Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP034971 Vibrio chagasii strain ECSMB14107 chromosome 2, complete sequence 1 crisprs NA 0 0 0 0
CP034970 Vibrio chagasii strain ECSMB14107 chromosome 1, complete sequence 2 crisprs NA 0 1 0 0

Results visualization

1. CP034971
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034971_1 1649289-1649371 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP034970
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034970_1 912275-912392 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP034970_2 2481632-2481782 Orphan I-F
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP034970_2 2.2|2481723|29|CP034970|CRISPRCasFinder 2481723-2481751 29 NZ_CP015921 Pediococcus pentosaceus strain wikim20 plasmid pKPP03, complete sequence 2931-2959 7 0.759

1. spacer 2.2|2481723|29|CP034970|CRISPRCasFinder matches to NZ_CP015921 (Pediococcus pentosaceus strain wikim20 plasmid pKPP03, complete sequence) position: , mismatch: 7, identity: 0.759

ctcaaccgtttaagaaaaggaatattcac	CRISPR spacer
ttacaatttttaagaaaaggaatatttac	Protospacer
.*  * . ******************.**

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage