Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035299 Corynebacterium pelargi strain 136/3 chromosome, complete genome 1 crisprs csb2gr5,cas3,csb3,cas4,cas1,cas2,DinG,DEDDh,csa3,WYL 0 1 0 0

Results visualization

1. CP035299
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035299_1 161662-162429 Unclear NA
10 spacers
cas2,cas1,cas4,csb3,cas3,csb2gr5,csb1gr7

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035299_1 1.1|161698|37|CP035299|PILER-CR,CRISPRCasFinder,CRT 161698-161734 37 NZ_CP004394 Celeribacter indicus strain P73 plasmid pP73A, complete sequence 122112-122148 9 0.757

1. spacer 1.1|161698|37|CP035299|PILER-CR,CRISPRCasFinder,CRT matches to NZ_CP004394 (Celeribacter indicus strain P73 plasmid pP73A, complete sequence) position: , mismatch: 9, identity: 0.757

gcggcgcgatcagccgtcatgatgaactcacccagcg	CRISPR spacer
cgcgcgcgataggccgtcatgatgaactccggcaccg	Protospacer
   ******* .*****************   ** **

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage