT 3684833-3684864 32 NZ_AP022571 Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence 153476-153507 10 0.688
CP034968_5 5.9|3685547|32|CP034968|CRISPRCasFinder,CRT 3685547-3685578 32 NC_016113 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence 1151729-1151760 10 0.688
CP034968_5 5.9|3685547|32|CP034968|CRISPRCasFinder,CRT 3685547-3685578 32 NC_017585 Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence 661429-661460 10 0.688
CP034968_3 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667025-3667056 32 NC_012586 Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence 1885546-1885577 11 0.656
CP034968_3 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667025-3667056 32 NZ_HG938356 Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence 56201-56232 11 0.656
CP034968_3 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667025-3667056 32 NZ_CP040822 Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence 83399-83430 11 0.656
CP034968_3 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667025-3667056 32 NZ_CP023071 Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence 1487158-1487189 11 0.656
CP034968_3 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT 3667025-3667056 32 NZ_CP029232 Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence 597699-597730 11 0.656

1. spacer 3.16|3667941|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034699 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE40 plasmid pRSE40, complete sequence) position: , mismatch: 1, identity: 0.969 

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

2. spacer 3.16|3667941|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034710 (Salmonella enterica subsp. enterica serovar Karamoja strain RSE21 plasmid pRSE21, complete sequence) position: , mismatch: 1, identity: 0.969 

ggatatgtgaagttcaggtagcccattacgca	CRISPR spacer
ggatatgtgaagttcaggtagcccactacgca	Protospacer
*************************.******

3. spacer 4.8|3684832|33|CP034968|PILER-CR matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.97 

gccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
gccacgttcggcgatgttggccccatcggtccg	Protospacer
********************************.

4. spacer 4.8|3684832|33|CP034968|PILER-CR matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.97 

gccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
gccacattcggcgatgttggccccatcggtcca	Protospacer
*****.***************************

5. spacer 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT matches to CP051275 (Salmonella phage SW-37, complete genome) position: , mismatch: 1, identity: 0.969 

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacgttcggcgatgttggccccatcggtccg	Protospacer
*******************************.

6. spacer 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT matches to KC139516 (Salmonella phage FSL SP-016, partial genome) position: , mismatch: 1, identity: 0.969 

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ccacattcggcgatgttggccccatcggtcca	Protospacer
****.***************************

7. spacer 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT matches to JQ182729 (Enterobacterial phage mEp390, complete genome) position: , mismatch: 3, identity: 0.906 

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
ctacgttcggtgatgttggccccataggtcca	Protospacer
*.********.************** ******

8. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * ****

9. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * ****

10. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 5, identity: 0.844 

gatcgggtggtgccggtgggccatgtggcgct-	CRISPR spacer
gatcgggtggtgccgctggggcata-gccgctg	Protospacer
*************** **** ***. * ****

11. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812 

gatcgggtggtgccggtgggccatgtggcgct--	CRISPR spacer
ggtcgggtggtgcgggtcggcca--tggcgttgg	Protospacer
*.*********** *** *****  *****.*

12. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044078 (Paracoccus yeei strain FDAARGOS_643 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

gatcg--ggtggtgccggtgggccatgtggcgct	CRISPR spacer
--ccgacgctggtggcggtgggccatgtggcggc	Protospacer
  .**  * ***** ***************** .

13. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031081 (Paracoccus yeei strain CCUG 32053 plasmid pYEE3, complete sequence) position: , mismatch: 7, identity: 0.781 

gatcg--ggtggtgccggtgggccatgtggcgct	CRISPR spacer
--ccgacgctggtggcggtgggccatgtggcggc	Protospacer
  .**  * ***** ***************** .

14. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************

15. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781 

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************

16. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781 

gatcg-ggtggtgccggtgggccatgtggcgct	CRISPR spacer
-atggcgatggagccgctgggccatgtggcggg	Protospacer
 ** * *.*** **** **************

17. spacer 3.7|3667391|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 7, identity: 0.781 

gatcgggtggtgccggtgggccatgtggcgct	CRISPR spacer
gctagtgccgtgccggtgcgccatgtggggct	Protospacer
* * * *. ********* ********* ***

18. spacer 4.12|3684589|32|CP034968|CRISPRCasFinder,CRT matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 7, identity: 0.781 

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

19. spacer 4.12|3684589|32|CP034968|CRISPRCasFinder,CRT matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781 

ttacgtgtttattcatctgttgcattagattc	CRISPR spacer
attggtgtttcttcatctattgcattagaagc	Protospacer
 *  ****** *******.**********  *

20. spacer 4.14|3684711|32|CP034968|CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781 

acgccccgaatgtgtttgcctcgcccgctgcc	CRISPR spacer
gcgacctgaatgtgtttgcctcgcgccgtggc	Protospacer
.** **.***************** *  ** *

21. spacer 5.1|3685059|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013929 (Alteromonas mediterranea strain UM8 plasmid pAMEDUM8_300, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**

22. spacer 5.1|3685059|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to CP013931 (Alteromonas mediterranea strain U10 plasmid pAMED10_300, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**

23. spacer 5.1|3685059|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NC_019394 (Alteromonas mediterranea DE1 plasmid pAMDE1, complete sequence) position: , mismatch: 7, identity: 0.781 

agccgtttccgctaaatacccc--cgcagtgatt	CRISPR spacer
ccccgatttcgctaaatacccccgcgcagcga--	Protospacer
  *** **.*************  *****.**

24. spacer 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NC_028940 (Pectobacterium bacteriophage PM2, complete genome) position: , mismatch: 8, identity: 0.75 

gctcattaaataactatataacccccggactc	CRISPR spacer
tatcattaaataactatataacacacgagagc	Protospacer
  ******************** * **..  *

25. spacer 3.5|3667269|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014942 (Rhodococcus sp. BH4 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75 

ttccagaaccgtttgacttactgtggccatta	CRISPR spacer
ctgccgaaccgtgtgccttactgtggccaccg	Protospacer
.* * ******* ** *************...

26. spacer 3.13|3667758|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to CP024685 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-1-490K, complete sequence) position: , mismatch: 8, identity: 0.75 

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
attcactatcagacattttattcagttctgcc	Protospacer
  ***** ** *****************  .

27. spacer 3.13|3667758|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP031801 (Klebsiella pneumoniae strain MSB1_8A-sc-2280397 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

cgtcactttctgacattttattcagttcgtta	CRISPR spacer
cgcgcgtgtctgacattgtattcagttcattt	Protospacer
**.   * ********* **********.**

28. spacer 4.4|3684588|33|CP034968|PILER-CR matches to NZ_CP041075 (Bacillus tropicus strain LM1212-W3 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.758 

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

29. spacer 4.4|3684588|33|CP034968|PILER-CR matches to NZ_CP024773 (Bacillus thuringiensis LM1212 plasmid pLM2, complete sequence) position: , mismatch: 8, identity: 0.758 

gttacgtgtttattcatctgttgcattagattc	CRISPR spacer
aattggtgtttcttcatctattgcattagaagc	Protospacer
. *  ****** *******.**********  *

30. spacer 4.13|3684650|32|CP034968|CRISPRCasFinder,CRT matches to NZ_CP016179 (Vibrio breoganii strain FF50 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75 

gaggcgtac-----aggctgttagatgagaaattacc	CRISPR spacer
-----atactaataaggctgtttgatgcgaaattacc	Protospacer
     .***     ******** **** *********

31. spacer 5.8|3685486|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to MN855803 (Bacteriophage sp. isolate 108, partial genome) position: , mismatch: 8, identity: 0.75 

ggttaaccaggggtttttccccactatttcgc	CRISPR spacer
aggtaacgaggggtttttccccaatattgaaa	Protospacer
.* **** *************** ****  .

32. spacer 3.8|3667452|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021372 (Rhizobium sp. ACO-34A plasmid pRACO34Ad, complete sequence) position: , mismatch: 9, identity: 0.719 

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
ggtgcgggtgaggaactcctcgtccactgaac	Protospacer
*  **** **** **************   .

33. spacer 3.8|3667452|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to AM749121 (Streptococcus phage M102 complete genome) position: , mismatch: 9, identity: 0.719 

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

34. spacer 3.8|3667452|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NC_012884 (Streptococcus phage M102, complete genome) position: , mismatch: 9, identity: 0.719 

gcagcggttgagtaactcctcgtccacgtcga	CRISPR spacer
aaggcggtggagtaactcctggtccagcccaa	Protospacer
. .***** *********** *****  .*.*

35. spacer 3.11|3667635|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to MN693046 (Marine virus AFVG_25M413, complete genome) position: , mismatch: 9, identity: 0.719 

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*

36. spacer 3.11|3667635|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to MN693008 (Marine virus AFVG_117M9, complete genome) position: , mismatch: 9, identity: 0.719 

gcgaggtcaataaaaaatggtgtggctttacc	CRISPR spacer
ttagggtcaacaaaaaatggtgtggtttcaga	Protospacer
 ...******.**************.**.*

37. spacer 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT matches to MT162468 (Synechococcus phage S-H25, complete genome) position: , mismatch: 9, identity: 0.719 

ttgcag----ggcgatattgttgttggtgaatggga	CRISPR spacer
----aacactgacgatattattgttggtgattgggg	Protospacer
    *.    *.*******.********** ****.

38. spacer 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP042995 (Acinetobacter nosocomialis strain J1A plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*

39. spacer 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026129 (Acinetobacter baumannii strain ABNIH28 plasmid pABA-2f10, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*

40. spacer 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP038501 (Acinetobacter baumannii strain CIAT758 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*

41. spacer 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP046044 (Acinetobacter towneri strain 19110F47 plasmid p19110F47-2, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*

42. spacer 3.4|3667208|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048015 (Acinetobacter towneri strain 205 plasmid pAT205, complete sequence) position: , mismatch: 10, identity: 0.688 

gctcattaaataactatataacccccggactc	CRISPR spacer
cagcattaattaactgtataacccccaaaaaa	Protospacer
   ****** *****.**********..*

43. spacer 3.9|3667513|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030264 (Ensifer adhaerens strain Corn53 plasmid AB, complete sequence) position: , mismatch: 10, identity: 0.688 

ctccagcgctcgaatttatttgaggccaccac	CRISPR spacer
gaacaccgcgcgaatttatttgaggcaagttt	Protospacer
   ** *** **************** * . .

44. spacer 3.17|3668002|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044072 (Pseudomonas oryzihabitans strain FDAARGOS_657 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

ttgatcgagagtgcgaagaggcagaacgggca	CRISPR spacer
gaaggtggcagtgccaagagacagaacgggca	Protospacer
  .. .*. ***** *****.***********

45. spacer 3.20|3668185|32|CP034968|CRISPRCasFinder,CRT matches to NZ_CP054615 (Azospirillum oryzae strain KACC 14407 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688 

cgttcatcggcagcgtcacgcaatatgaagat	CRISPR spacer
acatcatcggcatcgtcacgccatatccggca	Protospacer
   ********* ******** ****  .*

46. spacer 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT matches to LN681539 (Clostridium phage phiCD505, complete genome) position: , mismatch: 10, identity: 0.688 

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

47. spacer 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT matches to JX145341 (Clostridium phage phiMMP02, complete genome) position: , mismatch: 10, identity: 0.688 

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

48. spacer 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT matches to NC_011398 (Clostridium phage phiCD27, complete genome) position: , mismatch: 10, identity: 0.688 

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

49. spacer 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT matches to NC_048642 (Clostridium phage CDKM9, complete genome) position: , mismatch: 10, identity: 0.688 

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

50. spacer 4.10|3684467|32|CP034968|CRISPRCasFinder,CRT matches to KX228400 (Clostridium phage CDKM15, complete genome) position: , mismatch: 10, identity: 0.688 

ttgcagggcgatattgttgttggtgaatggga	CRISPR spacer
agtgaaaatgatattgttgttgaggaatggga	Protospacer
    *....*************. ********

51. spacer 4.16|3684833|32|CP034968|CRISPRCasFinder,CRT matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 10, identity: 0.688 

ccacgttcggcgatgttggccccatcggtcca	CRISPR spacer
actcgttcggcgatgtggcccccatccaggtg	Protospacer
 * ************* * ******* .  ..

52. spacer 5.9|3685547|32|CP034968|CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688 

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

53. spacer 5.9|3685547|32|CP034968|CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688 

aggggcgttccgcagtcgacaagggctgaaaa	CRISPR spacer
ccgggcggtccgcagtcgacgagggtgaggga	Protospacer
  ***** ************.****. ....*

54. spacer 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

55. spacer 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_HG938356 (Neorhizobium galegae bv. officinalis bv. officinalis str. HAMBI 1141 plasmid pHAMBI1141a, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

56. spacer 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP040822 (Paraoceanicella profunda strain D4M1 plasmid pD4M1D, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgactcgatcgccttccagaccaaccttctgg	Protospacer
.   .***** ************ ****.  .

57. spacer 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

58. spacer 3.1|3667025|32|CP034968|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 11, identity: 0.656 

tttgccgatccccttccagaccaccctttaca	CRISPR spacer
cgacgagatcgccttccagaccaaccttttgg	Protospacer
.     **** ************ *****  .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 565150 : 620732 64 Salmonella_phage(32.65%) portal,holin,transposase,terminase,integrase,tRNA,head,tail,capsid attL 560036:560055|attR 609133:609152
DBSCAN-SWA_2 759171 : 843891 93 Salmonella_phage(44.44%) protease,portal,holin,lysis,terminase,tRNA,tail NA
DBSCAN-SWA_3 908021 : 916752 8 Enterobacteria_phage(16.67%) transposase,protease NA
DBSCAN-SWA_4 1500548 : 1542969 66 Salmonella_virus(64.06%) protease,portal,lysis,terminase,coat,integrase,tail attL 1488784:1488798|attR 1544316:1544330
DBSCAN-SWA_5 2299057 : 2343574 45 Burkholderia_phage(42.86%) plate,tail,tRNA NA
DBSCAN-SWA_6 3940086 : 4047115 104 Salmonella_phage(38.89%) protease,holin,transposase,lysis,terminase,integrase,tRNA,head,tail attL 3990512:3990527|attR 4013503:4013518
DBSCAN-SWA_7 4387412 : 4399712 11 Salmonella_phage(45.45%) holin,tail NA
DBSCAN-SWA_8 4471761 : 4480932 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_9 4549240 : 4559746 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_10 4645738 : 4696485 69 Salmonella_phage(88.52%) protease,portal,plate,holin,lysis,terminase,integrase,head,tail attL 4640316:4640330|attR 4656791:4656805
DBSCAN-SWA_11 4800524 : 4807330 11 Salmonella_phage(33.33%) integrase,tail attL 4802734:4802756|attR 4812446:4812468

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage