1. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to EF116926 (Streptococcus phage SMP, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
ataacttcaaagccattgttctcctctgct Protospacer
* .****************** ***. *
2. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581091 (Vibrio phage Cla, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
3. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581096 (Vibrio phage pVa-5, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
4. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to MK672804 (Vibrio phage Va_178/90_p41, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
5. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581093 (Vibrio phage Pel, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
6. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581097 (Vibrio phage pVa-6, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
7. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KY658677 (Vibrio phage P3, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
8. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581090 (Vibrio phage Her, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
9. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KY658678 (Vibrio phage pVa-3, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
10. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KY658679 (Vibrio phage pVa-4, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
11. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to MK672800 (Vibrio phage Va_90-11-287_p41_Ba35, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
12. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to MK672799 (Vibrio phage Va_90-11-287_p41, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
13. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581092 (Vibrio phage Len, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
14. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581094 (Vibrio phage pVa-2, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
15. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to MK672803 (Vibrio phage Va_91-7-154_p41, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
16. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KY658680 (Vibrio phage pVa-8, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
17. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KY658675 (Vibrio phage H20, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
18. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581095 (Vibrio phage pVa-1, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
19. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581099 (Vibrio phage Strym, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
20. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to MK672801 (Vibrio phage Va_90-11-287_p41_T265, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
21. spacer 2.1|1524715|30|CP035266|CRISPRCasFinder,CRT matches to KX581100 (Vibrio phage pVa-7, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
22. spacer 2.5|1524717|30|CP035266|PILER-CR matches to EF116926 (Streptococcus phage SMP, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
ataacttcaaagccattgttctcctctgct Protospacer
* .****************** ***. *
23. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581091 (Vibrio phage Cla, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
24. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581096 (Vibrio phage pVa-5, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
25. spacer 2.5|1524717|30|CP035266|PILER-CR matches to MK672804 (Vibrio phage Va_178/90_p41, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
26. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581093 (Vibrio phage Pel, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
27. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581097 (Vibrio phage pVa-6, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
28. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KY658677 (Vibrio phage P3, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
29. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581090 (Vibrio phage Her, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
30. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KY658678 (Vibrio phage pVa-3, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
31. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KY658679 (Vibrio phage pVa-4, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
32. spacer 2.5|1524717|30|CP035266|PILER-CR matches to MK672800 (Vibrio phage Va_90-11-287_p41_Ba35, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
33. spacer 2.5|1524717|30|CP035266|PILER-CR matches to MK672799 (Vibrio phage Va_90-11-287_p41, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
34. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581092 (Vibrio phage Len, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
35. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581094 (Vibrio phage pVa-2, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
36. spacer 2.5|1524717|30|CP035266|PILER-CR matches to MK672803 (Vibrio phage Va_91-7-154_p41, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
37. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KY658680 (Vibrio phage pVa-8, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
38. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KY658675 (Vibrio phage H20, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
39. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581095 (Vibrio phage pVa-1, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
40. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581099 (Vibrio phage Strym, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
41. spacer 2.5|1524717|30|CP035266|PILER-CR matches to MK672801 (Vibrio phage Va_90-11-287_p41_T265, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
42. spacer 2.5|1524717|30|CP035266|PILER-CR matches to KX581100 (Vibrio phage pVa-7, complete genome) position: , mismatch: 7, identity: 0.767
aacttttcaaagccattgttctcatctagt CRISPR spacer
aagctaagtaagccattgttatcatctagt Protospacer
** .* *********** *********
43. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 8, identity: 0.733
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
atttacttcaaatcaacaagcaattaattt Protospacer
. *********** *********.* *
44. spacer 2.4|1524913|30|CP035266|CRISPRCasFinder,CRT matches to MN693171 (Marine virus AFVG_25M555, complete genome) position: , mismatch: 8, identity: 0.733
aacgttaataattccgttccataacccgct CRISPR spacer
taaactaatccttccgttccataacccgta Protospacer
* ..**** *****************.
45. spacer 2.7|1524849|30|CP035266|PILER-CR matches to NZ_CP047444 (Spiroplasma citri strain BLH-MB plasmid pSciBLHMB-7) position: , mismatch: 8, identity: 0.733
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
atttacttcaaatcaacaagcaattaattt Protospacer
. *********** *********.* *
46. spacer 2.8|1524915|30|CP035266|PILER-CR matches to MN693171 (Marine virus AFVG_25M555, complete genome) position: , mismatch: 8, identity: 0.733
aacgttaataattccgttccataacccgct CRISPR spacer
taaactaatccttccgttccataacccgta Protospacer
* ..**** *****************.
47. spacer 2.2|1524781|30|CP035266|CRISPRCasFinder,CRT matches to NC_015710 (Simkania negevensis Z plasmid pSn, complete sequence) position: , mismatch: 9, identity: 0.7
cgttcggtacagaaaagcgtgtcaaaagcc CRISPR spacer
aaaactgtagagaaaagcgtgtcaaaaatt Protospacer
. * *** *****************...
48. spacer 2.6|1524783|30|CP035266|PILER-CR matches to NC_015710 (Simkania negevensis Z plasmid pSn, complete sequence) position: , mismatch: 9, identity: 0.7
cgttcggtacagaaaagcgtgtcaaaagcc CRISPR spacer
aaaactgtagagaaaagcgtgtcaaaaatt Protospacer
. * *** *****************...
49. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497078 (Flavobacterium phage vB_Fsp_elemo10-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
50. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497108 (Flavobacterium phage vB_Fsp_elemo4-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
51. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497121 (Flavobacterium phage vB_Fsp_elemo8-1D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
52. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497101 (Flavobacterium phage vB_Fsp_elemo2-5B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
53. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497069 (Flavobacterium phage vB_Fsp_elemo15-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
54. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497123 (Flavobacterium phage vB_Fsp_elemo8-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
55. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497079 (Flavobacterium phage vB_Fsp_elemo10-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
56. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497094 (Flavobacterium phage vB_Fsp_elemo14-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
57. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497076 (Flavobacterium phage vB_Fsp_elemo1-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
58. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497115 (Flavobacterium phage vB_Fsp_elemo7-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
59. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497082 (Flavobacterium phage vB_Fsp_elemo11-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
60. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497088 (Flavobacterium phage vB_Fsp_elemo13-1E, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
61. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497085 (Flavobacterium phage vB_Fsp_elemo12-3A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
62. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497095 (Flavobacterium phage vB_Fsp_elemo14-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
63. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497110 (Flavobacterium phage vB_Fsp_elemo5-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
64. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497096 (Flavobacterium phage vB_Fsp_elemo15-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
65. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497114 (Flavobacterium phage vB_Fsp_elemo7-3A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
66. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497120 (Flavobacterium phage vB_Fsp_elemo8-1B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
67. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497087 (Flavobacterium phage vB_Fsp_elemo13-1B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
68. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497117 (Flavobacterium phage vB_Fsp_elemo7-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
69. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497119 (Flavobacterium phage vB_Fsp_elemo8-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
70. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497112 (Flavobacterium phage vB_Fsp_elemo6-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
71. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497099 (Flavobacterium phage vB_Fsp_elemo15-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
72. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497097 (Flavobacterium phage vB_Fsp_elemo15-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
73. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497089 (Flavobacterium phage vB_Fsp_elemo13-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
74. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497070 (Flavobacterium phage vB_Fsp_elemo2-5C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
75. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497017 (Flavobacterium phage vB_Fsp_elemo7-9A, complete genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
76. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497109 (Flavobacterium phage vB_Fsp_elemo5-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
77. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497104 (Flavobacterium phage vB_Fsp_elemo2-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
78. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497125 (Flavobacterium phage vB_Fsp_elemo9-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
79. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497118 (Flavobacterium phage vB_Fsp_elemo7-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
80. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497072 (Flavobacterium phage vB_Fsp_elemo6-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
81. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497077 (Flavobacterium phage vB_Fsp_elemo1-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
82. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497068 (Flavobacterium phage vB_Fsp_elemo14-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
83. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497105 (Flavobacterium phage vB_Fsp_elemo3-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
84. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497107 (Flavobacterium phage vB_Fsp_elemo3-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
85. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497091 (Flavobacterium phage vB_Fsp_elemo13-5B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
86. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497113 (Flavobacterium phage vB_Fsp_elemo6-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
87. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497116 (Flavobacterium phage vB_Fsp_elemo7-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
88. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497065 (Flavobacterium phage vB_Fsp_elemo13-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
89. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497122 (Flavobacterium phage vB_Fsp_elemo8-3A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
90. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497106 (Flavobacterium phage vB_Fsp_elemo3-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
91. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497102 (Flavobacterium phage vB_Fsp_elemo2-5F, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
92. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497074 (Flavobacterium phage vB_Fsp_elemo1-5B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
93. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497092 (Flavobacterium phage vB_Fsp_elemo13-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
94. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497098 (Flavobacterium phage vB_Fsp_elemo15-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
95. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497081 (Flavobacterium phage vB_Fsp_elemo11-5C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
96. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497103 (Flavobacterium phage vB_Fsp_elemo2-5G, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
97. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497124 (Flavobacterium phage vB_Fsp_elemo8-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
98. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497093 (Flavobacterium phage vB_Fsp_elemo14-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
99. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497083 (Flavobacterium phage vB_Fsp_elemo11-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
100. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497084 (Flavobacterium phage vB_Fsp_elemo12-1B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
101. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497086 (Flavobacterium phage vB_Fsp_elemo12-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
102. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497067 (Flavobacterium phage vB_Fsp_elemo14-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
103. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497066 (Flavobacterium phage vB_Fsp_elemo13-1C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
104. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497100 (Flavobacterium phage vB_Fsp_elemo2-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
105. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497071 (Flavobacterium phage vB_Fsp_elemo6-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
106. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497080 (Flavobacterium phage vB_Fsp_elemo10-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
107. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497111 (Flavobacterium phage vB_Fsp_elemo5-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
108. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497075 (Flavobacterium phage vB_Fsp_elemo1-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
109. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497073 (Flavobacterium phage vB_Fsp_elemo8-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
110. spacer 2.3|1524847|30|CP035266|CRISPRCasFinder,CRT matches to MT497090 (Flavobacterium phage vB_Fsp_elemo13-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
111. spacer 2.4|1524913|30|CP035266|CRISPRCasFinder,CRT matches to MN694445 (Marine virus AFVG_250M317, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctcgg Protospacer
. .********.************.
112. spacer 2.4|1524913|30|CP035266|CRISPRCasFinder,CRT matches to MN693010 (Marine virus AFVG_117M73, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctcgg Protospacer
. .********.************.
113. spacer 2.4|1524913|30|CP035266|CRISPRCasFinder,CRT matches to MN694695 (Marine virus AFVG_250M866, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctagg Protospacer
. .********.************..
114. spacer 2.4|1524913|30|CP035266|CRISPRCasFinder,CRT matches to MN694652 (Marine virus AFVG_250M647, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctcgg Protospacer
. .********.************.
115. spacer 2.4|1524913|30|CP035266|CRISPRCasFinder,CRT matches to MN694780 (Marine virus AFVG_250M331, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctagg Protospacer
. .********.************..
116. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497078 (Flavobacterium phage vB_Fsp_elemo10-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
117. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497108 (Flavobacterium phage vB_Fsp_elemo4-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
118. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497121 (Flavobacterium phage vB_Fsp_elemo8-1D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
119. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497101 (Flavobacterium phage vB_Fsp_elemo2-5B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
120. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497069 (Flavobacterium phage vB_Fsp_elemo15-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
121. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497123 (Flavobacterium phage vB_Fsp_elemo8-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
122. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497079 (Flavobacterium phage vB_Fsp_elemo10-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
123. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497094 (Flavobacterium phage vB_Fsp_elemo14-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
124. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497076 (Flavobacterium phage vB_Fsp_elemo1-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
125. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497115 (Flavobacterium phage vB_Fsp_elemo7-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
126. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497082 (Flavobacterium phage vB_Fsp_elemo11-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
127. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497088 (Flavobacterium phage vB_Fsp_elemo13-1E, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
128. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497085 (Flavobacterium phage vB_Fsp_elemo12-3A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
129. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497095 (Flavobacterium phage vB_Fsp_elemo14-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
130. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497110 (Flavobacterium phage vB_Fsp_elemo5-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
131. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497096 (Flavobacterium phage vB_Fsp_elemo15-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
132. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497114 (Flavobacterium phage vB_Fsp_elemo7-3A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
133. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497120 (Flavobacterium phage vB_Fsp_elemo8-1B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
134. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497087 (Flavobacterium phage vB_Fsp_elemo13-1B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
135. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497117 (Flavobacterium phage vB_Fsp_elemo7-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
136. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497119 (Flavobacterium phage vB_Fsp_elemo8-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
137. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497112 (Flavobacterium phage vB_Fsp_elemo6-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
138. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497099 (Flavobacterium phage vB_Fsp_elemo15-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
139. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497097 (Flavobacterium phage vB_Fsp_elemo15-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
140. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497089 (Flavobacterium phage vB_Fsp_elemo13-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
141. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497070 (Flavobacterium phage vB_Fsp_elemo2-5C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
142. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497017 (Flavobacterium phage vB_Fsp_elemo7-9A, complete genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
143. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497109 (Flavobacterium phage vB_Fsp_elemo5-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
144. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497104 (Flavobacterium phage vB_Fsp_elemo2-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
145. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497125 (Flavobacterium phage vB_Fsp_elemo9-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
146. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497118 (Flavobacterium phage vB_Fsp_elemo7-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
147. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497072 (Flavobacterium phage vB_Fsp_elemo6-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
148. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497077 (Flavobacterium phage vB_Fsp_elemo1-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
149. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497068 (Flavobacterium phage vB_Fsp_elemo14-3B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
150. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497105 (Flavobacterium phage vB_Fsp_elemo3-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
151. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497107 (Flavobacterium phage vB_Fsp_elemo3-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
152. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497091 (Flavobacterium phage vB_Fsp_elemo13-5B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
153. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497113 (Flavobacterium phage vB_Fsp_elemo6-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
154. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497116 (Flavobacterium phage vB_Fsp_elemo7-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
155. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497065 (Flavobacterium phage vB_Fsp_elemo13-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
156. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497122 (Flavobacterium phage vB_Fsp_elemo8-3A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
157. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497106 (Flavobacterium phage vB_Fsp_elemo3-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
158. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497102 (Flavobacterium phage vB_Fsp_elemo2-5F, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
159. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497074 (Flavobacterium phage vB_Fsp_elemo1-5B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
160. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497092 (Flavobacterium phage vB_Fsp_elemo13-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
161. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497098 (Flavobacterium phage vB_Fsp_elemo15-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
162. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497081 (Flavobacterium phage vB_Fsp_elemo11-5C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
163. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497103 (Flavobacterium phage vB_Fsp_elemo2-5G, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
164. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497124 (Flavobacterium phage vB_Fsp_elemo8-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
165. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497093 (Flavobacterium phage vB_Fsp_elemo14-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
166. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497083 (Flavobacterium phage vB_Fsp_elemo11-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
167. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497084 (Flavobacterium phage vB_Fsp_elemo12-1B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
168. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497086 (Flavobacterium phage vB_Fsp_elemo12-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
169. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497067 (Flavobacterium phage vB_Fsp_elemo14-1A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
170. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497066 (Flavobacterium phage vB_Fsp_elemo13-1C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
171. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497100 (Flavobacterium phage vB_Fsp_elemo2-5A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
172. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497071 (Flavobacterium phage vB_Fsp_elemo6-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
173. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497080 (Flavobacterium phage vB_Fsp_elemo10-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
174. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497111 (Flavobacterium phage vB_Fsp_elemo5-9B, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
175. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497075 (Flavobacterium phage vB_Fsp_elemo1-9A, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
176. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497073 (Flavobacterium phage vB_Fsp_elemo8-9C, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
177. spacer 2.7|1524849|30|CP035266|PILER-CR matches to MT497090 (Flavobacterium phage vB_Fsp_elemo13-3D, partial genome) position: , mismatch: 10, identity: 0.667
ccggacttcaaatcatcaagcaattgagat CRISPR spacer
taaaccttcaattcatcaagcaattgtaga Protospacer
. .. ****** ************** ..
178. spacer 2.8|1524915|30|CP035266|PILER-CR matches to MN694445 (Marine virus AFVG_250M317, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctcgg Protospacer
. .********.************.
179. spacer 2.8|1524915|30|CP035266|PILER-CR matches to MN693010 (Marine virus AFVG_117M73, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctcgg Protospacer
. .********.************.
180. spacer 2.8|1524915|30|CP035266|PILER-CR matches to MN694695 (Marine virus AFVG_250M866, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctagg Protospacer
. .********.************..
181. spacer 2.8|1524915|30|CP035266|PILER-CR matches to MN694652 (Marine virus AFVG_250M647, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctcgg Protospacer
. .********.************.
182. spacer 2.8|1524915|30|CP035266|PILER-CR matches to MN694780 (Marine virus AFVG_250M331, complete genome) position: , mismatch: 10, identity: 0.667
aacgttaataattccgttccataacccgct CRISPR spacer
tggtctaataatttcgttccataacctagg Protospacer
. .********.************..