CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number	Prophage number	Anti-CRISPR protein number
CP034191	Mycobacteroides abscessus strain GZ0 1 chromosome, complete genome	1 crisprs	NA	0	2	0	0

Results visualization

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP034191_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP034191_1

3651263-3651499

Orphan

Consensus_repeat	Method
NCCGGCGGCAANGGCGGC	CRT

4 spacers

The CRISPR arrays of CP034191_1

>merge|CP034191|1|3651263-3651499|CRT
CGCGGCGGCAACGGCGGGCACGGAGGAGCAGGCGGAACCGGAGGCACCGGCGGCAAAGGCGGCGACGGGGACGACTGCGAATTCGGCAGAACCGGCGGCAACGGCGGCACCGGGGGGCGCGGCGGAGACGGAAATTTCGCCGGTACCGGCGGCAACGGCGGCGCCATCCTCGTCAAATGCCAGCACGACCTGTCCCTGGGCACCCACCCGATGGACGTGTCGGCCGGCACGGGCGGC

>CP034191|1|1|3651263-3651499|CRT
CGCGGCGGCAACGGCGGG	CACGGAGGAGCAGGCGGAACCGGAGGC
ACCGGCGGCAAAGGCGGC	GACGGGGACGACTGCGAATTCGGCAGA
ACCGGCGGCAACGGCGGC	ACCGGGGGGCGCGGCGGAGACGGAAATTTCGCCGGT
ACCGGCGGCAACGGCGGC	GCCATCCTCGTCAAATGCCAGCACGACCTGTCCCTGGGCACCCACCCGATGGACGTG
TCGGCCGGCACGGGCGGC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	MF140397	Arthrobacter phage Abidatro, complete genome	37516-37542	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NC_003037	Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence	580722-580748	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NC_020527	Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence	580390-580416	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP032685	Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence	1428875-1428901	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NC_019848	Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence	903089-903115	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP032690	Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence	1428853-1428879	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP021798	Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence	137845-137871	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP021796	Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence	106941-106967	4	0.852
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NC_012853	Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence	120961-120987	6	0.778
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP024587	Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence	83823-83849	6	0.778
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP012399	Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence	444070-444096	6	0.778
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP012915	Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence	47017-47043	6	0.778
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	KT224359	Bacillus phage TsarBomba, complete genome	51748-51774	6	0.778
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NC_015147	Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence	87623-87649	6	0.778
CP034191_1	1.1\|3651281\|27\|CP034191\|CRT	3651281-3651307	27	NZ_CP032340	Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence	338995-339021	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_LT703507	Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3	66353-66379	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_CP015273	Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence	58577-58603	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_CP029333	Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence	107327-107353	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_CP045964	Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence	49820-49846	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NC_022654	Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence	50360-50386	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_CP015280	Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence	41759-41785	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_CP023153	Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence	29396-29422	6	0.778
CP034191_1	1.2\|3651326\|27\|CP034191\|CRT	3651326-3651352	27	NZ_CP019224	Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence	74501-74527	6	0.778

1. spacer 1.1|3651281|27|CP034191|CRT matches to MF140397 (Arthrobacter phage Abidatro, complete genome) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gccggaggagcgggcggaaccggcggc	Protospacer
  *********.*********** ***

2. spacer 1.1|3651281|27|CP034191|CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gacggaggagcagccggagccggagcc	Protospacer
 ************ ****.****** *

3. spacer 1.1|3651281|27|CP034191|CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gacggaggagcagccggagccggagcc	Protospacer
 ************ ****.****** *

4. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP032685 (Rhizobium sp. CCGE531 plasmid pRCCGE531d, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
aaaggaggagcaggcggaaccgtcggc	Protospacer
 * *******************  ***

5. spacer 1.1|3651281|27|CP034191|CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gacggaggagcagccggagccggagcc	Protospacer
 ************ ****.****** *

6. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP032690 (Rhizobium sp. CCGE532 plasmid pRCCGE532d, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
aaaggaggagcaggcggaaccgtcggc	Protospacer
 * *******************  ***

7. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gacggaggagcagccggagccggagcc	Protospacer
 ************ ****.****** *

8. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP021796 (Sinorhizobium meliloti strain USDA1157 plasmid accessoryA, complete sequence) position: , mismatch: 4, identity: 0.852

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gacggaggagcagccggagccggagcc	Protospacer
 ************ ****.****** *

9. spacer 1.1|3651281|27|CP034191|CRT matches to NC_012853 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132503, complete sequence) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
aacggatgagcaggcggaaccggcctt	Protospacer
 ***** ****************   .

10. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP024587 (Roseomonas sp. FDAARGOS_362 plasmid unnamed3, complete sequence) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gaggcaggagcaggcggaaccggatcg	Protospacer
 * * *******************

11. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
gctcgaggagcaggcggaaccggtagc	Protospacer
  . ******************* .**

12. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
cacggaggtccaggcggaaccggtcca	Protospacer
********  *************

13. spacer 1.1|3651281|27|CP034191|CRT matches to KT224359 (Bacillus phage TsarBomba, complete genome) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
ggcggaggagcaggcggaaacgtagca	Protospacer
 .***************** ** **

14. spacer 1.1|3651281|27|CP034191|CRT matches to NC_015147 (Pseudarthrobacter phenanthrenivorans Sphe3 plasmid pASPHE302, complete sequence) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
cacggaggagcaggcgggacaggtccg	Protospacer
*****************.** **

15. spacer 1.1|3651281|27|CP034191|CRT matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 6, identity: 0.778

cacggaggagcaggcggaaccggaggc	CRISPR spacer
cacggaggtccaggcggaaccggtcca	Protospacer
********  *************

16. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_LT703507 (Mycobacterium chimaera strain Mycobacterium chimaera MC045 isolate Mycobacterium chimaera plasmid 3) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

17. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_CP015273 (Mycobacterium chimaera strain ZUERICH-1 plasmid unnamed 1, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

18. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_CP029333 (Mycobacterium avium subsp. hominissuis strain MAC109 plasmid pMAC109a, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

19. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_CP045964 (Mycobacterium chimaera strain AUSMDU00007395 plasmid pAUSMDU00007395_01, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

20. spacer 1.2|3651326|27|CP034191|CRT matches to NC_022654 (Mycobacterium kansasii ATCC 12478 plasmid pMK12478, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

21. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_CP015280 (Mycobacterium chimaera strain DSM 44623 plasmid unnamed 2, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

22. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_CP023153 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_2, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

23. spacer 1.2|3651326|27|CP034191|CRT matches to NZ_CP019224 (Mycobacterium chimaera strain CDC 2015-22-71 plasmid pDHQP20152271_1, complete sequence) position: , mismatch: 6, identity: 0.778

gacggggacgactgcgaattcggcaga	CRISPR spacer
cacgggcacgaccgcgaattcggcccc	Protospacer
 ***** *****.***********

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage