Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035105 Helicobacter pylori strain Hpbs2 chromosome, complete genome 3 crisprs NA 0 1 0 0

Results visualization

1. CP035105
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035105_1 538329-538531 Orphan I-B
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035105_2 786981-787054 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035105_3 834084-834175 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035105_1 1.2|538415|31|CP035105|CRISPRCasFinder,CRT 538415-538445 31 NZ_CP032533 Bacillus megaterium NCT-2 plasmid pNCT2_5, complete sequence 27066-27096 9 0.71
CP035105_1 1.2|538415|31|CP035105|CRISPRCasFinder,CRT 538415-538445 31 NZ_CP035095 Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed1, complete sequence 291581-291611 9 0.71
CP035105_1 1.2|538415|31|CP035105|CRISPRCasFinder,CRT 538415-538445 31 NZ_CP045274 Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence 87744-87774 9 0.71
CP035105_1 1.2|538415|31|CP035105|CRISPRCasFinder,CRT 538415-538445 31 NZ_CP009921 Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_2, complete sequence 185365-185395 9 0.71
CP035105_1 1.2|538415|31|CP035105|CRISPRCasFinder,CRT 538415-538445 31 NZ_CP022523 Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence 752262-752292 9 0.71

1. spacer 1.2|538415|31|CP035105|CRISPRCasFinder,CRT matches to NZ_CP032533 (Bacillus megaterium NCT-2 plasmid pNCT2_5, complete sequence) position: , mismatch: 9, identity: 0.71 

ttgctgttttcaaaaacagattgagtgctat	CRISPR spacer
ttacagttttcaaaaacagattggtcaaaag	Protospacer
**.* ******************. ..  *

2. spacer 1.2|538415|31|CP035105|CRISPRCasFinder,CRT matches to NZ_CP035095 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.71 

ttgctgttttcaaaaacagattgagtgctat	CRISPR spacer
ttacagttttcaaaaacagattggtcaaaag	Protospacer
**.* ******************. ..  *

3. spacer 1.2|538415|31|CP035105|CRISPRCasFinder,CRT matches to NZ_CP045274 (Bacillus megaterium strain FDU301 plasmid pFDU301B, complete sequence) position: , mismatch: 9, identity: 0.71 

ttgctgttttcaaaaacagattgagtgctat	CRISPR spacer
ttacagttttcaaaaacagattggtcaaaag	Protospacer
**.* ******************. ..  *

4. spacer 1.2|538415|31|CP035105|CRISPRCasFinder,CRT matches to NZ_CP009921 (Bacillus megaterium NBRC 15308 = ATCC 14581 plasmid pBMV_2, complete sequence) position: , mismatch: 9, identity: 0.71 

ttgctgttttcaaaaacagattgagtgctat	CRISPR spacer
ttacagttttcaaaaacagattggtcaaaag	Protospacer
**.* ******************. ..  *

5. spacer 1.2|538415|31|CP035105|CRISPRCasFinder,CRT matches to NZ_CP022523 (Pseudoalteromonas sp. NC201 plasmid pNC201, complete sequence) position: , mismatch: 9, identity: 0.71 

ttgctgttttcaaaaacagattgagtgctat	CRISPR spacer
ttgctgttttcaaaaggagattgccttgatc	Protospacer
***************. ******  *    .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage