1. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 0, identity: 1.0
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cggatgatgctgcgggcgatgcccggcgccgc Protospacer
********************************
2. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 1, identity: 0.969
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tggatgatgctgcgggcgatgcccggcgccgc Protospacer
.*******************************
3. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 1, identity: 0.969
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cggatgatgctacgggcgatgcccggcgccgc Protospacer
***********.********************
4. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_021986 (Streptomyces collinus Tu 365 plasmid pSCO2, complete sequence) position: , mismatch: 1, identity: 0.969
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tcggcgcgctgctcggcgtgccggtgctcgtc Protospacer
**** ***************************
5. spacer 13.1|3490144|20|CP028719|CRISPRCasFinder matches to NC_025459 (Aeromonas phage pAh6-C, complete genome) position: , mismatch: 1, identity: 0.95
gttcacggatttccgggatt CRISPR spacer
gttcacggatttccgggatc Protospacer
*******************.
6. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN831789 (Streptomyces leeuwenhoekii strain type strain (C34 = DSM 42122 = NRRL B-24963) plasmid pSLE2) position: , mismatch: 2, identity: 0.938
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cggatgatgcggcgggcggtgcccggcgccgc Protospacer
********** *******.*************
7. spacer 5.16|2616580|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 2, identity: 0.938
aaggcatcgtcgtggtgggcaaggcgttggtg CRISPR spacer
agggcatcgtcgtggtgggcaaggcgatggtg Protospacer
*.************************ *****
8. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 2, identity: 0.938
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
aagccgaccctgcgcgtgccgtgccccacgtt Protospacer
******************** ****** ****
9. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.938
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
ttcacggcggtcttgacgcccttgccgccgcc Protospacer
** ** **************************
10. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 2, identity: 0.933
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cacggcggtcttgacgcccttgccgccgcc Protospacer
** **************************
11. spacer 14.1|4497712|22|CP028719|PILER-CR matches to NZ_CP042998 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_1, complete sequence) position: , mismatch: 2, identity: 0.909
ccggtgtcggtctccccctcgg CRISPR spacer
ccggtgccggtctccccctcga Protospacer
******.**************.
12. spacer 14.1|4497712|22|CP028719|PILER-CR matches to NZ_CP011274 (Planctomyces sp. SH-PL62 plasmid pPL62-1, complete sequence) position: , mismatch: 2, identity: 0.909
ccggtgtcggtctccccctcgg CRISPR spacer
ccggtgccggtctccccctcga Protospacer
******.**************.
13. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP054922 (Streptomyces sp. NA03103 plasmid unnamed2, complete sequence) position: , mismatch: 3, identity: 0.906
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
gcgccctgttcatcaccacactcgccgtgcca Protospacer
********.**********.***********.
14. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP016084 (Streptomyces sp. SAT1 plasmid unnamed4, complete sequence) position: , mismatch: 4, identity: 0.875
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
cggtggtggtcgctgacgtcgaacggcgcgta Protospacer
.*.******************.*********
15. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NC_020894 (Streptomyces hygroscopicus subsp. jinggangensis TL01 plasmid pSHJGH1, complete sequence) position: , mismatch: 4, identity: 0.875
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
aggtggtggtcgctgacgttgaacggcgcgta Protospacer
*.*.***************.**.*********
16. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NC_017766 (Streptomyces hygroscopicus subsp. jinggangensis 5008 plasmid pSHJG1, complete sequence) position: , mismatch: 4, identity: 0.875
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
aggtggtggtcgctgacgttgaacggcgcgta Protospacer
*.*.***************.**.*********
17. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.839
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
cggtcccgcaggcccacccggtcccgcaggc Protospacer
*.*************.* ***********
18. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.839
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
cggtcccgcaggcccacccggtcccgcaggc Protospacer
*.*************.* ***********
19. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.839
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
cggtcccgcaggcccacccggtcccgcaggc Protospacer
*.*************.* ***********
20. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015007 (Aminobacter aminovorans strain KCTC 2477 plasmid pAA02, complete sequence) position: , mismatch: 5, identity: 0.844
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
cgggcgctgtggtcggcgggctcgccgtcggc Protospacer
********** ********* ******. * *
21. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP017076 (Novosphingobium resinovorum strain SA1 plasmid pSA1, complete sequence) position: , mismatch: 5, identity: 0.844
cgggcgctgtcgtcggcggggtcgccgcagtc- CRISPR spacer
cggccgctgtcgtcggcggggt-ggcgcagatg Protospacer
*** ****************** * ***** .
22. spacer 5.17|2616641|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP049814 (Monaibacterium sp. ALG8 plasmid unnamed3, complete sequence) position: , mismatch: 5, identity: 0.844
-cagcgcctggtgtcgtcgggcacggcttccag CRISPR spacer
accgcgtc-ggtgtcgtcgggcagggcgtccag Protospacer
* ***.* ************** *** *****
23. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029359 (Azospirillum sp. CFH 70021 plasmid unnamed4) position: , mismatch: 5, identity: 0.844
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
gcctcgccgctgtccagccggccgttgttgtc Protospacer
*.******* ******** ********** *
24. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049319 (Caballeronia sp. SBC2 plasmid pSBC2-3, complete sequence) position: , mismatch: 5, identity: 0.844
-gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
cgctg-gtgggcgcagcaggccgggcagctgtt Protospacer
** * ****.************ *******.*
25. spacer 5.36|2617801|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 5, identity: 0.844
---agatcctggacttccagcaccgctacgtcttc CRISPR spacer
ccgacatcc---acttccagccccgctacgtcttc Protospacer
* **** ********* *************
26. spacer 5.36|2617801|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 5, identity: 0.844
---agatcctggacttccagcaccgctacgtcttc CRISPR spacer
ccgacatcc---acttccagccccgctacgtcttc Protospacer
* **** ********* *************
27. spacer 5.36|2617801|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 5, identity: 0.844
---agatcctggacttccagcaccgctacgtcttc CRISPR spacer
ccgacatcc---acttccagccccgctacgtcttc Protospacer
* **** ********* *************
28. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MN428050 (Mycobacterium phage Apex, complete genome) position: , mismatch: 5, identity: 0.844
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
acacgctgctcatcaccaggttcgccgtgccg Protospacer
.*.* ************* *.***********
29. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT639648 (Mycobacterium phage Heath, complete genome) position: , mismatch: 5, identity: 0.844
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
acacgctgctcatcaccaggttcgccgtgccg Protospacer
.*.* ************* *.***********
30. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_042034 (Mycobacterium phage ChrisnMich, complete sequence) position: , mismatch: 5, identity: 0.844
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
acacgctgctcatcaccaggttcgccgtgccg Protospacer
.*.* ************* *.***********
31. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NC_004933 (Streptomyces lividans 1326 plasmid SLP2, complete sequence) position: , mismatch: 5, identity: 0.844
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
aggtggtggtcgctgacgtcgaacggcccgaa Protospacer
*.*.******************.**** ** *
32. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015097 (Pelagibaca abyssi strain JLT2014 plasmid pPABY7, complete sequence) position: , mismatch: 5, identity: 0.844
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
tccacggcgaggcgggcggtggtgtcggtcat Protospacer
* .******.* *******************
33. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 5, identity: 0.833
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
atccgcgcccttgacgcccttgccgccgcg Protospacer
. ***** .********************
34. spacer 6.22|2630566|30|CP028719|CRT matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 5, identity: 0.833
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cagcgcggccttgaagcccttgccgccgac Protospacer
* *****.***** ************* *
35. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 5, identity: 0.833
gaccgcggtcttgacgcccttgc-cgccgcc CRISPR spacer
gaccatggtcttgacgcccttgcgcgttgc- Protospacer
****..***************** **..**
36. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP016453 (Sphingobium sp. RAC03 plasmid pBSY17_1, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
ggcgagccgtgccgggcggctgccgcc Protospacer
. .******************** * *
37. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_AP018665 (Sphingobium amiense strain DSM 16289 plasmid pSAMIE_2, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
gatcagccttgcctggcggctgcgggc Protospacer
. * **** **** *************
38. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP053023 (Sphingobium yanoikuyae strain YC-XJ2 plasmid p-B-Sy, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
gatcagccttgcctggcggctgcgggc Protospacer
. * **** **** *************
39. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
acgcgaccgtgccgggccgctgcgggc Protospacer
** ..*********** *********
40. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP022747 (Sphingobium hydrophobicum strain C1 plasmid p1, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
gatcagccttgcctggcggctgcgggc Protospacer
. * **** **** *************
41. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NC_009507 (Sphingomonas wittichii RW1 plasmid pSWIT01, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
gatcagccttgcctggcggctgcgggc Protospacer
. * **** **** *************
42. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP011869 (Pseudonocardia sp. HH130629-09 plasmid pLS1-1, complete sequence) position: , mismatch: 5, identity: 0.815
actgagccgtgccgggcggctgcgggc CRISPR spacer
acgcgaccgtgccgggccgctgcgggc Protospacer
** ..*********** *********
43. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.812
atgaccccggccgagctggaccgc--cgccgagc CRISPR spacer
ctgaccccggccgagctggagcgcgtcgcctt-- Protospacer
******************* *** ****
44. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032324 (Azospirillum brasilense strain MTCC4035 plasmid p3, complete sequence) position: , mismatch: 6, identity: 0.812
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
ggcatgatgctgaggacgatgcccggcgctcc Protospacer
* ********* **.*************. *
45. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cagttgatgctgcgggcgctgcccggcacctt Protospacer
*.* ************** ********.** .
46. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KX879752 (Halomonas phage QHHSV-1, complete genome) position: , mismatch: 6, identity: 0.812
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
agggcgctgtcgtcggtgggctcgccggtctc Protospacer
***************.*** ****** **
47. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.812
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
cggccggtgtcgtcggcggggtcgaggtagcc Protospacer
*** ** ***************** *.**.*
48. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134459 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 17, complete sequence) position: , mismatch: 6, identity: 0.812
-cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tcgcgctcc-tcgtcggcgggctcgccgcggtc Protospacer
** ** *. *********** *******.***
49. spacer 5.22|2616946|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT740728 (Ralstonia phage Anchaing, complete genome) position: , mismatch: 6, identity: 0.812
tcctcccacgtcttgccgacgacctcggcgcc CRISPR spacer
tcctcccacgtctcgcccacgacctcaccgaa Protospacer
*************.*** ********. **
50. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_009475 (Bradyrhizobium sp. BTAi1 plasmid pBBta01, complete sequence) position: , mismatch: 6, identity: 0.812
aagccgac-cctgcgcgtgccctgcccctcgtt CRISPR spacer
-aaccgccgcctgcgcgatccctgcccctcgtc Protospacer
*.*** * ******** *************.
51. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.812
---aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
acgaagcgg---ctgcgcgcgccctgccccgcgtt Protospacer
**** * *******.********** ****
52. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
---aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
acgaagcgg---ctgcgcgcgccctgccccgcgtt Protospacer
**** * *******.********** ****
53. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MH229865 (Streptomyces phage LazerLemon, complete genome) position: , mismatch: 6, identity: 0.812
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
gccgtatccaggggctcgcggccgagggcttc Protospacer
* *. ****** ***************** *
54. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MH825706 (Streptomyces phage Microdon, complete genome) position: , mismatch: 6, identity: 0.812
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
gccgtatccaggggctcgcggccgagggcttc Protospacer
* *. ****** ***************** *
55. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594669 (Variovorax sp. SRS16 plasmid 4) position: , mismatch: 6, identity: 0.812
tcggcctccaggtgctcgcggccga---gggctgc CRISPR spacer
tcggcctccagttgctcgcgcccgacccggac--- Protospacer
*********** ******** **** **.*
56. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 6, identity: 0.812
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
tcggcctccaggcgctcgcgggcgatgcgggc Protospacer
************.******** *** * **
57. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR594673 (Variovorax sp. PBL-E5 plasmid 3) position: , mismatch: 6, identity: 0.812
tcggcctccaggtgctcgcggccga---gggctgc CRISPR spacer
tcggcctccagttgctcgcgcccgacccggac--- Protospacer
*********** ******** **** **.*
58. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023440 (Thauera sp. K11 plasmid pTX1, complete sequence) position: , mismatch: 6, identity: 0.812
---tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
aactc---gcgctgctcggcgtgcccgagctcggc Protospacer
** ***************** * ***** *
59. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MF324914 (Mycobacterium phage Krueger, complete genome) position: , mismatch: 6, identity: 0.812
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tcccggcgctgcgcgacgtgccggtgctgttc Protospacer
** ******** **.************ **
60. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_022331 (Mycobacterium phage Bane1, complete genome) position: , mismatch: 6, identity: 0.812
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
atacgctgctcatcaccaggttcgccgtgccg Protospacer
...* ************* *.***********
61. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KF279413 (Mycobacterium phage Bane2, complete genome) position: , mismatch: 6, identity: 0.812
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
atacgctgctcatcaccaggttcgccgtgccg Protospacer
...* ************* *.***********
62. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP048642 (Streptomyces aureoverticillatus strain HN6 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.812
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ctgtcgtggtcgctgacgtcgaacggcgcgtc Protospacer
*. *****************.********
63. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 6, identity: 0.812
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
aagcggtggtcgatgacgtcgagcaggtagtt Protospacer
************ ***********.* **
64. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 6, identity: 0.812
aagcggtggtcgctgacgtcgagcggcgcgta- CRISPR spacer
atgcggttgtcgctgacgtcgagcga-acgcag Protospacer
* ***** *****************. .**.*
65. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to MN693058 (Marine virus AFVG_25M517, complete genome) position: , mismatch: 6, identity: 0.812
aagcggtggtcgctgacgtcgagcgg-cgcgta CRISPR spacer
catcggtagtcgctgacatcgagcggttgcgt- Protospacer
* ****.*********.******** .****
66. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP000663 (Rhodobacter sphaeroides ATCC 17025 plasmid pRSPA02, complete sequence) position: , mismatch: 6, identity: 0.812
----gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
ctcggtg----accgcccctccgagcaggccgagat Protospacer
*** ***.**.******************
67. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019795 (Thermus thermophilus strain AA2-29 plasmid pAA229, complete sequence) position: , mismatch: 6, identity: 0.812
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaagagggcggtggtgtcggggta Protospacer
.**************************
68. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019793 (Thermus thermophilus strain AA2-20 plasmid pAA220, complete sequence) position: , mismatch: 6, identity: 0.812
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaagagggcggtggtgtcggggta Protospacer
.**************************
69. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to ASHF01000034 (Streptomyces sp. GBA 94-10 plasmid pGBA1, complete sequence, whole genome shotgun sequence) position: , mismatch: 6, identity: 0.812
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
agggcggcgaagagggtggtggtgccggcccg Protospacer
* **************.*******.***.*
70. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_012528 (Deinococcus deserti VCD115 plasmid 3, complete sequence) position: , mismatch: 6, identity: 0.812
-cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
acctaccg-cacccagctcgcccagcagctcga Protospacer
**..*** *********** * *********
71. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054613 (Paenibacillus cellulosilyticus strain KACC 14175 plasmid unnamed4, complete sequence) position: , mismatch: 6, identity: 0.812
-cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gcccatc-tcacgcagctcgacaggcagctcct Protospacer
***..* **** **********.******* *
72. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 6, identity: 0.8
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gtcgcctgtcatgacgaccttgccgccgcc Protospacer
* * * *** ***** *************
73. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 6, identity: 0.8
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gtcgcctgtcatgacgaccttgccgccgcc Protospacer
* * * *** ***** *************
74. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.8
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gtcgcctgtcatgacgaccttgccgccgcc Protospacer
* * * *** ***** *************
75. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 6, identity: 0.8
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gtcgcctgtcatgacgaccttgccgccgcc Protospacer
* * * *** ***** *************
76. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 6, identity: 0.8
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gtcgcctgtcatgacgaccttgccgccgcc Protospacer
* * * *** ***** *************
77. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 6, identity: 0.8
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
ggccgccgtcttggcgcccttgccggccac Protospacer
*.**** ******.*********** * *
78. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
tcgaccaggagctggctgaccgacgccggctc CRISPR spacer
ttctccaggaactggctgaccgacgccagcac Protospacer
*. ******.****************.** *
79. spacer 7.4|2637376|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_012809 (Methylorubrum extorquens AM1 plasmid p2META1, complete sequence) position: , mismatch: 6, identity: 0.812
tcgcccaggccgctgtagtagcgggcgaggtg CRISPR spacer
tcctccacgccgccgtagtagcgggcgagggc Protospacer
** .*** *****.****************
80. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP044425 (Paracoccus pantotrophus strain DSM 2944 plasmid pPAN2, complete sequence) position: , mismatch: 6, identity: 0.778
actgagccgtgccgggcggctgcgggc CRISPR spacer
caagggccatgccgggcggctgcgggt Protospacer
*.***.*****************.
81. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 6, identity: 0.778
actgagccgtgccgggcggctgcgggc CRISPR spacer
ggtgagccgttcccggcggctgcggag Protospacer
. ******** ** ***********.
82. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NC_009620 (Sinorhizobium medicae WSM419 plasmid pSMED01, complete sequence) position: , mismatch: 6, identity: 0.778
actgagccgtgccgggcggctgcgggc CRISPR spacer
gatccgccgtgccgcgcggctgcggga Protospacer
. * ********* ***********
83. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NZ_CP013345 (Sphingopyxis macrogoltabida strain 203N plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778
actgagccgtgccgggcggctgcgggc CRISPR spacer
ggtgagccttgccgggcggctgtggcg Protospacer
. ****** *************.**
84. spacer 18.1|8162105|27|CP028719|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 6, identity: 0.778
actgagccgtgccgggcggctgcgggc CRISPR spacer
ggtgagccgttcccggcggctgcggag Protospacer
. ******** ** ***********.
85. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP030127 (Indioceanicola profundi strain SCSIO 08040 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.774
-----ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
tcgatgga-----caggcccatcagttcccggaggg Protospacer
*** ************ ***** ****
86. spacer 5.4|2615847|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
ttgaccttgtcggtctcgaatgccgcccggat CRISPR spacer
ccgagattgtcggtctcgattgcggcccggag Protospacer
..** ************* *** *******
87. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 7, identity: 0.781
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ctgagcccggccgagctggaccgcatgcgcga Protospacer
*** ******************* ** *
88. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029833 (Azospirillum ramasamyi strain M2T2B2 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ctgagcccggccgagctggaccgcatgcgcga Protospacer
*** ******************* ** *
89. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 7, identity: 0.781
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ctgagcccggccgagctggaccgcatgcgcga Protospacer
*** ******************* ** *
90. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054617 (Azospirillum oryzae strain KACC 14407 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.781
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ctgagcccggccgagctggaccgcatgcgcga Protospacer
*** ******************* ** *
91. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023000 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-B, complete sequence) position: , mismatch: 7, identity: 0.781
atgacc--ccggccgagctggaccgccgccgagc CRISPR spacer
--gatcagccggccgcgctggaccgccggcgcga Protospacer
**.* ******* ************ ** *
92. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014797 (Salipiger profundus strain JLT2016 plasmid pTPRO1, complete sequence) position: , mismatch: 7, identity: 0.781
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
gtgcccgacgccgagctcgaccgccgccgggc Protospacer
.** ** ******** ***********.**
93. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT701597 (Streptomyces phage Sentinel, complete genome) position: , mismatch: 7, identity: 0.781
atgaccccggccgagctggaccgcc-gccgagc CRISPR spacer
tggaccccggccgagcgggagcgcctggcgcg- Protospacer
************** *** **** * ** *
94. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010410 (Xanthomonas sacchari strain R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
ggcatcgtgctgcgcgcgatggccggcgccgg Protospacer
* ** .******* ****** *********
95. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_014120 (Paraburkholderia sp. CCGE1002 plasmid pBC201, complete sequence) position: , mismatch: 7, identity: 0.781
cggatgatgctgcgggcgatgcccggcgccgc- CRISPR spacer
tcgatgatgctgcgggcgat-cccaggttcgcg Protospacer
. ****************** ***.* .***
96. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044217 (Mesorhizobium sp. NIBRBAC000500504 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tcggcgctgtcgtcggcgaggtcgcccgattg Protospacer
. ****************.******* * *
97. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023721 (Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tcgtcgctgtcctcggcggggttgccgcggcc Protospacer
. * ******* **********.*****.*.*
98. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN234198 (Mycobacterium phage Zavala, complete genome) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcggcgctgtcgtcggcggtatcgccacggac Protospacer
***************** .*****.*.* *
99. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KJ567045 (Mycobacterium phage Emerson, complete genome) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcggcgctgtcgtcggcggtatcgccacggac Protospacer
***************** .*****.*.* *
100. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MG962371 (Mycobacterium phage LaterM, complete genome) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcggcgctgtcgtcggcggtatcgccacggac Protospacer
***************** .*****.*.* *
101. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH513977 (Mycobacterium phage Mynx, complete genome) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcggcgctgtcgtcggcggtatcgccacggac Protospacer
***************** .*****.*.* *
102. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033038 (Agrobacterium fabrum strain 12D13 plasmid pAt12D13c, complete sequence) position: , mismatch: 7, identity: 0.781
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
ctgccgctgtcgtcggaggcgtcgccgtggcc Protospacer
* * ************ ** *******..*.*
103. spacer 5.16|2616580|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 7, identity: 0.781
aaggcatcgtcgtggtgggcaaggcgttggtg CRISPR spacer
ccgacatcgtcgtgctgggcaaggcgctgggc Protospacer
*.********** ***********.***
104. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011665 (Streptomyces sp. Mg1 plasmid pSMg1-1, complete sequence) position: , mismatch: 7, identity: 0.781
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
ttcctcccgggacgcggcggccgggtggcaca Protospacer
*.** *************.*********...
105. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP033582 (Streptomyces sp. ADI95-16 plasmid pADI95-16a, complete sequence) position: , mismatch: 7, identity: 0.781
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
ttcctcccgggacgcggcggccgggtggcaca Protospacer
*.** *************.*********...
106. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
gccatgccgggacgcggcgacagggcggcggg Protospacer
** .*************** ***.**** *
107. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.781
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
aggacggactccagggcgccgtcgaggagcag Protospacer
* * *.******* ******** *******
108. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
ccgtccggctccaggtcgtcgccgaccatccg Protospacer
******************.**.** * * *
109. spacer 5.22|2616946|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT114163 (Mycobacterium phage Settecandela, complete genome) position: , mismatch: 7, identity: 0.781
tcctcccacgtcttgccgacgacctcggcgcc CRISPR spacer
gccagcgaggtcttgccgacgtgctcggcgcc Protospacer
** * * ************ *********
110. spacer 5.22|2616946|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MK937592 (Mycobacterium phage Phrappuccino, complete genome) position: , mismatch: 7, identity: 0.781
tcctcccacgtcttgccgacgacctcggcgcc CRISPR spacer
gccagcgaggtcttgccgacgtgctcggcgcc Protospacer
** * * ************ *********
111. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 7, identity: 0.781
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
aagccgatcgtgcgcgtgccctgcttgacgct Protospacer
*******.* **************.. **.*
112. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023740 (Methylosinus trichosporium OB3b plasmid pOB3b3, complete sequence) position: , mismatch: 7, identity: 0.781
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
aagccgatcgtgcgcgtgccctgcttgacgct Protospacer
*******.* **************.. **.*
113. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
--aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
ccgagc--accctgcgcggggcctgcccctcctg Protospacer
.*** ********** * ********** *
114. spacer 5.24|2617068|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007796 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p3, complete sequence) position: , mismatch: 7, identity: 0.781
cggcctg--agcagtgccgacggccgaatcgtca CRISPR spacer
--gcccgtccgcggtgccgacggccggatcgtcg Protospacer
***.* **.*************.******.
115. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041606 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.2, complete sequence) position: , mismatch: 7, identity: 0.781
gcccactggtccagctccggctcggacaggct CRISPR spacer
gcccactggtccagctccgtctcgctgacggc Protospacer
******************* **** * * .
116. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 7, identity: 0.781
-gcccactggtccagctccggctcggacaggct CRISPR spacer
agcgcgc-gggccagcaccggctcggacaggtc Protospacer
** *.* ** ***** **************..
117. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
gaggcgccgatgcccagcaggccgttgttgtt Protospacer
* *****.**.**************** *
118. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
gaggcgccgatgcccagcaggccgttgttgtt Protospacer
* *****.**.**************** *
119. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013052 (Sinorhizobium americanum CCGM7 plasmid A, complete sequence) position: , mismatch: 7, identity: 0.781
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
gcccagacggagtccagcaggccgatgttctt Protospacer
*.*. * *** ************* ******
120. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MH536815 (Streptomyces phage Crosby, complete genome) position: , mismatch: 7, identity: 0.781
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
ggcgtatccaggggctcgcggccgagggcttc Protospacer
*. ****** ***************** *
121. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
tggccctgcgggtgctcgcggccgaggccgtc Protospacer
* * *** *.***************** * *
122. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
--tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
tgccggc--gaaggtcttcgcggccgagggctgc Protospacer
.**** **** .*****************
123. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccgaggcgctgctcggcgggccggtacggctc Protospacer
.**.************** ******.* **
124. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccgaggcgctgctcggcgggccggtacggctc Protospacer
.**.************** ******.* **
125. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
acgacgcgctgcccggcgtgccggtgttcgaa Protospacer
**. *******.*************.***
126. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
cggcggcgctgatcggcgtgctggtgctgatc Protospacer
. * ******* *********.****** .**
127. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017966 (Tistrella mobilis KA081020-065 plasmid pTM2, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccgggccgctgcacggcgtgccggtgacgatc Protospacer
.**** ****** ************* . .**
128. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032348 (Azospirillum brasilense strain MTCC4039 plasmid p4, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcggggcgctgcacggcgtgccgctggcccac Protospacer
*********** ********** ** .* *
129. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016613 (Ralstonia solanacearum FJAT-91 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
130. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021449 (Ralstonia solanacearum strain SEPPX05 plasmid pSEPPX05, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
131. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP023013 (Ralstonia solanacearum strain T110 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
132. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049790 (Ralstonia solanacearum strain 202 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
133. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049794 (Ralstonia solanacearum strain 204 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
134. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049788 (Ralstonia solanacearum strain B2 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
135. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022766 (Ralstonia solanacearum strain T78 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
136. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039340 (Ralstonia solanacearum strain UW386 plasmid pUW386, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
137. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021763 (Ralstonia pseudosolanacearum strain RS 476 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
138. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015116 (Ralstonia solanacearum strain EP1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
139. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016555 (Ralstonia solanacearum FJAT-1458 plasmid plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
140. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049792 (Ralstonia solanacearum strain 203 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
141. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052069 (Ralstonia solanacearum strain FJAT91.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
142. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016915 (Ralstonia solanacearum strain CQPS-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
143. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016905 (Ralstonia solanacearum strain KACC 10709 plasmid unnamed1) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
144. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025986 (Ralstonia solanacearum strain RSCM plasmid p-unname2, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
145. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022769 (Ralstonia solanacearum strain T60 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
146. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP034351 (Streptomyces sp. W1SF4 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccgctccggtgctcggcgcgccggtgctcgac Protospacer
.** ** *********.*********** *
147. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015851 (Ralstonia solanacearum strain YC40-M plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
148. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022773 (Ralstonia solanacearum strain T42 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
149. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022783 (Ralstonia solanacearum strain SL3755 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
150. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
151. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022795 (Ralstonia solanacearum strain SL2330 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
152. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052071 (Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
153. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022482 (Ralstonia solanacearum strain HA4-1 plasmid HA4-1MP, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
154. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP009763 (Ralstonia solanacearum OE1-1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
155. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP023015 (Ralstonia solanacearum strain T25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
156. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022779 (Ralstonia solanacearum strain SL3882 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
157. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052075 (Ralstonia solanacearum strain FJAT448.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
158. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052085 (Ralstonia solanacearum strain FJAT15353.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
159. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052095 (Ralstonia solanacearum strain FJAT15340.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
160. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052105 (Ralstonia solanacearum strain FJAT15252.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
161. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052077 (Ralstonia solanacearum strain FJAT445.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
162. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052087 (Ralstonia solanacearum strain FJAT15353.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
163. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052097 (Ralstonia solanacearum strain FJAT15304.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
164. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052115 (Ralstonia solanacearum strain FJAT1463.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
165. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052127 (Ralstonia solanacearum strain FJAT1303.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
166. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052079 (Ralstonia solanacearum strain FJAT445.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
167. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052089 (Ralstonia solanacearum strain FJAT15353.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
168. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052093 (Ralstonia solanacearum strain FJAT15340.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
169. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052101 (Ralstonia solanacearum strain FJAT15304.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
170. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052099 (Ralstonia solanacearum strain FJAT15304.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
171. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052107 (Ralstonia solanacearum strain FJAT15249.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
172. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022781 (Ralstonia solanacearum strain SL3822 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
173. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052117 (Ralstonia solanacearum strain FJAT1463.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
174. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052125 (Ralstonia solanacearum strain FJAT1452.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
175. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022793 (Ralstonia solanacearum strain SL2729 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
176. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022785 (Ralstonia solanacearum strain SL3730 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
177. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022787 (Ralstonia solanacearum strain SL3300 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
178. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022756 (Ralstonia solanacearum strain T117 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
179. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052129 (Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
180. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052121 (Ralstonia solanacearum strain FJAT1458.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
181. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052123 (Ralstonia solanacearum strain FJAT1452.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
182. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052131 (Ralstonia solanacearum strain FJAT1303.F8 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
183. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP011998 (Ralstonia solanacearum strain YC45 plasmid, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
184. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052073 (Ralstonia solanacearum strain FJAT448.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
185. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052081 (Ralstonia solanacearum strain FJAT442.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
186. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052083 (Ralstonia solanacearum strain FJAT442.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
187. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052109 (Ralstonia solanacearum strain FJAT15249.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
188. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052091 (Ralstonia solanacearum strain FJAT15340.F6 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
189. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052111 (Ralstonia solanacearum strain FJAT15244.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
190. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052103 (Ralstonia solanacearum strain FJAT15252.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
191. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052119 (Ralstonia solanacearum strain FJAT1458.F50 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
192. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP052113 (Ralstonia solanacearum strain FJAT15244.F1 plasmid Plas1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggccgacctgcgcggcgagccggtgctcgtc Protospacer
* * * **** ***** *************
193. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccgccgccgtgctcggcgggctggtgctcgtc Protospacer
.** ** ********* **.**********
194. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 7, identity: 0.781
tcggggcgctgctcggcgtgccggtgctcgtc- CRISPR spacer
gcggcgcggtgctcggcgtgccgg-aagcgtcg Protospacer
*** *** *************** . ****
195. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP022791 (Ralstonia solanacearum strain SL3103 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
aagcggtggtcgctgacgtcgagcggcgcgta- CRISPR spacer
ctgcggttgtcgctgacgtcgagcga-acgcag Protospacer
***** *****************. .**.*
196. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 7, identity: 0.781
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
aaagggcggtcgctgacgtcgatcggcgggcc Protospacer
**. **.*************** ***** *.
197. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 7, identity: 0.781
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
aaagggcggtcgctgacgtcgatcggcgggcc Protospacer
**. **.*************** ***** *.
198. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044332 (Methylocystis parvus strain BRCS2 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
agaactcgatgggctcgtcgccggcgtgctcg Protospacer
****.***********.******* * * *
199. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP044333 (Methylocystis parvus strain BRCS2 plasmid unnamed2, complete sequence) position: , mismatch: 7, identity: 0.781
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
agaactcgatgggctcgtcgccggcgtgctcg Protospacer
****.***********.******* * * *
200. spacer 6.4|2629651|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050084 (Rhizobium leguminosarum bv. trifolii strain 31B plasmid pRL31b2, complete sequence) position: , mismatch: 7, identity: 0.781
--gacggatcagatgcttcatggggctatggctc CRISPR spacer
acgcagga--agatccttcatgggtctatggcta Protospacer
* *** **** ********* ********
201. spacer 6.4|2629651|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053209 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1A, complete sequence) position: , mismatch: 7, identity: 0.781
--gacggatcagatgcttcatggggctatggctc CRISPR spacer
acgcagga--agatccttcatgggtctatggcta Protospacer
* *** **** ********* ********
202. spacer 6.6|2629773|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN813686 (Mycobacterium phage BirdsNest, complete genome) position: , mismatch: 7, identity: 0.781
gaaggtcggctcgccggatcttcagcggttcg CRISPR spacer
gagctacggctcgccggagcttcagcagttct Protospacer
**. ************ *******.****
203. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017273 (Thermus thermophilus SG0.5JP17-16 plasmid pTHTHE1601, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaagagggcggtggtgtcagggta Protospacer
.************************.*
204. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017588 (Thermus thermophilus JL-18 plasmid pTTJL1801, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaagagggcggtggtgtcagggta Protospacer
.************************.*
205. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaagagggcggtggtgtcagggta Protospacer
.************************.*
206. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ccggcgccgaagagggcgatggtgtcgctgtg Protospacer
***** ***********.******** *
207. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gcggcggcgaagaaggcggcggtgtcccgcac Protospacer
.************.*****.****** **.
208. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016313 (Thermus brockianus strain GE-1 plasmid pTB1, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaagatggcggtggtgtccggaaa Protospacer
.*********** ************ * *
209. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ccggcgccgaagagggcgatggtgtcgctgtg Protospacer
***** ***********.******** *
210. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gcggcggcgaagaaggcggcggtgtcccgcac Protospacer
.************.*****.****** **.
211. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020041 (Streptomyces sp. 3211 isolate 3 plasmid p3211-2, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
aacgcggcgaagagggtggtggtgccggccca Protospacer
* *************.*******.***.*
212. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gcctcggcgaagagggcggtggtttcgttgaa Protospacer
.* ******************* *** * *
213. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041163 (Leisingera aquaemixtae strain R2C4 plasmid unnamed5) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgt-cggtcat CRISPR spacer
ggggcggcgaagaaggcggcggtgtccgggcg- Protospacer
. ***********.*****.***** *** *.
214. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_019408 (Caulobacter phage CcrRogue, complete genome) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
aacggggcgaagcgggcggtggtgttggtggt Protospacer
* * ******* ************.*** .*
215. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_021086 (Cutibacterium acnes HL096PA1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtg---tcggtcat CRISPR spacer
gcggcgtcgatgagggcggtggtggcttcggc--- Protospacer
.***** *** ************* ****.
216. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012356 (Cutibacterium acnes strain PA_15_1_R1 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.781
acggcggcgaagagggcggtggtg---tcggtcat CRISPR spacer
gcggcgtcgatgagggcggtggtggcttcggc--- Protospacer
.***** *** ************* ****.
217. spacer 6.12|2630139|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN585980 (Microbacterium phage Gina, complete genome) position: , mismatch: 7, identity: 0.781
ggagtc----tcggtcggcgtgaccttgtacaggtc CRISPR spacer
----tcgtggccggtcggcgcggccttgtacaggtc Protospacer
** .*********.*.*************
218. spacer 6.12|2630139|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN586059 (Microbacterium phage Teamocil, complete genome) position: , mismatch: 7, identity: 0.781
ggagtc----tcggtcggcgtgaccttgtacaggtc CRISPR spacer
----tcgtggccggtcggcgcggccttgtacaggtc Protospacer
** .*********.*.*************
219. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006991 (Rhizobium sp. IE4771 plasmid pRetIE4771e, complete sequence) position: , mismatch: 7, identity: 0.781
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
cccgccgacacccagatcgacaagcacattca Protospacer
******* ******* ********** *.
220. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP007645 (Rhizobium etli bv. phaseoli str. IE4803 plasmid pRetIE4803d, complete sequence) position: , mismatch: 7, identity: 0.781
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
cccgccgacacccagatcgacaagcacattca Protospacer
******* ******* ********** *.
221. spacer 6.18|2630505|30|CP028719|CRISPRCasFinder matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 7, identity: 0.767
gtcgacgccgtactcgccgccccacgcctc CRISPR spacer
cgcgaagccgtcctcgccgccccacgtcat Protospacer
*** ***** **************.* .
222. spacer 6.18|2630505|30|CP028719|CRISPRCasFinder matches to NZ_CP016083 (Streptomyces sp. SAT1 plasmid unnamed3, complete sequence) position: , mismatch: 7, identity: 0.767
gtcgacgccgtactcgccgcc----ccacgcctc CRISPR spacer
gtcgacgccgtactcgacgcctgtgcagcg---- Protospacer
**************** **** * .**
223. spacer 6.18|2630505|30|CP028719|CRISPRCasFinder matches to NC_017805 (Deinococcus gobiensis I-0 plasmid P1, complete sequence) position: , mismatch: 7, identity: 0.767
gtcgacgccgtactcgccgccccacgcctc- CRISPR spacer
ctcgacgccgaactcgccg-cccgcacccag Protospacer
********* ******** ***.*.**.
224. spacer 6.18|2630505|30|CP028719|CRISPRCasFinder matches to NZ_CP016821 (Rhodococcus sp. p52 plasmid pDF01, complete sequence) position: , mismatch: 7, identity: 0.767
gtcgacgccgtactcgccgccccacgcctc CRISPR spacer
atcgacgccgaactcgccgccctcggcccg Protospacer
.********* ***********. ***.
225. spacer 6.18|2630505|30|CP028719|CRISPRCasFinder matches to MH744420 (Streptomyces phage Kromp, complete genome) position: , mismatch: 7, identity: 0.767
gtcgacgccgtactcgccgccccacgcctc CRISPR spacer
ggggacgccgtagtcgccgacccacgacca Protospacer
* ********* ****** ****** *.
226. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 7, identity: 0.781
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agatccgcgcccttgacgcccttgccgccgcg Protospacer
. ***** .********************
227. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 7, identity: 0.781
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgcagcgcggccttgaagcccttgccgccgac Protospacer
. * *****.***** ************* *
228. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP054028 (Rhizobium sp. JKLM19E plasmid pPR19E01, complete sequence) position: , mismatch: 7, identity: 0.781
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
tcggccgccgtcttggcgcccttgccggccac Protospacer
*.*.**** ******.*********** * *
229. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.781
ttgaccgcggtcttgacgcccttgc-cgccgcc CRISPR spacer
gcgaccatggtcttgacgcccttgcgcgttgc- Protospacer
.****..***************** **..**
230. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to MT657344 (Microbacterium phage Kauala, complete genome) position: , mismatch: 7, identity: 0.781
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
ttgaccgcagtcttgatgcccttctcgtagac Protospacer
********.*******.****** .**. * *
231. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgtcgcccttgccagcccg Protospacer
.*********** **********. * *
232. spacer 6.22|2630566|30|CP028719|CRT matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgtcgcccttgccagcccg Protospacer
.*********** **********. * *
233. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP032695 (Rhizobium jaguaris strain CCGE525 plasmid pRCCGE525c, complete sequence) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
atcttccgtcttgacgaccttgccgccgcg Protospacer
. *. * ********* ************
234. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP022220 (Bradyrhizobium guangxiense strain CCBAU 53363 plasmid p53363, complete sequence) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gatttcaaccttgacgtccttgccgccgcc Protospacer
**.. *...*******.*************
235. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP026382 (Sphingopyxis sp. MG plasmid pCMS1, complete sequence) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gaggaggcgcttgccgcccttgccgccgcc Protospacer
** . * **** ****************
236. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP030052 (Bradyrhizobium guangdongense strain CCBAU 51649 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gatttcaaccttgacgtccttgccgccgcc Protospacer
**.. *...*******.*************
237. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP030054 (Bradyrhizobium guangzhouense strain CCBAU 51670 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gatttcaaccttgacgtccttgccgccgcc Protospacer
**.. *...*******.*************
238. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 7, identity: 0.781
cagtacgaggaccggtgcgccgcgtgctcacg-- CRISPR spacer
gagtacgaggaccggtacgccac--gctgaaggc Protospacer
***************.****.* *** * *
239. spacer 5.3|2615786|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP028969 (Aminobacter sp. MSH1 plasmid pUSP1, complete sequence) position: , mismatch: 8, identity: 0.75
tacaacaagcacccgcaccgcaccaccaccct CRISPR spacer
ttcgttgagcgcgcgcaccgcaccaccaccca Protospacer
* *. ..***.* ******************
240. spacer 5.3|2615786|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026266 (Aminobacter sp. MSH1 plasmid pAM01, complete sequence) position: , mismatch: 8, identity: 0.75
tacaacaagcacccgcaccgcaccaccaccct CRISPR spacer
ttcgttgagcgcgcgcaccgcaccaccaccca Protospacer
* *. ..***.* ******************
241. spacer 5.4|2615847|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP024314 (Rhizobium sp. NXC24 plasmid pRspNXC24c, complete sequence) position: , mismatch: 8, identity: 0.75
ttgaccttgtcggtctcgaatgccgcccggat CRISPR spacer
tcccccttgtcgggctcgaatgccgccacgta Protospacer
*. ********* ************* *
242. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR594676 (Variovorax sp. PBS-H4 plasmid 2) position: , mismatch: 8, identity: 0.75
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ctcaccccggccgaactggaccgccgcaccct Protospacer
* ***********.************ .
243. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134451 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 9, complete sequence) position: , mismatch: 8, identity: 0.75
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
gcgcgcctggccgagctggaccgccgccacgg Protospacer
..* **.********************. *
244. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_008537 (Arthrobacter sp. FB24 plasmid 1, complete sequence) position: , mismatch: 8, identity: 0.75
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
tccaacctcgccgagctggaccgcggccgcgc Protospacer
. * **. *************** **** **
245. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010679 (Phaeobacter gallaeciensis strain P75 plasmid pP75_f, complete sequence) position: , mismatch: 8, identity: 0.75
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
gcgcgccttgccgagctggagcgccgacgagc Protospacer
..* **. *********** ***** *****
246. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP010790 (Phaeobacter gallaeciensis strain P63 plasmid pP63_f, complete sequence) position: , mismatch: 8, identity: 0.75
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
gcgcgccttgccgagctggagcgccgacgagc Protospacer
..* **. *********** ***** *****
247. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccgggggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
248. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_022063 (Mycobacterium phage Phelemich, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccggaggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
249. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccgggggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
250. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KF024727 (Mycobacterium phage Reprobate, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccggaggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
251. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccgggggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
252. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KY224000 (Mycobacterium phage Rich, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccgggggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
253. spacer 5.7|2616030|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KR080199 (Mycobacterium phage Baee, complete genome) position: , mismatch: 8, identity: 0.75
agtcgcc-----cacgacccagttgacgaggacggtg CRISPR spacer
-----ccgggggcacgacccagttgaggatgacggcg Protospacer
** ************** ** *****.*
254. spacer 5.9|2616152|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP006370 (Aureimonas sp. AU20 plasmid pAU20c, complete sequence) position: , mismatch: 8, identity: 0.75
gcgcgctccaccctccagatcgtctccgagac CRISPR spacer
gcgcgctcgatcctccagatcgtcgatcggcc Protospacer
******** *.************* . .* *
255. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_013859 (Azospirillum sp. B510 plasmid pAB510e, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cggctgatgctgcgggcgatgccataggcgag Protospacer
*** ******************* . ** .
256. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054841 (Acidovorax sp. 16-35-5 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
gataggcagctgcgcgcgctgcccggcgccgc Protospacer
. * * ****** *** *************
257. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051470 (Rhodobacter sphaeroides strain CH10 plasmid pRspCH10A, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
258. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_011960 (Rhodobacter sphaeroides KD131 plasmid pRSKD131B, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
259. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030273 (Rhodobacter sphaeroides 2.4.1 plasmid pA, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
260. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP047033 (Rhodobacter sphaeroides strain DSM 158 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
261. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_009040 (Rhodobacter sphaeroides ATCC 17029 plasmid pRSPH01, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
262. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015290 (Rhodobacter sphaeroides strain MBTLJ-20 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
263. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047039 (Rhodobacter sphaeroides strain 2.4.1 substr. H2 plasmid pEA, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
264. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015213 (Rhodobacter sphaeroides strain MBTLJ-13 plasmid b, complete sequence) position: , mismatch: 8, identity: 0.75
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
cgcccgatgccgcgggctatgcccggcggctg Protospacer
** .*****.****** ********** *
265. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
---cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
atccg---gccgtcgtcggctgggtcgccgcgcgc Protospacer
** **.********* **********. *
266. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcggcgccgtcggcggcggggtcgccttcgtg Protospacer
*****.**** ************* . **
267. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcggcgccgtcggcggcggggtcgccttcgtg Protospacer
*****.**** ************* . **
268. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012185 (Pseudonocardia sp. EC080619-01 plasmid pBCI1-2, complete sequence) position: , mismatch: 8, identity: 0.75
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tcgccgcggtcggcggcggggtcgccgggatc Protospacer
. * *** **** ************** ..**
269. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012182 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-1, complete sequence) position: , mismatch: 8, identity: 0.75
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tcgccgcggtcggcggcggggtcgccgggatc Protospacer
. * *** **** ************** ..**
270. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 8, identity: 0.75
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgtaggcttc Protospacer
.** ************** *****. * **
271. spacer 5.17|2616641|32|CP028719|CRISPRCasFinder,CRT matches to CP000617 (Burkholderia vietnamiensis G4 plasmid pBVIE01, complete sequence) position: , mismatch: 8, identity: 0.75
cagcgcctggtgtcgtcgggcacggcttccag CRISPR spacer
tggcgactggtgtcgtcgcgcacggcgacgcg Protospacer
..*** ************ ******* * *
272. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017536 (Oligotropha carboxidovorans OM4 plasmid pHCG3B, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgtgggccagacggacaccgacagcagctc CRISPR spacer
gcgccggaccagaccgacaccgacagcagcat Protospacer
* .**.****** *************** .
273. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013071 (Sphingobium indicum B90A plasmid pSRL1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgtgggccagacggacaccgacagcagctc CRISPR spacer
gccccggaccagaccgacaccgacagcagcat Protospacer
* . .**.****** *************** .
274. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_015689 (Oligotropha carboxidovorans OM5 plasmid pHCG3, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgtgggccagacggacaccgacagcagctc CRISPR spacer
gcgccggaccagaccgacaccgacagcagcat Protospacer
* .**.****** *************** .
275. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023152 (Mycobacterium chimaera strain FLAC0070 plasmid pFLAC0070_1, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgtg-ggccagacggacaccgacagcagctc CRISPR spacer
-ccgcgcagccacacgaacaccgacagcagcgc Protospacer
.*.* .**** ***.************** *
276. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043499 (Rhizobium grahamii strain BG7 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgtgggccagacggacaccgacagcagctc CRISPR spacer
ggtgtcggcctgacggacaccgaggccttcac Protospacer
***** **** ************ . * * *
277. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP012556 (Mycobacterium avium subsp. hominissuis TH135 plasmid pMAH135, complete sequence) position: , mismatch: 8, identity: 0.75
ggtgtg-ggccagacggacaccgacagcagctc CRISPR spacer
-ccgcgcagccacacgaacaccgacagcagcgc Protospacer
.*.* .**** ***.************** *
278. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_011143 (Phenylobacterium zucineum HLK1 plasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
gtcatgccgggacgcggcgccagggtggcgcg Protospacer
.* .************* * ********.*
279. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
ttgaccggcaccaggtcgccgtcgtggacgtc Protospacer
..* ***** ******************
280. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039425 (Citricoccus sp. SGAir0253 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tcgaggggctccgggtcaccgtcgtggagcga Protospacer
.** ******.****.************..
281. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
cgcagctgctccaggtcgccgtcgcggaccat Protospacer
* * *****************.*** **
282. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP039430 (Citricoccus sp. SGAir0453 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tcgaggggctccgggtcaccgtcgtggagcga Protospacer
.** ******.****.************..
283. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to LN997843 (Streptomyces reticuli genome assembly TUE45, plasmid : II) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
ccgtccagctccaggtcaccgtcggcccgccc Protospacer
******.**********.****** **
284. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KC117377 (Halovirus HVTV-1, complete genome) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tcgtcctcctccaggtcgccgtcgtcggtgac Protospacer
.***** ***************** *. *
285. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 8, identity: 0.75
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tcgtccggcttcgggtcgccgtcgccgggctt Protospacer
.*********.*.***********. *.**
286. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_013855 (Azospirillum sp. B510 plasmid pAB510a, complete sequence) position: , mismatch: 8, identity: 0.75
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
ggaccgacccggcgcatgccctgcccctgctc Protospacer
...******* ****.************ *.
287. spacer 5.24|2617068|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026654 (Streptomyces dengpaensis strain XZHG99 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cggcctgagcagtgccgacggccgaatcgtca CRISPR spacer
cggccggagcagtgtcgacggccgccccgcag Protospacer
***** ********.********* .**. .
288. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043960 (Streptomyces tendae strain 139 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
gagggctgttccagctcccgctcggacaggga Protospacer
* .*** ********* ***********
289. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032323 (Azospirillum brasilense strain MTCC4035 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
gacagacgctccagctccgacttggacaggct Protospacer
* * . .* **********.**.*********
290. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007795 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p2, complete sequence) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
gacagacgctccagctccgacttggacaggct Protospacer
* * . .* **********.**.*********
291. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
gacagacgctccagctccgacttggacaggct Protospacer
* * . .* **********.**.*********
292. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
gacagacgctccagctccgacttggacaggct Protospacer
* * . .* **********.**.*********
293. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KX620751 (Propionibacterium phage Doucette, complete genome) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
acctgccggtccagctccgggtcggccaggtg Protospacer
.**..*.************* **** ****.
294. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KX620754 (Propionibacterium phage G4, complete genome) position: , mismatch: 8, identity: 0.75
gcccactggtccagctccggctcggacaggct CRISPR spacer
acctgccggtccagctccgggtcggccaggtg Protospacer
.**..*.************* **** ****.
295. spacer 5.26|2617190|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_014819 (Asticcacaulis excentricus CB 48 plasmid pASTEX02, complete sequence) position: , mismatch: 8, identity: 0.75
atcac-gtcgggcgcgcagtagctcggctggtt CRISPR spacer
-cgacagctgggcgcgcagtagatcggccggtg Protospacer
. ** *..************* *****.***
296. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029356 (Azospirillum sp. CFH 70021 plasmid unnamed1) position: , mismatch: 8, identity: 0.75
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
gcgtcgccggtgaccagcacgccgttgaggtc Protospacer
*. ********* ****** ******* *
297. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021082 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI1, complete sequence) position: , mismatch: 8, identity: 0.75
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
ggttcaccggcgtccagcaggccgttggcgtt Protospacer
* .**.****.**************** . *
298. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
299. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
300. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
acggcctccaggttctcgcggccgccgtcgcg Protospacer
************ ********** * *
301. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
302. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007214 (Burkholderia plantarii strain ATCC 43733 plasmid bpln_1p, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
atgacctgcaggtgctcgcggccgcgggcgcg Protospacer
.*.*** **************** ****
303. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
304. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
acggcctccaggttctcgcggccgccgtcgcg Protospacer
************ ********** * *
305. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
306. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
307. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
308. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
309. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
acggcctccaggttctcgcggccgccgtcgcg Protospacer
************ ********** * *
310. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
acggcctccaggttctcgcggccgccgtcgcg Protospacer
************ ********** * *
311. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
312. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
313. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttctcgcggcc----gccgtagcg Protospacer
************ ********* **.*.
314. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
acggccgtcaggtgctcgcggccgccgacacc Protospacer
***** .**************** *.* *
315. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccg---agggctgc CRISPR spacer
ccggcctcgaggcgctcgcggccgtccaggag--- Protospacer
.******* ***.*********** ***.
316. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_023283 (Streptomyces sp. FR1 plasmid pFRL3, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
taggcgtccaggtgctggcggccgacatccac Protospacer
* *** ********** ******** . *..*
317. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
taggcgtccaggtgctggcggccgacatccac Protospacer
* *** ********** ******** . *..*
318. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcggccg---agggctgc CRISPR spacer
ccggcctcgaggcgctcgcggccgtccaggag--- Protospacer
.******* ***.*********** ***.
319. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggcctccaggtgctcgcg---gccgagggctgc CRISPR spacer
acggcctccaggttctcgcgcccgccgaagcg--- Protospacer
************ ****** *****.*
320. spacer 5.31|2617495|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014600 (Yangia sp. CCB-MM3 plasmid unnamed4, complete sequence) position: , mismatch: 8, identity: 0.75
cggagcactcccccgagccggccgaagaagcc CRISPR spacer
gcggggatgcccccgacccggccgaggaagcc Protospacer
*.* *. ******* ********.******
321. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 8, identity: 0.75
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
acttccgggacgcagcaggccttacagctgct Protospacer
.* ************** *.********
322. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.75
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
acttccgggacgcagcaggccttacagctgct Protospacer
.* ************** *.********
323. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013744 (Streptomyces sp. CdTB01 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
acggtcgggccgcagcaggacgtgcagctggc Protospacer
.*** ** ********* ********** .
324. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022363 (Azospirillum sp. TSH58 plasmid TSH58_p03, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccggggcgctgcccggcgtgccggcggttcat Protospacer
.***********.***********.* *. .
325. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_007974 (Cupriavidus metallidurans CH34 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gttgggcggtgcccggcgtgccggtgctggcg Protospacer
. ***** ***.*************** *.
326. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046333 (Cupriavidus metallidurans strain FDAARGOS_675 plasmid unnamed3) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gttgggcggtgcccggcgtgccggtgctggcg Protospacer
. ***** ***.*************** *.
327. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tggacgcgctggccggcgtgccggtgctgggg Protospacer
* *. ****** .*************** *
328. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KM879463 (Arthrobacter phage vB_ArtM-ArV1, complete genome) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gtggggcgcggcttggcgtgccggtgcggcgc Protospacer
.******* ***.************* *
329. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_012989 (Methylorubrum extorquens AM1 plasmid p2METDI, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
cctttccgctgctcggcgtgctgctgctcgcc Protospacer
.* ***************.* ******.*
330. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014811 (Methylorubrum populi strain P-1M plasmid pMPPM02, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
cctttccgctgctcggcgtgctgctgctcgcc Protospacer
.* ***************.* ******.*
331. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032322 (Azospirillum brasilense strain MTCC4035 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggc----gctgctcggcgtgccggtgctcgtc CRISPR spacer
----ggcttctgctgctcggcgtggcggtgatcgcg Protospacer
*** ************* ***** ***.
332. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP007794 (Azospirillum brasilense strain Az39 plasmid AbAZ39_p1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggc----gctgctcggcgtgccggtgctcgtc CRISPR spacer
----ggcttctgctgctcggcgtggcggtgatcgcg Protospacer
*** ************* ***** ***.
333. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tcgcggcgctgcccggcgtgccggcgattccg Protospacer
*** ********.***********.* *. .
334. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tcggggcgcggctcggtgtgccgttcaccgcg Protospacer
********* ******.****** * .**.
335. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tgaccgcgctggtcggcgtgcccgtgctgatc Protospacer
* . ****** ********** ***** .**
336. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccttggcgctgcccggcgtgccggggcccatg Protospacer
.* ********.*********** **.*.*
337. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP046053 (Methylocystis heyeri strain H2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tgggcatgctgctcggcgtggcgctgctcgga Protospacer
* ** ..************* ** ******
338. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029234 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436d, complete sequence) position: , mismatch: 8, identity: 0.75
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
acggcagaatgctcgacgtgccggtgttcgtc Protospacer
*** . . ******.**********.*****
339. spacer 5.36|2617801|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
agatcctggacttccagcaccgctacgtcttc CRISPR spacer
tgatccgcgacttccagcaccgctatcccggc Protospacer
***** *****************. .* *
340. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
ccgccctgctcatcacggcgctcgcctacctc Protospacer
*************** .******** *.
341. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
gccacctgctcatcaccatgcccgccgagaac Protospacer
** **************.**.***** *
342. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
tggcctatctcaccaccacgctcggcgtgccc Protospacer
***. ****.*********** ******
343. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
gccacctgctcatcaccatgcccgccgagaac Protospacer
** **************.**.***** *
344. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 8, identity: 0.75
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
gccacctgctcatcaccatgcccgccgagaac Protospacer
** **************.**.***** *
345. spacer 5.40|2618046|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP050138 (Sphingomonas sp. CL5.1 plasmid pTSSC1, complete sequence) position: , mismatch: 8, identity: 0.75
gccgggtgagacgtactgggcgttcgcggacg CRISPR spacer
gacgttgctgacgtcctgggcgttcgcggccg Protospacer
* ** ***** ************** **
346. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP019949 (Methylocystis bryophila strain S285 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
acgtggcgatcgctgacgtcgagcggcgtccc Protospacer
* *.**.*.*******************. .
347. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NC_016588 (Azospirillum lipoferum 4B plasmid AZO_p6, complete sequence) position: , mismatch: 8, identity: 0.75
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ctgtcggtgtcgctgatgtcgagcggcgccta Protospacer
*. * ********.************ **
348. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to KR080197 (Mycobacterium phage FlagStaff, complete genome) position: , mismatch: 8, identity: 0.75
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
gacctgtcgtcgctgtcgtcgagcggcgcccg Protospacer
.* * ** ******* ************* ..
349. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
aagcggtggtcgctgacgtcgagcggcgcgta- CRISPR spacer
gcgcggtggtcgctgtcgccgagc-gcatgaag Protospacer
. ************* **.***** **..* *
350. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP017244 (Rhizobium etli 8C-3 plasmid pRsp8C3c, complete sequence) position: , mismatch: 8, identity: 0.75
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
acgatgtggtcgctgaagtagagcggcggctg Protospacer
* * *********** ** ******** *.
351. spacer 6.1|2629468|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP054927 (Streptomyces fulvissimus strain NA06532 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttggtggtgacgtggctggtgtagctgtcgat CRISPR spacer
cagggagtgactttgctggtgtagctgtcgga Protospacer
. ** .***** * ****************.
352. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050092 (Rhizobium leguminosarum bv. trifolii strain 22B plasmid pRL22b6, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
353. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050104 (Rhizobium leguminosarum bv. trifolii strain 4B plasmid pRL4b2, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
354. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025013 (Rhizobium leguminosarum strain Norway plasmid pRLN1, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
355. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP020900 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
356. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
357. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
358. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP018229 (Rhizobium leguminosarum strain Vaf-108 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
359. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025507 (Rhizobium leguminosarum bv. viciae strain UPM791 plasmid pRlvA, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
360. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
361. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
362. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013579 (Rhizobium phaseoli strain N671 plasmid pRphaN671e, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
363. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013531 (Rhizobium phaseoli strain R723 plasmid pRphaR723d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
364. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013536 (Rhizobium phaseoli strain R650 plasmid pRphaR650d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
365. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013541 (Rhizobium phaseoli strain R630 plasmid pRphaR630d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
366. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013546 (Rhizobium phaseoli strain R620 plasmid pRphaR620d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
367. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
368. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050109 (Rhizobium leguminosarum bv. trifolii strain 3B plasmid pRL3b2, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
369. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048281 (Rhizobium leguminosarum bv. viciae 248 plasmid pRle248e, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
370. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013584 (Rhizobium phaseoli strain N261 plasmid pRphaN261d, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
371. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030761 (Rhizobium leguminosarum strain ATCC 14479 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
372. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013573 (Rhizobium phaseoli strain N771 plasmid pRphaN771e, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
373. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_012848 (Rhizobium leguminosarum bv. trifolii WSM1325 plasmid pR132501, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
374. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022666 (Rhizobium leguminosarum bv. viciae strain BIHB 1217 plasmid pPR1, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
375. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_010997 (Rhizobium etli CIAT 652 plasmid pC, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
376. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
377. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022565 (Rhizobium leguminosarum bv. viciae strain BIHB 1148 plasmid pSK01, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
378. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP050086 (Rhizobium leguminosarum bv. trifolii strain 23B plasmid pRL23b7, complete sequence) position: , mismatch: 8, identity: 0.75
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgccggcctcttca Protospacer
* . ** ******************** * .
379. spacer 6.5|2629712|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK450426 (Streptomyces phage Euratis, complete genome) position: , mismatch: 8, identity: 0.75
acgtcctcggacagcaagccgaagaagagcaa CRISPR spacer
gaggacgcggacaacaagccgaagaagcgcga Protospacer
. * * ******.************* **.*
380. spacer 6.6|2629773|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN617843 (Mycobacterium phage Quesadilla, complete genome) position: , mismatch: 8, identity: 0.75
gaaggtcggctcgccggatcttcagcggttcg CRISPR spacer
gagctatggctcgccggagcttcagcagttcc Protospacer
**. .*********** *******.****
381. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039901 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877c, complete sequence) position: , mismatch: 8, identity: 0.75
accaacgggatcatcagcttcacgg---cctgacg CRISPR spacer
gacaacgggaacatcagtttcacggagaccgg--- Protospacer
. ******** ******.******* ** *
382. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_011994 (Agrobacterium radiobacter K84 plasmid pAgK84, complete sequence) position: , mismatch: 8, identity: 0.75
accaacgggatcatcagcttcacgg---cctgacg CRISPR spacer
gacaacgggaacatcagtttcacggagaccgg--- Protospacer
. ******** ******.******* ** *
383. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_006277 (Agrobacterium tumefaciens K84 plasmid pAgK84, complete sequence) position: , mismatch: 8, identity: 0.75
accaacgggatcatcagcttcacgg---cctgacg CRISPR spacer
gacaacgggaacatcagtttcacggagaccgg--- Protospacer
. ******** ******.******* ** *
384. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP030828 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750a, complete sequence) position: , mismatch: 8, identity: 0.75
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
gtcacgaggatcgtcagcttcacgccctgaag Protospacer
..** .*****.*********** ***** *
385. spacer 6.8|2629895|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_013856 (Azospirillum sp. B510 plasmid pAB510b, complete sequence) position: , mismatch: 8, identity: 0.75
agctacaccccttccctggtcaatgccgggtc CRISPR spacer
cgccgccccccttccccggtcaatgtcgggaa Protospacer
**..* *********.********.****
386. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH744418 (Streptomyces phage JustBecause, complete genome) position: , mismatch: 8, identity: 0.75
gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
ctgacgtaccacctctccgaggaggggacgcg Protospacer
******************** *** . *
387. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT310898 (Streptomyces phage Kela, complete genome) position: , mismatch: 8, identity: 0.75
gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
ctgacgtaccacctctccgaggaggggacgcg Protospacer
******************** *** . *
388. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021374 (Rhizobium sp. ACO-34A plasmid pRACO34Ab, complete sequence) position: , mismatch: 8, identity: 0.75
gtgacgt----accacctctccgagcaggccgagat CRISPR spacer
----cgtttcctccacctctccgcgcagcccgagag Protospacer
*** *********** **** ******
389. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 8, identity: 0.75
gtgacg-taccacctctccgagcaggccgagat CRISPR spacer
-tggtactgccacctctccgagcagaccgtgaa Protospacer
**... *.****************.*** **
390. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_006462 (Thermus thermophilus HB8 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.75
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaaaatggcggtggtgtcggggta Protospacer
.*********.* **************
391. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_005838 (Thermus thermophilus HB27 plasmid pTT27, complete sequence) position: , mismatch: 8, identity: 0.75
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaaaatggcggtggtgtcggggta Protospacer
.*********.* **************
392. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP019802 (Thermus thermophilus strain HC11 plasmid pHC11, complete sequence) position: , mismatch: 8, identity: 0.75
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ttggcggcgaaaatggcggtggtgtcggggta Protospacer
.*********.* **************
393. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_018583 (Gordonia sp. KTR9 plasmid pGKT3, complete sequence) position: , mismatch: 8, identity: 0.75
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
tgggcggcgagtagggcggtggtgtcgcggct Protospacer
********. *************** *
394. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP045548 (Streptomyces sp. SYP-A7193 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
agggcgggggagagggcggtggtgtccgcggc Protospacer
* ***** *.**************** *. ..
395. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009803 (Streptomyces sp. FR-008 plasmid pSSFR1, complete sequence) position: , mismatch: 8, identity: 0.75
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
acggcggcgaggcgggcggtggtcgagatgag Protospacer
**********.* ********** *.* *
396. spacer 6.11|2630078|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP007792 (Corynebacterium marinum DSM 44953 plasmid pCmarinum1, complete sequence) position: , mismatch: 8, identity: 0.75
gaccggtccggctacacctacttcgccaccgc CRISPR spacer
gagttcaccggctactcctacttcaccaccgg Protospacer
** . ******** ********.******
397. spacer 6.11|2630078|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP032520 (Cupriavidus oxalaticus strain T2 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gaccggtccggctacacctacttcgccaccgc CRISPR spacer
ggcaataacggctacaccaacttcaccaccgc Protospacer
*.* . ********** *****.*******
398. spacer 6.11|2630078|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029357 (Azospirillum sp. CFH 70021 plasmid unnamed2) position: , mismatch: 8, identity: 0.75
gaccggtccggctacacctacttcgccaccgc CRISPR spacer
ggcatcgccggcttcaccttcttcgccaccgg Protospacer
*.* ****** ***** ***********
399. spacer 6.11|2630078|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP021131 (Meiothermus taiwanensis strain WR-220 plasmid pMtWR-220, complete sequence) position: , mismatch: 8, identity: 0.75
gaccggtcc-----ggctacacctacttcgccaccgc CRISPR spacer
-----atccctaagggctacatctacttcgccatcgc Protospacer
.*** *******.***********.***
400. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MG663582 (Streptomyces phage HaugeAnator, complete genome) position: , mismatch: 8, identity: 0.75
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
atggcagtcaccaagctcgacaagcagtacgc Protospacer
. ** ****** **************. **.
401. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MG663586 (Streptomyces phage ZooBear, complete genome) position: , mismatch: 8, identity: 0.75
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
atggcagtcaccaagctcgacaagcagtacgc Protospacer
. ** ****** **************. **.
402. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MG663584 (Streptomyces phage Romero, complete genome) position: , mismatch: 8, identity: 0.75
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
atggcagtcaccaagctcgacaagcagtacgc Protospacer
. ** ****** **************. **.
403. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 8, identity: 0.75
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gcagccgccacccagcccgacaagcaccggat Protospacer
* ****.********.********* * .*
404. spacer 6.16|2630383|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP021031 (Rhizobium sp. NXC14 plasmid pRspNXC14a, complete sequence) position: , mismatch: 8, identity: 0.75
atcacga-acgtgcagcaggccaacccgaacct CRISPR spacer
-tggggatgcgtgcaggcggccaacccgaaccc Protospacer
* . ** .******* **************.
405. spacer 6.16|2630383|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 8, identity: 0.75
atcacga-acgtgcagcaggccaacccgaacct CRISPR spacer
-tggggatgcgtgcaggcggccaacccgaaccc Protospacer
* . ** .******* **************.
406. spacer 6.16|2630383|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP020910 (Rhizobium etli strain NXC12 plasmid pRetNXC12d, complete sequence) position: , mismatch: 8, identity: 0.75
atcacga-acgtgcagcaggccaacccgaacct CRISPR spacer
-tggggatgcgtgcaggcggccaacccgaaccc Protospacer
* . ** .******* **************.
407. spacer 6.16|2630383|32|CP028719|CRISPRCasFinder,CRT matches to NC_021909 (Rhizobium etli bv. mimosae str. Mim1 plasmid pRetMIM1e, complete sequence) position: , mismatch: 8, identity: 0.75
atcacga-acgtgcagcaggccaacccgaacct CRISPR spacer
-tggggatgcgtgcaggcggccaacccgaaccc Protospacer
* . ** .******* **************.
408. spacer 6.17|2630444|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP030864 (Streptomyces globosus strain LZH-48 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
gccaccgggtcctcgaggacaccgtcggcgtc CRISPR spacer
tcggctgggtcctcccggacaccgtcggccgc Protospacer
* .*.******** ************* *
409. spacer 6.17|2630444|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP020810 (Mycobacterium dioxanotrophicus strain PH-06 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
gccaccgggtcctcgaggacaccgtcggcgtc CRISPR spacer
tcgaggagttcctcggggacacggtcggcgtc Protospacer
* * .* ******.****** *********
410. spacer 6.18|2630505|30|CP028719|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.733
gtcgacgccgtactcgccgccccacgcctc CRISPR spacer
gtcgacgccgtactggccgccgcggacgaa Protospacer
************** ****** *. .*
411. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP045329 (Labrenzia sp. THAF191b plasmid pTHAF191b_a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cggtcgcctgtcatgacgaccttgccgccgcc Protospacer
. * * * *** ***** *************
412. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP045345 (Labrenzia sp. THAF187b plasmid pTHAF187b_a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cggtcgcctgtcatgacgaccttgccgccgcc Protospacer
. * * * *** ***** *************
413. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP045335 (Labrenzia sp. THAF191a plasmid pTHAF191a_b, complete sequence) position: , mismatch: 8, identity: 0.75
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cggtcgcctgtcatgacgaccttgccgccgcc Protospacer
. * * * *** ***** *************
414. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP045381 (Labrenzia sp. THAF35 plasmid pTHAF35_a, complete sequence) position: , mismatch: 8, identity: 0.75
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cggtcgcctgtcatgacgaccttgccgccgcc Protospacer
. * * * *** ***** *************
415. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP019631 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cggtcgcctgtcatgacgaccttgccgccgcc Protospacer
. * * * *** ***** *************
416. spacer 6.21|2630505|32|CP028719|CRT matches to MH632120 (Mycobacterium phage Thonko, complete genome) position: , mismatch: 8, identity: 0.75
gtcgacgccgtactcgccgccccacgcctccc CRISPR spacer
cgcgaagccgtcctcgccgccccacgtcatcg Protospacer
*** ***** **************.* .*
417. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP020371 (Candidatus Thiodictyon syntrophicum strain Cad16T plasmid pTs417, complete sequence) position: , mismatch: 8, identity: 0.733
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gccgttcttcttgaagcccttgccgccgcg Protospacer
* * . ****** **************
418. spacer 6.22|2630566|30|CP028719|CRT matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 8, identity: 0.733
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gaccatggtcttgacgcccttgcgctttgc Protospacer
****..***************** .. *
419. spacer 7.1|2637193|32|CP028719|CRISPRCasFinder,CRT matches to NC_010627 (Paraburkholderia phymatum STM815 plasmid pBPHY02, complete sequence) position: , mismatch: 8, identity: 0.75
gacgtagtagctgtgcccgtccgcagtgtggt CRISPR spacer
ggtgtgcgaggtgtgcccggccgcagtgtgga Protospacer
*..**. ** ******** ***********
420. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019632 (Labrenzia aggregata strain RMAR6-6 plasmid unnamed2, complete sequence) position: , mismatch: 8, identity: 0.75
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
ggataagttgaccggagcgccgagtgctcacg Protospacer
..** * ****** ****** *********
421. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017303 (Rhodococcus sp. YL-1 plasmid pYLL1 sequence) position: , mismatch: 8, identity: 0.75
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
tacctcgatgaccgttgcgccgcgtgctgccg Protospacer
.* . *** ***** ************* **
422. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012265 (Cronobacter condimenti 1330 strain LMG 26250 plasmid pCCO1, complete sequence) position: , mismatch: 8, identity: 0.75
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
agataaaacgagccgtgcgccgcgtgctcacg Protospacer
..** .* ** * ******************
423. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011928 (Labrenzia sp. CP4 plasmid pBCL1, complete sequence) position: , mismatch: 8, identity: 0.75
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
ggataagttgaccggagcgccgagtgctcacg Protospacer
..** * ****** ****** *********
424. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MN310546 (Microbacterium phage PhriedRice, complete genome) position: , mismatch: 8, identity: 0.75
tcgaccaggagctggctgaccga--cgccggctc CRISPR spacer
tcgacaaggagctggctgagcgattcaccaag-- Protospacer
***** ************* *** *.**..
425. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT310890 (Microbacterium phage Phedro, complete genome) position: , mismatch: 8, identity: 0.75
tcgaccaggagctggctgaccga--cgccggctc CRISPR spacer
tcgacaaggagctggctgagcgattcaccaag-- Protospacer
***** ************* *** *.**..
426. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT310889 (Microbacterium phage Phractured, complete genome) position: , mismatch: 8, identity: 0.75
tcgaccaggagctggctgaccga--cgccggctc CRISPR spacer
tcgacaaggagctggctgagcgattcaccaag-- Protospacer
***** ************* *** *.**..
427. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT310891 (Microbacterium phage Pharky, complete genome) position: , mismatch: 8, identity: 0.75
tcgaccaggagctggctgaccga--cgccggctc CRISPR spacer
tcgacaaggagctggctgagcgattcaccaag-- Protospacer
***** ************* *** *.**..
428. spacer 7.4|2637376|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023712 (Rhodococcus ruber strain YC-YT1 plasmid unnamed1, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccaggccgctgtagtagcgggcgaggtg CRISPR spacer
gccatcaggccgccgtcgtagcgggcgagttc Protospacer
* .********.** ************ *
429. spacer 7.4|2637376|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_010335 (Caulobacter sp. K31 plasmid pCAUL01, complete sequence) position: , mismatch: 8, identity: 0.75
tcgcccaggccgctgtagtagcgggcgaggtg CRISPR spacer
accgccaggccgatgttgtagcgggcggcgta Protospacer
* ******** *** **********. **.
430. spacer 7.4|2637376|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 8, identity: 0.75
---tcgcccaggccgctgtagtagcgggcgaggtg CRISPR spacer
aggatgcc---gccgatgtagtggcgggcgaggtc Protospacer
.*** **** ******.***********
431. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NC_009427 (Novosphingobium aromaticivorans DSM 12444 plasmid pNL2, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
gccatggtcaggcccagcaggtcgcgcaggg Protospacer
* . ******** ****** *******
432. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP013556 (Rhizobium phaseoli strain N931 plasmid pRphaN931d, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
ggatcctgcaggcctatcaggtcatcctcat Protospacer
******.*******.******** . * .
433. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP024896 (Amycolatopsis sp. AA4 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
gcgtccagcaggcccagcaggtcccgagcca Protospacer
* .*** ********* ********* . .
434. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP028885 (Borrelia turcica IST7 plasmid lp129, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
aggagtagcaggcccagcaggtccagcaggt Protospacer
.*. . ********* ******* *****
435. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP013589 (Rhizobium phaseoli strain N161 plasmid pRphaN161d, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
ggatcctgcaggcctatcaggtcatcctcat Protospacer
******.*******.******** . * .
436. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP013562 (Rhizobium phaseoli strain N841 plasmid pRphaN841e, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
ggatcctgcaggcctatcaggtcattctcat Protospacer
******.*******.******** . * .
437. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP013567 (Rhizobium phaseoli strain N831 plasmid pRphaN831d, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
ggatcctgcaggcctatcaggtcatcctcat Protospacer
******.*******.******** . * .
438. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP021128 (Rhizobium sp. Kim5 plasmid pRetKim5d, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
ggatcctgcaggcctatcaggtcatcctcat Protospacer
******.*******.******** . * .
439. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP016080 (Mesorhizobium loti NZP2037 plasmid pML2037, complete sequence) position: , mismatch: 9, identity: 0.71
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
accgcgagcaggcccatcaggaccggcaggt Protospacer
. * ************** ** *****
440. spacer 5.2|2615725|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to LC413193 (Klebsiella phage KN1-1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
ctgacggccccggagaggctggtcccgagggt CRISPR spacer
gtgacggcaccgtagaggctggtcgagaccaa Protospacer
******* *** *********** ** .
441. spacer 5.2|2615725|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH587638 (Klebsiella phage vB_KpnP_IME321, complete genome) position: , mismatch: 9, identity: 0.719
ctgacggccccggagaggctggtcccgagggt CRISPR spacer
gtgacggcaccgtagaggctggtcgagaccaa Protospacer
******* *** *********** ** .
442. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ccggccccggccgagctggtccggcgcctgcg Protospacer
.*.*************** *** **** .
443. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012183 (Pseudonocardia sp. EC080610-09 plasmid pBCI2-2, complete sequence) position: , mismatch: 9, identity: 0.719
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
caggccccggccgagcttcaccgccgcgtctc Protospacer
*.************* ******** *
444. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017767 (Thermus thermophilus HB8 plasmid pVV8, complete sequence) position: , mismatch: 9, identity: 0.719
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
gtccccgcggacgagctggaccgccgctacac Protospacer
.* ** *** ****************.. .*
445. spacer 5.11|2616274|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014598 (Yangia sp. CCB-MM3 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
catccggaccgctcttggagcagggcccagat CRISPR spacer
agatcggaccgctcttggtgcagggtccgggc Protospacer
. .************** ******.**.*..
446. spacer 5.11|2616274|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_011368 (Rhizobium leguminosarum bv. trifolii WSM2304 plasmid pRLG201, complete sequence) position: , mismatch: 9, identity: 0.719
catccggaccgctcttggagcagggcccagat CRISPR spacer
ctttcgcacggctcttggagcagggccgcctg Protospacer
* *.** ** *****************
447. spacer 5.11|2616274|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035002 (Rhizobium acidisoli strain FH23 plasmid pRapFH23d, complete sequence) position: , mismatch: 9, identity: 0.719
catccggaccgctcttggagcagggcccagat CRISPR spacer
ctttcgcacggctcttggagcagggccgcctg Protospacer
* *.** ** *****************
448. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
gggatgatgctgcgcgcgaggcccgggtagaa Protospacer
************* **** ****** .
449. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026091 (Ralstonia solanacearum strain IBSBF 2570 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
450. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_014309 (Ralstonia solanacearum CFBP2957 plasmid RCFBPv3_mp, complete genome) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
451. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021653 (Ralstonia solanacearum strain RS 488 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
452. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134461 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 19, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
acgatggtgctgcgcgcgatgcccgcggacaa Protospacer
****.******* ********** * *.
453. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR134463 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 21, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
ccgatgatgatgccggcgatgcccgcgaggtc Protospacer
* ******* *** *********** . *
454. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
aaggcgcggctgcgggcgctgaccggcgccgt Protospacer
.*..* ********** ** *********.
455. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
456. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021767 (Ralstonia solanacearum strain RS 489 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
457. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012940 (Ralstonia solanacearum strain UW163 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
458. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012944 (Ralstonia solanacearum strain IBSBF1503 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
459. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP012688 (Ralstonia solanacearum strain UY031 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
460. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_010625 (Paraburkholderia phymatum STM815 plasmid pBPHY01, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
acgcagatgctgcaggcgatgctcggcgaatc Protospacer
* ********.********.***** *
461. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047900 (Pseudarthrobacter sp. YJ56 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
agggctccgctgcggccggtgcccggcgccgg Protospacer
**.. .******* **.************
462. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017575 (Ralstonia solanacearum Po82 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
463. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023071 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666b, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
gtgatgatgttgcgggcgaagcccgcctgcag Protospacer
*******.********* ***** * *.
464. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026308 (Ralstonia solanacearum strain IBSBF 2571 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
465. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021765 (Ralstonia pseudosolanacearum strain CRMRs218 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
466. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP047139 (Ralstonia solanacearum strain CFBP 8695 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
467. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP051295 (Ralstonia solanacearum strain CIAT_078 plasmid megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
468. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP047137 (Ralstonia solanacearum strain CFBP 8697 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tcgccgatgcggcggccgatgcccggcgaacc Protospacer
. * .***** **** ************ *
469. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP029232 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436b, complete sequence) position: , mismatch: 9, identity: 0.719
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
gtgatgatgttgcgggcgaagcccgcctgcag Protospacer
*******.********* ***** * *.
470. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_015952 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI02, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
agaacgctgtcgtcggcggcatcgccgacggg Protospacer
*..*************** .****** *
471. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015203 (Rhodococcus sp. 008 plasmid pR8L1, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
aaagacttttcgtcggcgtggtcgccgcggtc Protospacer
..* .* ********* *********.***
472. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
473. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
474. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
475. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017327 (Sinorhizobium meliloti SM11 plasmid pSmeSM11c, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
476. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
477. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
478. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
479. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
480. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
481. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
482. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
483. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_011887 (Methylobacterium nodulans ORS 2060 plasmid pMNOD02, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
gcgcggctggcgtcggcggggtcgcggccacc Protospacer
* **** *************** ** ..*
484. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
485. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
486. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
487. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
488. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
489. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021217 (Sinorhizobium meliloti RU11/001 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
490. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
491. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
492. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
493. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tggtcgctgtcgtcggcgcggtcgttggcttt Protospacer
.** ************** *****..* *.
494. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_015065 (Granulicella tundricola MP5ACTX9 plasmid pACIX902, complete sequence) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
aggaacaaatcgtcggcatggtcgccgcagtc Protospacer
**. .********. *************
495. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN908693 (Gordonia phage AnClar, complete genome) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
ggggtgctgtcgtcgtcggggtcggtgctcat Protospacer
***.********** ******** .** .
496. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK801725 (Gordonia phage Yago84, complete genome) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
ggggtgctgtcgtcgtcggggtcggtgctcat Protospacer
***.********** ******** .** .
497. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KR080200 (Mycobacterium phage AlanGrant, complete genome) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
taggcgcggtcgtcggcggcgtcgcaggcgcg Protospacer
..***** *********** ***** * *.
498. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KR080194 (Mycobacterium phage Vincenzo, complete genome) position: , mismatch: 9, identity: 0.719
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
taggcgcggtcgtcggcggcgtcgcaggcgcg Protospacer
..***** *********** ***** * *.
499. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP027859 (Streptomyces clavuligerus strain ATCC 27064 plasmid pCLA1, complete sequence) position: , mismatch: 9, identity: 0.719
ggtgtgggccagacggacaccgacagcagctc CRISPR spacer
gccagcagcaagacggacaccgacagcagcag Protospacer
* .. .** ********************
500. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032924 (Agrobacterium tumefaciens strain 1D1108 plasmid pAt1D1108b, complete sequence) position: , mismatch: 9, identity: 0.719
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
tccgaagcgggacgcggcgaccggactaaggc Protospacer
*** ** *****************.. . *
501. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_011758 (Methylorubrum extorquens CM4 plasmid pCMU01, complete sequence) position: , mismatch: 9, identity: 0.719
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
ggaagaccgggacgcggcgacgcggtggctcg Protospacer
.**************** ****** .*
502. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.719
tcccaac-----cgggacgcggcgaccgggtggcgtg CRISPR spacer
-----acggctgcgggacgcggcgacctggcggcggc Protospacer
** *************** **.****
503. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.719
tcccaac-----cgggacgcggcgaccgggtggcgtg CRISPR spacer
-----acggctgcgggacgcggcgacctggcggcggc Protospacer
** *************** **.****
504. spacer 5.20|2616824|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP054621 (Azospirillum oryzae strain KACC 14407 plasmid unnamed6, complete sequence) position: , mismatch: 9, identity: 0.719
tcccaaccgggacgcggcgaccgggtggcgtg CRISPR spacer
agcgaactggggcgcggcgaccgggtgtggct Protospacer
* ***.***.*************** *.
505. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016500 (Agrobacterium sp. RAC06 plasmid pBSY240_1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tctaaatgctcaaggtcgccgtcgtcgagcat Protospacer
.* **** ************* *****
506. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045856 (Agrobacterium sp. MA01 plasmid punanmed2, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tctaaatgctcaaggtcgccgtcgtcgagcat Protospacer
.* **** ************* *****
507. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029542 (Streptomyces sp. NEAU-S7GS2 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
tcgtccagctccagctcgccgtcgacctgctt Protospacer
.*****.******* ********* **
508. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MN096360 (Mycobacterium phage Rita1961, complete genome) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
gtgtccggctcctgctcgccgtcgtccaggtc Protospacer
.********** * ********** **
509. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MN096359 (Mycobacterium phage Obutu, complete genome) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
gtgtccggctcctgctcgccgtcgtccaggtt Protospacer
.********** * ********** **
510. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT952851 (Mycobacterium phage Gervas, complete genome) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
gtgtccggctcctgctcgccgtcgtccaggtc Protospacer
.********** * ********** **
511. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KJ194584 (Mycobacterium phage Heathcliff, complete genome) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
gtgtccggctcctgctcgccgtcgtccaggtc Protospacer
.********** * ********** **
512. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to DQ398049 (Mycobacterium phage Pipefish, complete genome) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
gtgtccggctcctgctcgccgtcgtccaggtc Protospacer
.********** * ********** **
513. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KF493879 (Mycobacterium phage Bernardo, complete genome) position: , mismatch: 9, identity: 0.719
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
gtgtccggctcctgctcgccgtcgtccaggtc Protospacer
.********** * ********** **
514. spacer 5.22|2616946|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MN484601 (Gordonia phage Sixama, complete genome) position: , mismatch: 9, identity: 0.719
tcctcccacgtcttgccgacgacctcggcgcc CRISPR spacer
acgccgttagtcttgcagaagacctcggcgcc Protospacer
* .* . ******* ** ************
515. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to AP018698 (Arthrobacter sp. MN05-02 plasmid plasmid1 DNA, complete genome) position: , mismatch: 9, identity: 0.719
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
ctgccgcccctgcgcgtcccctgcccactact Protospacer
**** ********** ******** ....*
516. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_022043 (Paracoccus aminophilus JCM 7686 plasmid pAMI5, complete sequence) position: , mismatch: 9, identity: 0.719
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
caattcgccctgcgcgtcgcctgcccctcgat Protospacer
*... .********** *********** *
517. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
518. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
519. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
520. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
521. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
522. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
523. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
524. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
525. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
526. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
527. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
528. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactggtccagctccggctcggacaggct CRISPR spacer
ttgagcgtgtccagctccggctgggtcaggct Protospacer
. .* ************** ** ******
529. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP026093 (Ralstonia solanacearum strain SFC plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gcccactg-gtccagctccggctcggacaggct CRISPR spacer
-catgcgatgtccagccccggatcggacaggcg Protospacer
* ..* . *******.**** **********
530. spacer 5.26|2617190|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 9, identity: 0.719
atcacgtcgggcgcgcagtagctcggctggtt CRISPR spacer
ggcggctcgggcgcgcagtacctcggccgggg Protospacer
. *. ************** ******.**
531. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013635 (Rhizobium sp. N324 plasmid pRspN324e, complete sequence) position: , mismatch: 9, identity: 0.719
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
ttctcgccgaagtccagcaggccgatcagatc Protospacer
********. ************* * *
532. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
atctcgccggtggccagcacgccggccatttc Protospacer
.*********** ****** **** . *.*
533. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_031004 (Gordonia phage Nyceirae, complete genome) position: , mismatch: 9, identity: 0.719
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
tcagcgagggtgtccagcaggccgtcgatctt Protospacer
. ** *****************.* ***
534. spacer 5.28|2617312|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP035511 (Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence) position: , mismatch: 9, identity: 0.719
ctcgtcatcacggcggcggggggtgatccggc CRISPR spacer
aacgtcaccacggcggcgggcggtgtgaaagc Protospacer
*****.************ **** .**
535. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032340 (Azospirillum brasilense strain MTCC4038 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
ccggcctccaggtgctcgacgccgtgcagaac Protospacer
.***************** **** * . .*
536. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP012915 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
ccggcctccaggtgctcgacgccgtgcagaac Protospacer
.***************** **** * . .*
537. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MT711888 (Pseudomonas phage Dolphis, complete genome) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
ccggcctccaggcgctcgcggacgaacgagag Protospacer
.***********.******** ***. * .
538. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttttcgcggcc----gccgtagcg Protospacer
************ .******** **.*.
539. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
ccggcctccaggtgctcgacgccgtgcagaac Protospacer
.***************** **** * . .*
540. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttttcgcggcc----gccgtagcg Protospacer
************ .******** **.*.
541. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttttcgcggcc----gccgtagcg Protospacer
************ .******** **.*.
542. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttttcgcggcc----gccgtagcg Protospacer
************ .******** **.*.
543. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc---- CRISPR spacer
acggcctccaggttttcgcggcc----gccgtagcg Protospacer
************ .******** **.*.
544. spacer 5.30|2617434|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcggcctccaggtgctcgcggccgagggctgc CRISPR spacer
ccggcctccaggtgctcgacgccgtgcagaac Protospacer
.***************** **** * . .*
545. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022367 (Azospirillum sp. TSH58 plasmid TSH58_p02, complete sequence) position: , mismatch: 9, identity: 0.719
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
cttggccggacgcagcacgccgtgcagcagcg Protospacer
. *. .********** ********** **
546. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 9, identity: 0.719
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
ggcgcacggccgcaggaggccgtgcagctgta Protospacer
* * ..** ***** **************.
547. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MF377440 (Mycobacterium phage Bella96, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccaaacctgctcgacgtgccgttgctcgtc Protospacer
* .. *******.******* ********
548. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MK494119 (Mycobacterium Phage Niklas, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccacacctgctcgacgtgccgctgctcgtc Protospacer
* . *******.******* ********
549. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_042031 (Mycobacterium phage Anaya, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccaaacctgctcgacgtgccgctgctcgtc Protospacer
* .. *******.******* ********
550. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MK310138 (Mycobacterium phage Shaobing, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccacacctgctcgacgtgccgctgctcgtc Protospacer
* . *******.******* ********
551. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KX657796 (Mycobacterium phage Urkel, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccaaacctgctcgacgtgccgttgctcgtc Protospacer
* .. *******.******* ********
552. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MF185722 (Mycobacterium phage Peanam, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccacacctgctcgacgtgccgctgctcgtc Protospacer
* . *******.******* ********
553. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KX657794 (Mycobacterium phage SamuelLPlaqson, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccaaacctgctcgacgtgccgttgctcgtc Protospacer
* .. *******.******* ********
554. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to KX657795 (Mycobacterium phage DrHayes, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccaaacctgctcgacgtgccgttgctcgtc Protospacer
* .. *******.******* ********
555. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_023498 (Mycobacterium phage Validus, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccacacctgctcgacgtgccgctgctcgtc Protospacer
* . *******.******* ********
556. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to JX042579 (Mycobacterium virus MacnCheese, complete genome) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
gcccaaacctgctcgacgtgccgctgctcgtc Protospacer
* .. *******.******* ********
557. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134446 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 4, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tcgcggcgctgctcggcgcgccgcccaccccc Protospacer
*** **************.**** . .* .*
558. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_015383 (Burkholderia gladioli BSR3 plasmid bgla_4p, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggc--gctgctcggcgtgccggtgctcgtc CRISPR spacer
--agtactggctgctcggcgtgctggtgttcggg Protospacer
.* .* **************.****.***
559. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022366 (Azospirillum sp. TSH58 plasmid TSH58_p04, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tcggcgcgctgctcggcgagccgcaattccag Protospacer
**** ************* **** ..**
560. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tccttctgctgctcggcctgccggcgctcgct Protospacer
** .********** ******.*****..
561. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
tccttctgctgctcggcctgccggcgctcgct Protospacer
** .********** ******.*****..
562. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032346 (Azospirillum brasilense strain MTCC4039 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
cgctgtcgccgctcggcgtgccggcgctcatg Protospacer
. * ***.**************.****.*
563. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ccagcgcgctgcgcggcgggccggtgctgcag Protospacer
.*.* ******* ***** *********
564. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_010847 (Paracoccus aminophilus strain JCM 7686 plasmid pAMI2, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccctgctcatcaccacgctcgccgtgccg- CRISPR spacer
aggccctgctcatcgtcacgctcg-cgcatcaa Protospacer
. ************..******** **...*.
565. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022571 (Mycolicibacterium poriferae strain JCM 12603 plasmid pJCM12603, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
acaccctgctcttcgccacgctcgccacacta Protospacer
.*.******** **.***********...*..
566. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_008703 (Mycobacterium sp. KMS plasmid pMKMS01, complete sequence) position: , mismatch: 9, identity: 0.719
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
acaccctgctcttcgccacgctcgccacacta Protospacer
.*.******** **.***********...*..
567. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP041652 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.2, complete sequence) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ctctcgtggtcgctgacgtcgaacggcgccgc Protospacer
. *****************.******
568. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
tgctcgtggtcgttgacgtcgagcgacgcgac Protospacer
. . *******.************.****
569. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP041605 (Streptomyces sp. S1D4-14 plasmid pS1D4-14.1, complete sequence) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ctctcgtggtcgctgacgtcgaacggcgctgc Protospacer
. *****************.******
570. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP030863 (Streptomyces globosus strain LZH-48 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ttctcgcggtcgctgaagtcgaacggcgcgca Protospacer
. *.********* *****.*******.*
571. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP015419 (Rhodovulum sulfidophilum DSM 1374 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
tagaccgggtcggtcacgtcgagcggcgcggc Protospacer
** ***** * ***************
572. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP015422 (Rhodovulum sulfidophilum strain SNK001 plasmid, complete sequence) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
tagaccgggtcggtcacgtcgagcggcgcggc Protospacer
** ***** * ***************
573. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_AP014802 (Rhodovulum sulfidophilum plasmid Plasmid2 DNA, complete genome, strain: DSM 2351) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
tagaccgggtcggtcacgtcgagcggcgcggc Protospacer
** ***** * ***************
574. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to MN586047 (Gordonia phage EMoore, complete genome) position: , mismatch: 9, identity: 0.719
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
gggtcgacgtcggtgacgtcgatcggcgcgtc Protospacer
..*. * **** ********* ********
575. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccgacctatgggctcgccgccggcctctata Protospacer
* . ** ******************** .
576. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023721 (Rhodococcus sp. H-CA8f plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tgaacccgattggttcgccgccgaaatctaca Protospacer
********** **.*********. ** .
577. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_019848 (Sinorhizobium meliloti GR4 plasmid pRmeGR4c, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
578. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049731 (Rhizobium leguminosarum strain A1 plasmid pRL12, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctacgggctcgccgccggcctcttca Protospacer
* . ** *.****************** * .
579. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_003037 (Sinorhizobium meliloti 1021 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
580. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019585 (Sinorhizobium meliloti strain CCMM B554 (FSM-MA) plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
581. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021798 (Sinorhizobium meliloti strain USDA1106 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
582. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017324 (Sinorhizobium meliloti BL225C plasmid pSINMEB01, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
583. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
584. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021827 (Sinorhizobium meliloti strain KH35c plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
585. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP054022 (Rhizobium sp. JKLM12A2 plasmid pPR12A201, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctatgggctcgccgcaggcctcttca Protospacer
* . ** ************* ****** * .
586. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021801 (Sinorhizobium meliloti strain USDA1021 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
587. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021819 (Sinorhizobium meliloti strain M162 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
588. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021830 (Sinorhizobium meliloti strain HM006 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
589. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
590. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021813 (Sinorhizobium meliloti strain M270 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
591. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
592. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021794 (Sinorhizobium meliloti strain USDA1157 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
593. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
594. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021805 (Sinorhizobium meliloti strain T073 plasmid psymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
595. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
596. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_017833 (Streptomyces sp. FR1 plasmid pFP4, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tctccacgatgggcacggcgccggcctcgccc Protospacer
* * ******** ** ***********.
597. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019483 (Sinorhizobium meliloti strain B401 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
598. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP053206 (Rhizobium leguminosarum bv. trifolii TA1 plasmid pRltTA1D, complete sequence) position: , mismatch: 9, identity: 0.719
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
tccggcctacgggctcgccgccggcctcttca Protospacer
* . ** *.****************** * .
599. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP019486 (Sinorhizobium meliloti strain B399 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
600. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_020527 (Sinorhizobium meliloti 2011 plasmid pSymA, complete sequence) position: , mismatch: 9, identity: 0.719
----tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gcgttgg----gatgggcttgccgccggcgtcgtca Protospacer
**. ********.********* **** .
601. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP025513 (Neorhizobium sp. SOG26 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
tcaggacggatcagcagcgtcacggcctgacc Protospacer
* .. ****** **** ************
602. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK967395 (Mycobacterium phage WideWale, complete genome) position: , mismatch: 9, identity: 0.719
gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
gccctgtaccagctctccgaccaggccggcgt Protospacer
*. .****** ******** *******. .*
603. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MF919538 (Mycobacterium phage Updawg, complete genome) position: , mismatch: 9, identity: 0.719
gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
gccctgtaccagctctccgaccaggccggcgt Protospacer
*. .****** ******** *******. .*
604. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH825701 (Mycobacterium phage Flare16, complete genome) position: , mismatch: 9, identity: 0.719
gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
gccctgtaccagctctccgaccaggccggcgt Protospacer
*. .****** ******** *******. .*
605. spacer 6.9|2629956|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to KJ959632 (Mycobacterium phage Equemioh13, complete genome) position: , mismatch: 9, identity: 0.719
gtgacgtaccacctctccgagcaggccgagat CRISPR spacer
gccctgtaccagctctccgaccaggccggcgt Protospacer
*. .****** ******** *******. .*
606. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP047236 (Gordonia sp. JH63 plasmid pJH63-1, complete sequence) position: , mismatch: 9, identity: 0.719
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
tgcgcggcgagcagggcggtggtgtcgcggct Protospacer
*******. *************** *
607. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013298 (Arthrobacter sp. YC-RL1 plasmid unnamed 1, complete sequence) position: , mismatch: 9, identity: 0.719
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gcggcggctaagagggcggcggtgatcgatag Protospacer
.******* **********.**** . * .*
608. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 9, identity: 0.719
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
tcgacggcgaagagggcggtgatgaccgcgcc Protospacer
**.*****************.** * *. .
609. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP043441 (Cupriavidus campinensis strain MJ1 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gagggcgcgaagacggcggtgctgtcggtgcc Protospacer
. ** ******* ******* ******* .
610. spacer 6.12|2630139|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_016587 (Azospirillum lipoferum 4B plasmid AZO_p4, complete sequence) position: , mismatch: 9, identity: 0.719
ggagtctcggtcggcgtgaccttgtacaggtc CRISPR spacer
accatgccggtcggcgcgaccttggacaggta Protospacer
. .* .*********.******* ******
611. spacer 6.12|2630139|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_007336 (Cupriavidus pinatubonensis JMP134 megaplasmid, complete sequence) position: , mismatch: 9, identity: 0.719
ggagtctcggtcggcgtgaccttgtacaggtc CRISPR spacer
tacgtgacggcctgcgtgaccttgtacaggcg Protospacer
. ** ***.* *****************.
612. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP013712 (Klebsiella pneumoniae strain J1 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gcggatgtcacccaggtcgacaagctgctgca Protospacer
* * .********* ********* ***
613. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT219824 (Escherichia coli strain RT18-1 plasmid pRT18-1_294k_tetX, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gcggatgtcacccaggtcgacaagctgctgca Protospacer
* * .********* ********* ***
614. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP048383 (Citrobacter freundii strain 62 plasmid p6_A, complete sequence) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gcggatgtcacccaggtcgacaagctgctgca Protospacer
* * .********* ********* ***
615. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK937601 (Gordonia phage Charming, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
616. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976519 (Gordonia phage Tangent, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
617. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH153809 (Gordonia phage Sitar, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
618. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976518 (Gordonia phage Stultus, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
619. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH479924 (Gordonia phage Rofo, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
620. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK937594 (Gordonia phage Galadriel, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
621. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN329673 (Gordonia phage Jabberwocky, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
622. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT723934 (Gordonia phage Love, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
623. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH651166 (Gordonia phage Angelicage, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
624. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT639640 (Gordonia phage Paries, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
625. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MK977702 (Gordonia terrae phage McKinley, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
626. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_042108 (Gordonia phage Brandonk123, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
627. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976514 (Gordonia phage Nordenberg, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
628. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976508 (Gordonia phage Bibwit, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
629. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976506 (Gordonia phage Affeca, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
630. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN329677 (Gordonia phage Keitabear, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
631. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_042045 (Gordonia phage Lennon, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
632. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976507 (Gordonia phage Ailee, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
633. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT498035 (Gordonia Phage Barsten, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
634. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH976512 (Gordonia phage Geodirt, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
635. spacer 6.13|2630200|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_031239 (Gordonia phage Vivi2, complete genome) position: , mismatch: 9, identity: 0.719
cccgccgtcacccagctcgacaagcagctcgt CRISPR spacer
gacgccgtcaccgaactcgacaagctcgccgc Protospacer
********** *.********** .**.
636. spacer 6.17|2630444|32|CP028719|CRISPRCasFinder,CRT matches to NC_015951 (Streptomyces violaceusniger Tu 4113 plasmid pSTRVI01, complete sequence) position: , mismatch: 9, identity: 0.719
gccaccgggtcctcgaggacaccgtcggcgtc CRISPR spacer
ccctccgcgtcctcgaggacaccgacactgca Protospacer
** *** **************** *. .*.
637. spacer 6.17|2630444|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP013855 (Pseudonocardia sp. HH130630-07 plasmid pLS2-1, complete sequence) position: , mismatch: 9, identity: 0.719
gccaccgggtcctcgaggacaccgtcggcgtc CRISPR spacer
agcatgccgtcgtcgaggacaccggcggcgtg Protospacer
. **. *** ************ ******
638. spacer 6.17|2630444|32|CP028719|CRISPRCasFinder,CRT matches to CP040467 (Streptomyces albidoflavus strain UYFA156 plasmid unnamed, complete sequence) position: , mismatch: 9, identity: 0.719
gccaccgggtcctcgaggacaccgtcggcgtc CRISPR spacer
aggacgccgtcgtcgaggacaccggcggcgtg Protospacer
. ** *** ************ ******
639. spacer 6.21|2630505|32|CP028719|CRT matches to MH744420 (Streptomyces phage Kromp, complete genome) position: , mismatch: 9, identity: 0.719
gtcgacgccgtactcgccgccccacgcctccc CRISPR spacer
ggggacgccgtagtcgccgacccacgaccagg Protospacer
* ********* ****** ****** *.
640. spacer 6.22|2630566|30|CP028719|CRT matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgggccggtctcgacgccctcgccgccgga Protospacer
. ******.********.*******
641. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
642. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
tgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
643. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
644. spacer 6.22|2630566|30|CP028719|CRT matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgggccggtctcgacgccctcgccgccgga Protospacer
. ******.********.*******
645. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
646. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
647. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
648. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
649. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
650. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
651. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
652. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
653. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
654. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
655. spacer 6.22|2630566|30|CP028719|CRT matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 9, identity: 0.7
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
656. spacer 7.1|2637193|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP034156 (Rhodococcus sp. NJ-530 plasmid unnamed4, complete sequence) position: , mismatch: 9, identity: 0.719
gacgtagtagctgtgcccgtccgcagtgtggt CRISPR spacer
gtgacatcggctgtggccgtcggcagtgtggt Protospacer
* ..* ..****** ***** **********
657. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_006912 (Streptomyces sp. FQ1 plasmid pFP1, complete sequence) position: , mismatch: 9, identity: 0.719
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
cgaccgggcgaccggtgtgccgcgtgatcacg Protospacer
*... *. ********.******** *****
658. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
cgaccgggcgaccggtgtgccgcgtgatcacg Protospacer
*... *. ********.******** *****
659. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP029602 (Streptomyces sp. WAC 01438 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
cgaccgggcgaccggtgtgccgcgtgatcacg Protospacer
*... *. ********.******** *****
660. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011450 (Sphingomonas sanxanigenens DSM 19645 = NX02 plasmid pNXO2, complete sequence) position: , mismatch: 9, identity: 0.719
tcgaccaggagctggctgaccgacgccggctc CRISPR spacer
cgctgcaggtgctggctggccgacgccggcga Protospacer
. **** ********.***********
661. spacer 2.2|763801|34|CP028719|CRISPRCasFinder matches to NZ_CP016082 (Streptomyces sp. SAT1 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.706
gacgccgccaggtgcccctgcggggcttccgaac CRISPR spacer
tcttccgccaggtgaccctgcgcggcttctggct Protospacer
. ********** ******* ******.*. .
662. spacer 2.3|763858|31|CP028719|CRISPRCasFinder matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 10, identity: 0.677
ggatcccgcaggcccatcaggtcccgcaggg CRISPR spacer
acgccccgctggcccatcaggtccagccaca Protospacer
. ..***** ************** ** . .
663. spacer 5.4|2615847|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP035512 (Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence) position: , mismatch: 10, identity: 0.688
ttgaccttgtcggtctcgaatgccgcccggat CRISPR spacer
caggaacagtcgggcgcgaatgccgcccggaa Protospacer
. *. . ***** * ***************
664. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022775 (Ralstonia solanacearum strain T12 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
665. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_008713 (Paenarthrobacter aurescens TC1 plasmid pTC2, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ccgcacccggccgtgctgggccgccgccacat Protospacer
.* ******** *****.********. ..
666. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_014310 (Ralstonia solanacearum PSI07 plasmid mpPSI07, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
667. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022762 (Ralstonia solanacearum strain T95 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
668. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023017 (Ralstonia solanacearum strain SL3022 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
669. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP022607 (Mycobacterium branderi strain JCM 12687 plasmid pJCM12687) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
gcttcgttggccgagctcgatcgccgccgagt Protospacer
.. * ..********* **.**********.
670. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP014703 (Ralstonia solanacearum strain KACC 10722 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
671. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022760 (Ralstonia solanacearum strain T98 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
672. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022789 (Ralstonia solanacearum strain SL3175 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
673. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022771 (Ralstonia solanacearum strain T51 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
674. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022777 (Ralstonia solanacearum strain T11 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
675. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022799 (Ralstonia solanacearum strain SL2064 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
676. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022764 (Ralstonia solanacearum strain T82 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
677. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022797 (Ralstonia solanacearum strain SL2312 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
678. spacer 5.5|2615908|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP022758 (Ralstonia solanacearum strain T101 plasmid unnamed, complete sequence) position: , mismatch: 10, identity: 0.688
atgaccccggccgagctggaccgccgccgagc CRISPR spacer
ttctccccggccgagcaggaccggcgcgatag Protospacer
* ************ ****** *** . .
679. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039899 (Agrobacterium tumefaciens strain CFBP5877 plasmid pAtCFBP5877a, complete sequence) position: , mismatch: 10, identity: 0.688
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tagcctccgctgccggcggtgcccggcgccga Protospacer
..* . .***** ****.************
680. spacer 5.13|2616396|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP039890 (Agrobacterium tumefaciens strain CFBP5499 plasmid pAtCFBP5499a, complete sequence) position: , mismatch: 10, identity: 0.688
cggatgatgctgcgggcgatgcccggcgccgc CRISPR spacer
tagcctccgctgccggcggtgcccggcgccga Protospacer
..* . .***** ****.************
681. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP016354 (Prauserella marina strain DSM 45268 plasmid pPmarDSM45268, complete sequence) position: , mismatch: 10, identity: 0.688
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
acggcgctgtcgtcggcgggtttgcgttcggg Protospacer
****************** *.** . *
682. spacer 5.15|2616519|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 10, identity: 0.688
cgggcgctgtcgtcggcggggtcgccgcagtc CRISPR spacer
tgctcgctgaggtcggcggggtcgccgtgaat Protospacer
.* ***** ****************... .
683. spacer 5.18|2616702|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_AP022602 (Mycobacterium gallinarum strain JCM 6399 plasmid pJCM6399) position: , mismatch: 10, identity: 0.688
ggcttcctgtgcgaggcgcggagcacccggga CRISPR spacer
cgcttcccgtgcgcggcgcggagcagttttcg Protospacer
******.***** *********** .. .
684. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014514 (Frondihabitans sp. PAMC 28766 strain SR6 plasmid 1, complete sequence) position: , mismatch: 10, identity: 0.688
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
ggatccgcccccaggtcgccgtcgtgaaagcc Protospacer
.**** *.****************.*.
685. spacer 5.21|2616885|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to MK937605 (Mycobacterium phage Stephig9, complete genome) position: , mismatch: 10, identity: 0.688
ccgtccggctccaggtcgccgtcgtggagcag CRISPR spacer
atagacggctccaggccgtcgtcgtggatgaa Protospacer
.. **********.**.********* *.
686. spacer 5.22|2616946|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022999 (Rhizobium sp. 11515TR strain 10195 plasmid p11515TR-A, complete sequence) position: , mismatch: 10, identity: 0.688
tcctcccacgtcttgccgacgacctcggcgcc CRISPR spacer
cgctcccacgtcttgctgacgaactttgttat Protospacer
. **************.***** **. *. .
687. spacer 5.23|2617007|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015738 (Shinella sp. HZN7 plasmid pShin-02, complete sequence) position: , mismatch: 10, identity: 0.688
aagccgaccctgcgcgtgccctgcccctcgtt CRISPR spacer
cgctatgccctgcgcgtcgcctgcccctcgat Protospacer
. . .********** *********** *
688. spacer 5.24|2617068|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021373 (Rhizobium sp. ACO-34A plasmid pRACO34Ac, complete sequence) position: , mismatch: 10, identity: 0.688
cggcctgagcagtgccgacggccgaatcgtca CRISPR spacer
gcgcctgatcagtgccgacgcccgaacaagat Protospacer
****** *********** *****. .
689. spacer 5.24|2617068|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP021116 (Rhodobacteraceae bacterium strain G7 plasmid unnamed2, complete sequence) position: , mismatch: 10, identity: 0.688
cggcctgagcagtgccgacggccgaatcgtca CRISPR spacer
tcttttccgcagtgccgacggccccatcgtcc Protospacer
. ..* *************** ******
690. spacer 5.25|2617129|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP042999 (Aquisphaera giovannonii strain OJF2 plasmid pOJF2_2, complete sequence) position: , mismatch: 10, identity: 0.688
gcccactggtccagctccggctcggacaggct CRISPR spacer
cggacctggtccagctccggcccggccatccc Protospacer
****************.*** ** *.
691. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP044976 (Hydrogenophaga sp. PBL-H3 substr. PBL-H3(B2) plasmid pPBL-H3_B2-1, complete sequence) position: , mismatch: 10, identity: 0.688
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
ttggagccggtgtccagcgggccgctgtcagt Protospacer
* *************.*****.***.
692. spacer 5.27|2617251|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023549 (Rhodobacter sp. CZR27 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
gtctcgccggtgtccagcaggccgttgttctg CRISPR spacer
atgacgccggtggccagaaggccgttgccgat Protospacer
.* ******** **** *********..
693. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832562 (Paracoccus aminovorans isolate JCM7685 plasmid IV, complete sequence) position: , mismatch: 10, identity: 0.688
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
tattcgctgacccggcaggccgtgcagctgcg Protospacer
*. *** *.*****************
694. spacer 5.32|2617556|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP024423 (Paracoccus yeei strain TT13 plasmid pTT13-1, complete sequence) position: , mismatch: 10, identity: 0.688
gcggagtggacgcagcaggccgtgcagctgct CRISPR spacer
cttttgctgacgcagcatgtcgtgcagctgcg Protospacer
. *. ********* *.***********
695. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 10, identity: 0.688
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ggccggcggtgctcggcgtgcgggtgcctgag Protospacer
**** ************ *****..*
696. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 10, identity: 0.688
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ggccggcggtgctcggcgtgcgggtgcctgag Protospacer
**** ************ *****..*
697. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NC_016585 (Azospirillum lipoferum 4B plasmid AZO_p1, complete sequence) position: , mismatch: 10, identity: 0.688
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
agggggtgctgcgcggcgtgccggtctatatt Protospacer
****.***** ************ . ..*.
698. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP006988 (Rhizobium sp. IE4771 plasmid pRetIE4771b, complete sequence) position: , mismatch: 10, identity: 0.688
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
agattacggtgctcggcgtgccggtgcccgct Protospacer
. .** ******************.**..
699. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134452 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 10, complete sequence) position: , mismatch: 10, identity: 0.688
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
cgatcgtgctcatcatcgcgctcgccgtgggc Protospacer
..* *********.*.***********
700. spacer 5.37|2617862|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LN832560 (Paracoccus aminovorans isolate JCM7685 plasmid II, complete sequence) position: , mismatch: 10, identity: 0.688
gcgccctgctcatcaccacgctcgccgtgccg CRISPR spacer
agagataggtcaccaccacgcccgccgtgccg Protospacer
. . . * ***.********.**********
701. spacer 5.40|2618046|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015881 (Ensifer adhaerens strain Casida A plasmid pCasidaAA, complete sequence) position: , mismatch: 10, identity: 0.688
gccgggtgagacgtactgggcgttcgcggacg CRISPR spacer
ggcgggtgagacgtagtcggcgttcttttcga Protospacer
* ************* * ******* . .
702. spacer 5.40|2618046|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030263 (Ensifer adhaerens strain Corn53 plasmid AA, complete sequence) position: , mismatch: 10, identity: 0.688
gccgggtgagacgtactgggcgttcgcggacg CRISPR spacer
ggcgggtgagacgtagtcggcgttcttttcga Protospacer
* ************* * ******* . .
703. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NC_004719 (Streptomyces avermitilis MA-4680 = NBRC 14893 plasmid SAP1, complete sequence) position: , mismatch: 10, identity: 0.688
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ctctcgtggtcgctgacatcgaacggcgccgc Protospacer
. ************.****.******
704. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP041653 (Streptomyces sp. RLB1-9 plasmid pRLB1-9.1, complete sequence) position: , mismatch: 10, identity: 0.688
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
tgctgcaggtcgctgacgtcgtccggcgcggg Protospacer
. .* ************** ******* .
705. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to NZ_CP017563 (Paraburkholderia sprentiae WSM5005 plasmid pl1WSM5005, complete sequence) position: , mismatch: 10, identity: 0.688
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
ggctcggggtcgctgacgtcgagcaccgcgct Protospacer
.. . * *****************. ****.
706. spacer 5.42|2618168|32|CP028719|CRISPRCasFinder,CRT matches to MH588544 (Caulobacter phage CcrBL10, complete genome) position: , mismatch: 10, identity: 0.688
aagcggtggtcgctgacgtcgagcggcgcgta CRISPR spacer
tctccacggtcgctgacttcgagcgccgcgcc Protospacer
* ..********** ******* ****.
707. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP015867 (Streptomyces parvulus strain 2297 plasmid pSPA1, complete sequence) position: , mismatch: 10, identity: 0.688
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gctcgccgccgggctcgccgccggcctcaccg Protospacer
*** .******************.. *
708. spacer 6.5|2629712|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP033873 (Caulobacter sp. FWC26 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
acgtcctcggacagcaagccgaagaagagcaa CRISPR spacer
gcgttctcggacaggaagccgaagcccggatg Protospacer
.***.********* ********* .* .
709. spacer 6.5|2629712|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_008010 (Deinococcus geothermalis DSM 11300 plasmid pDGEO01, complete sequence) position: , mismatch: 10, identity: 0.688
acgtcctcggacagcaagccgaagaagagcaa CRISPR spacer
aatccctcggtcagaaagccgaagaaggtgcg Protospacer
* .****** *** ************. .
710. spacer 6.6|2629773|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_012586 (Sinorhizobium fredii NGR234 plasmid pNGR234b, complete sequence) position: , mismatch: 10, identity: 0.688
gaaggtcggctcgccggatcttcagcggttcg CRISPR spacer
gcccgtcggctcgcccgagcttcagcgccggc Protospacer
* *********** ** ******** .
711. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MH807820 (Dickeya phage Coodle, complete genome) position: , mismatch: 10, identity: 0.688
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
gtggacaggatcatcaccttcacggccaaaat Protospacer
.. .**.********* ********** .*
712. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN871496 (UNVERIFIED: Salmonella phage Se-H, complete genome) position: , mismatch: 10, identity: 0.688
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
gtggacaggatcatcaccttcacggccaaaat Protospacer
.. .**.********* ********** .*
713. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN871498 (UNVERIFIED: Salmonella phage Se-J, complete genome) position: , mismatch: 10, identity: 0.688
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
gtggacaggatcatcaccttcacggccaaaat Protospacer
.. .**.********* ********** .*
714. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN871497 (UNVERIFIED: Salmonella phage Se-I, complete genome) position: , mismatch: 10, identity: 0.688
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
gtggacaggatcatcaccttcacggccaaaat Protospacer
.. .**.********* ********** .*
715. spacer 6.7|2629834|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN871499 (UNVERIFIED: Salmonella phage Se-N, complete genome) position: , mismatch: 10, identity: 0.688
accaacgggatcatcagcttcacggcctgacg CRISPR spacer
gtggacaggatcatcaccttcacggccaaaat Protospacer
.. .**.********* ********** .*
716. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_LR027520 (Thermus thermophilus isolate TTHNAR1 plasmid 4, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ccggcggcgaagaggccgggggtggccagggg Protospacer
************** *** **** * . .
717. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP049749 (Rhodococcus fascians A21d2 plasmid pA21d2, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
tactcggcgaagcgggcgttggtgtcgtggac Protospacer
******** ***** ******** *.
718. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MN657140 (Cryobacterium sp. strain ANT_H26B plasmid pA26BH1, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
tactcggcgaagcgggcgttggtgtcgtggac Protospacer
******** ***** ******** *.
719. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_023284 (Streptomyces sp. F2 plasmid pFRL4, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gcctgggcgaagagggcggtgtagtcgggggc Protospacer
.* **************** ***** ..
720. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_013858 (Azospirillum sp. B510 plasmid pAB510d, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
ccggcggcgaagcgggcggcggtgacctcgcc Protospacer
*********** ******.**** * . .
721. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP023408 (Streptomyces fungicidicus strain TXX3120 plasmid p1, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
atccgggtgaagagggcggcggtgtcgggggc Protospacer
*. **.***********.******** ..
722. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP041045 (Paracoccus sp. AK26 plasmid pAK1, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gggttcccgaagaggacgggggtgtcggtctg Protospacer
. * . ********.*** **********
723. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_003903 (Streptomyces coelicolor A3(2) plasmid SCP1, complete sequence) position: , mismatch: 10, identity: 0.688
acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
gtgatggcgaagaggggggtggtgccggcaga Protospacer
..*..*********** *******.***. .
724. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 10, identity: 0.688
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
gcgaccatggtcttgacgcccttgcgctttgc Protospacer
.****..***************** .. *
725. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013523 (Rhizobium phaseoli strain R744 plasmid pRphaR744a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
726. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP013526 (Rhizobium phaseoli strain R744 plasmid pRphaR744d, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
727. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP029453 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
728. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP029453 (Sinorhizobium fredii CCBAU 25509 plasmid pSF25509a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
729. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
730. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
731. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP023069 (Ensifer sojae CCBAU 05684 plasmid pSJ05684a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
732. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP023072 (Sinorhizobium fredii CCBAU 83666 plasmid pSF83666a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
733. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
734. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
735. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP029233 (Sinorhizobium fredii CCBAU 45436 plasmid pSF45436a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
736. spacer 6.22|2630566|30|CP028719|CRT matches to NZ_CP023065 (Sinorhizobium sp. CCBAU 05631 plasmid pSS05631a, complete sequence) position: , mismatch: 10, identity: 0.667
gaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cgccgcggtcttgaagcccttgcacggatt Protospacer
.************ ******** ...
737. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 10, identity: 0.688
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
gagtacgacgaccggtgtgccgcgccgcctaa Protospacer
******* ********.******. .* .
738. spacer 7.2|2637254|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to CP006880 (Rhizobium gallicum bv. gallicum R602 plasmid pRgalR602c, complete sequence) position: , mismatch: 10, identity: 0.688
cagtacgaggaccggtgcgccgcgtgctcacg CRISPR spacer
gagtacgacgaccggtgtgccgcgccgcctaa Protospacer
******* ********.******. .* .
739. spacer 7.3|2637315|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019438 (Thioclava nitratireducens strain 25B10_4 plasmid unnamed1, complete sequence) position: , mismatch: 10, identity: 0.688
tcgaccaggagctggctgaccgacgccggctc CRISPR spacer
accgccaagagctggctgaccgaggccccgct Protospacer
* .***.*************** *** ..
740. spacer 5.14|2616457|33|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP009145 (Sinorhizobium meliloti strain RMO17 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.667
gctcatttcggctggtcatgacggcctcgatct CRISPR spacer
tggggtttcggctggtcatggcggccgcggggc Protospacer
.***************.***** **. .
741. spacer 5.14|2616457|33|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021824 (Sinorhizobium meliloti strain KH46 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.667
gctcatttcggctggtcatgacggcctcgatct CRISPR spacer
tggggtttcggctggtcatggcggccgcggggc Protospacer
.***************.***** **. .
742. spacer 5.14|2616457|33|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NC_018683 (Sinorhizobium meliloti Rm41 plasmid pSYMA, complete sequence) position: , mismatch: 11, identity: 0.667
gctcatttcggctggtcatgacggcctcgatct CRISPR spacer
tggggtttcggctggtcatggcggccgcggggc Protospacer
.***************.***** **. .
743. spacer 5.14|2616457|33|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP021809 (Sinorhizobium meliloti strain Rm41 plasmid psymA, complete sequence) position: , mismatch: 11, identity: 0.667
gctcatttcggctggtcatgacggcctcgatct CRISPR spacer
tggggtttcggctggtcatggcggccgcggggc Protospacer
.***************.***** **. .
744. spacer 5.14|2616457|33|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP026526 (Sinorhizobium meliloti strain AK21 plasmid pSymA, complete sequence) position: , mismatch: 11, identity: 0.667
gctcatttcggctggtcatgacggcctcgatct CRISPR spacer
tggggtttcggctggtcatggcggccgcggggc Protospacer
.***************.***** **. .
745. spacer 5.19|2616763|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030772 (Streptomyces sp. YIM 121038 plasmid pSSP121038, complete sequence) position: , mismatch: 11, identity: 0.656
ggtgtgggccagacggacaccgacagcagctc CRISPR spacer
ctgctgggccggccggacaccgacagctcgcg Protospacer
******.* ************** .
746. spacer 5.22|2616946|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045549 (Streptomyces sp. SYP-A7193 plasmid unnamed2, complete sequence) position: , mismatch: 11, identity: 0.656
tcctcccacg---------tcttgccgacgacctcggcgcc CRISPR spacer
---------gaggtggcggtcttgccgacgacgacggcgcc Protospacer
* ************* *******
747. spacer 5.34|2617679|32|CP028719|CRISPRCasFinder,CRT,PILER-CR matches to NZ_LR134455 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 13, complete sequence) position: , mismatch: 11, identity: 0.656
tcggggcgctgctcggcgtgccggtgctcgtc CRISPR spacer
ggcaggcgctgctcgtcgtgcaggtgcgtcca Protospacer
.*********** ***** ***** . .
748. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to CP006583 (Mesorhizobium huakuii 7653R plasmid pMHb, complete sequence) position: , mismatch: 11, identity: 0.656
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
gacctccgattggcacgccgccggcctccgca Protospacer
. .***** *** ************* .
749. spacer 6.2|2629529|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to NZ_AP014705 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_1p, complete sequence) position: , mismatch: 11, identity: 0.656
tgaacccgatgggctcgccgccggcctcgtag CRISPR spacer
cctgggcgacgggctcgccgcccgcctcgacc Protospacer
. . ***.************ ******
750. spacer 6.10|2630017|32|CP028719|PILER-CR,CRISPRCasFinder,CRT matches to MT952845 (Microbacterium phage GardenState, complete genome) position: , mismatch: 11, identity: 0.656
---acggcggcgaagagggcggtggtgtcggtcat CRISPR spacer
cggacggcgacgagggcggtggagtcgtcggt--- Protospacer
******.***.*. **.** * .******
751. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP020899 (Rhizobium phaseoli Brasil 5 strain Bra5 plasmid pRphaBra5c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
752. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP006989 (Rhizobium sp. IE4771 plasmid pRetIE4771c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agtgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
753. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013525 (Rhizobium phaseoli strain R744 plasmid pRphaR744c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
754. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NC_016113 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCAT, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cccgggccggtctcgacgccctcgccgccgga Protospacer
.. . ******.********.*******
755. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013588 (Rhizobium phaseoli strain N161 plasmid pRphaN161c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
756. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013560 (Rhizobium phaseoli strain N841 plasmid pRphaN841c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
757. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013577 (Rhizobium phaseoli strain N671 plasmid pRphaN671c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
758. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013549 (Rhizobium phaseoli strain R611 plasmid pRetR611b, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
759. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013529 (Rhizobium phaseoli strain R723 plasmid pRphaR723b, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
760. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013534 (Rhizobium phaseoli strain R650 plasmid pRphaR650b, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
761. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013539 (Rhizobium phaseoli strain R630 plasmid pRphaR630b, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
762. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013545 (Rhizobium phaseoli strain R620 plasmid pRphaR620c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
763. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NC_017585 (Streptomyces cattleya NRRL 8057 = DSM 46488 plasmid pSCATT, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
cccgggccggtctcgacgccctcgccgccgga Protospacer
.. . ******.********.*******
764. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013582 (Rhizobium phaseoli strain N261 plasmid pRphaN261b, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
765. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NZ_CP013571 (Rhizobium phaseoli strain N771 plasmid pRphaN771c, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
766. spacer 6.19|2630564|32|CP028719|CRISPRCasFinder matches to NC_010998 (Rhizobium etli CIAT 652 plasmid pA, complete sequence) position: , mismatch: 11, identity: 0.656
ttgaccgcggtcttgacgcccttgccgccgcc CRISPR spacer
agcgccacggtcttgacgccctcgccgggaaa Protospacer
.**.***************.**** .
