1. spacer 1.20|931460|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to KF024733 (Mycobacterium phage Medusa, complete genome) position: , mismatch: 8, identity: 0.765
ctcgggcgggacggactacggcggg----gtggccctg CRISPR spacer
ctcgggcgggtcggactacgacgggcccaacggc---- Protospacer
********** *********.**** ..***
2. spacer 1.20|931460|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to MT889382 (Mycobacterium phage TroyPia, complete genome) position: , mismatch: 8, identity: 0.765
ctcgggcgggacggactacggcggg----gtggccctg CRISPR spacer
ctcgggcgggtcggactacgacgggcccaacggc---- Protospacer
********** *********.**** ..***
3. spacer 1.10|930794|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.735
cggcaggccgctcgcgagcggctgctggcccgga CRISPR spacer
ccgggggccgcgcgcgagcggctgctcgccgaac Protospacer
* * .****** ************** *** ..
4. spacer 1.15|931126|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050138 (Sphingomonas sp. CL5.1 plasmid pTSSC1, complete sequence) position: , mismatch: 9, identity: 0.735
cgtaacccgcggcccattccggccagaagatcgc CRISPR spacer
tgaggcacgcggcccattgcggcccgaagatcat Protospacer
.* ..* *********** ***** *******..
5. spacer 1.16|931192|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NC_015057 (Granulicella tundricola MP5ACTX9 plasmid pACIX901, complete sequence) position: , mismatch: 9, identity: 0.727
tcccgcgacctcatcttccccgcccatgatctc CRISPR spacer
tcccgcctcctcatcttccccgccgtcctcatc Protospacer
****** **************** . . **
6. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
7. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
8. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
9. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
10. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
11. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
12. spacer 1.30|932120|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.727
cgggatgagcttcggttattcctgcaagatctg CRISPR spacer
tgggatgatcttcggttgttcctgcacgtcgct Protospacer
.******* ********.******** * . .
13. spacer 1.45|933115|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022994 (Paraburkholderia aromaticivorans strain BN5 plasmid pBN4, complete sequence) position: , mismatch: 9, identity: 0.743
tcagggcttctggcagagcttggcgacgttcccgt CRISPR spacer
gcgcagcttccggcagagcttggcgaggttgtcgg Protospacer
*. .*****.*************** *** .**
14. spacer 1.48|933314|34|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017300 (Rhodococcus sp. YL-1 plasmid pYLC1, complete sequence) position: , mismatch: 9, identity: 0.735
tacgaggatcgcagagatcctcgcagaggccgtg CRISPR spacer
ggcgaggatcgcagcgatcctcgccgatgacaac Protospacer
.************ ********* ** * *.
15. spacer 1.48|933314|34|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034154 (Rhodococcus sp. NJ-530 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.735
tacgaggatcgcagagatcctcgcagaggccgtg CRISPR spacer
ggcgaggatcgcagcgatcctcgccgatgacaac Protospacer
.************ ********* ** * *.
16. spacer 1.10|930794|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 10, identity: 0.706
cggcaggccgctcgcgagcggctgctggcccgga CRISPR spacer
gacccggccgcccgcgagcggctgctgaccttcg Protospacer
. * ******.***************.**. .
17. spacer 1.10|930794|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134466 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence) position: , mismatch: 10, identity: 0.706
cggcaggccgctcgcgagcggctgctggcccgga CRISPR spacer
gacctcgccgcgcgcgagcggctgctgaccacgg Protospacer
. * ***** ***************.** *.
18. spacer 1.10|930794|34|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 10, identity: 0.706
cggcaggccgctcgcgagcggctgctggcccgga CRISPR spacer
tggcaggcagctcgcgagctgctgcgaagccccg Protospacer
.******* ********** ***** .. ** .
19. spacer 1.16|931192|33|CP034928|PILER-CR,CRISPRCasFinder,CRT matches to NC_034248 (Rhizobium phage RHEph10, complete genome) position: , mismatch: 10, identity: 0.697
tcccgcgacctcatcttccccgcccatgatctc CRISPR spacer
acccgctacctcaacttccccgccctcctctac Protospacer
***** ****** *********** . .. *
20. spacer 1.38|932649|34|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP018921 (Pseudonocardia autotrophica strain NBRC 12743 plasmid pPA12743CP, complete sequence) position: , mismatch: 10, identity: 0.706
gtagagcgctacaccgaaggcacgagcgccgccc CRISPR spacer
accacgcgcaacaccgacggcacgagcgccagcg Protospacer
.. . **** ******* ************. *
21. spacer 1.40|932782|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
gttgagcgtccgcacatctgccaacagctcccaca CRISPR spacer
gttgagcgtcggcacatctgcaaacgttggcttcg Protospacer
********** ********** ***. . *. *.
22. spacer 1.40|932782|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
gttgagcgtccgcacatctgccaacagctcccaca CRISPR spacer
gttgagcgtcggcacatctgcaaacgttggcttcg Protospacer
********** ********** ***. . *. *.
23. spacer 1.40|932782|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.714
gttgagcgtccgcacatctgccaacagctcccaca CRISPR spacer
gttgagcgtcggcacatctgcaaacgttggcttcg Protospacer
********** ********** ***. . *. *.
24. spacer 1.45|933115|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006990 (Rhizobium sp. IE4771 plasmid pRetIE4771d, complete sequence) position: , mismatch: 11, identity: 0.686
tcagggcttctggcagagcttggcgacgttcccgt CRISPR spacer
cgttagcgtctggccgagcttggcgacgttgatct Protospacer
. .** ****** *************** . *
25. spacer 1.45|933115|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021127 (Rhizobium sp. Kim5 plasmid pRetKim5c, complete sequence) position: , mismatch: 11, identity: 0.686
tcagggcttctggcagagcttggcgacgttcccgt CRISPR spacer
cgttagcgtctggccgagcttggcgacgttgatct Protospacer
. .** ****** *************** . *
26. spacer 1.45|933115|35|CP034928|CRISPRCasFinder,CRT,PILER-CR matches to CP007644 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803c, complete sequence) position: , mismatch: 11, identity: 0.686
tcagggcttctggcagagcttggcgacgttcccgt CRISPR spacer
cgttagcgtctggccgagcttggcgacgttgatct Protospacer
. .** ****** *************** . *