Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP019384 Vampirococcus sp. LiM chromosome, complete genome 3 crisprs RT,cas3,csa3 1 0 7 0

Results visualization

1. CP019384
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP019384_1 875578-875727 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP019384_2 1062302-1062425 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP019384_3 1625552-1625657 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP019384_3 3.1|1625587|36|CP019384|CRISPRCasFinder 1625587-1625622 36 CP019384.1 833738-833773 1 0.972

1. spacer 3.1|1625587|36|CP019384|CRISPRCasFinder matches to position: 833738-833773, mismatch: 1, identity: 0.972

tcctgacaaaattaaggatcacgcttcttttgccga	CRISPR spacer
tcctgacaaaattaagggtcacgcttcttttgccga	Protospacer
*****************.******************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 322420 : 330188 9 uncultured_marine_virus(16.67%) protease NA
DBSCAN-SWA_2 435380 : 442616 10 uncultured_Caudovirales_phage(16.67%) NA NA
DBSCAN-SWA_3 1003993 : 1012877 7 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_4 1031346 : 1041237 7 Klosneuvirus(33.33%) tRNA NA
DBSCAN-SWA_5 1536387 : 1548591 11 Bacillus_phage(12.5%) NA NA
DBSCAN-SWA_6 1863341 : 1892807 34 uncultured_Mediterranean_phage(11.11%) portal,tail,terminase,protease,capsid NA
DBSCAN-SWA_7 1963461 : 1971145 9 Tupanvirus(16.67%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage