Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026367 Sulfitobacter donghicola strain SB1155 chromosome, complete genome 6 crisprs WYL,csa3,cas2,cas1,cas9,cas3,DEDDh,DinG,cas14j 1 13 7 0

Results visualization

1. CP026367
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026367_1 511555-511636 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026367_2 761604-762629 orTypeII NA
15 spacers
cas2,cas1,cas9

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026367_3 768303-768603 orTypeII NA
4 spacers
cas9,cas1,cas2

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026367_4 1887641-1887736 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026367_5 1987328-1987423 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026367_6 2435572-2435663 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP026367_4 4.1|1887675|28|CP026367|CRISPRCasFinder 1887675-1887702 28 CP026367.1 1887797-1887824 2 0.929

1. spacer 4.1|1887675|28|CP026367|CRISPRCasFinder matches to position: 1887797-1887824, mismatch: 2, identity: 0.929

ttgcataagagccactattcagttaaaa	CRISPR spacer
ttgcataagagccactattcatttgaaa	Protospacer
********************* **.***

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 MF417891 Uncultured Caudovirales phage clone 10S_13, partial genome 28398-28426 0 1.0
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 MF417891 Uncultured Caudovirales phage clone 10S_13, partial genome 28398-28427 0 1.0
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 KY653129 Staphylococcus phage IME1365_01, complete genome 22816-22845 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 KR709302 Staphylococcus phage 55-2, complete genome 21415-21444 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_003288 Staphylococcus phage phiETA, complete genome 23510-23539 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AP001553 Staphylococcus phage phiETA DNA, complete genome 23510-23539 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007061 Staphylococcus phage 29, complete genome 6594-6623 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954962 Bacteriophage 71, complete genome 6491-6520 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AB370268 Staphylococcus phage phiMR11 DNA, complete genome 23609-23638 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007063 Staphylococcus phage 88, complete genome 6660-6689 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954966 Bacteriophage 88, complete genome 6660-6689 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954963 Bacteriophage 55, complete genome 6625-6654 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954964 Bacteriophage 29, complete genome 6594-6623 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007065 Staphylococcus phage X2, complete genome 6477-6506 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 MG564297 Staphylococcus phage UPMK_2, complete genome 13879-13908 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007059 Staphylococcus phage 71, complete genome 6491-6520 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 KR709303 Staphylococcus phage 55-3, complete genome 21848-21877 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 KC595279 Staphylococcus phage StauST398-5, complete genome 22394-22423 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 MG543995 Staphylococcus phage UPMK_1, partial genome 30963-30992 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_028915 Staphylococcus phage B236, complete genome 23738-23767 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 MK211557 Staphylococcus phage Henu2, complete genome 35060-35089 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_010147 Staphylococcus phage phiMR11, complete genome 23609-23638 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 JX094501 Staphylococcus phage SA13, complete genome 23148-23177 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954967 Bacteriophage 92, complete genome 6657-6686 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954968 Bacteriophage X2, complete genome 6477-6506 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007060 Staphylococcus phage 55, complete genome 6625-6654 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007064 Staphylococcus phage 92, complete genome 6657-6686 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 JX013863 Staphylococcus phage StauST398-1, complete genome 22258-22287 4 0.867
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 MN904510 Staphylococcus phage vB_SauS-SAP27, complete genome 41916-41945 4 0.867
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 AP013811 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S36-C173, *** SEQUENCING IN PROGRESS *** 1368-1396 4 0.862
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 JX519263 Uncultured Mediterranean phage MEDS1 group fosmid MedDCM-OCT-S13-C2, complete sequence 5767-5795 4 0.862
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP009640 Bacillus cereus 03BB108 plasmid pBFI_3, complete sequence 13136-13165 5 0.833
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP053961 Bacillus cereus strain FDAARGOS_802 plasmid unnamed1, complete sequence 46969-46998 5 0.833
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 KT878766 Staphylococcus phage P1105, complete genome 22115-22144 5 0.833
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 MH384261 Staphylococcus phage SA137ruMSSAST121PVL, complete genome 43122-43151 5 0.833
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 NC_025460 Staphylococcus phage phiSa119, complete genome 39609-39638 5 0.833
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 AY954956 Bacteriophage 3A, complete genome 23244-23273 5 0.833
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 NC_007053 Staphylococcus phage 3A, complete genome 23244-23273 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_007062 Staphylococcus phage 52A, complete genome 6671-6700 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AY954965 Bacteriophage 52A, complete genome 6671-6700 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 DQ908929 Staphylococcus phage 80, complete genome 21675-21704 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 KY653120 Staphylococcus phage IME1348_01, complete genome 22666-22695 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 JN192400 Staphylococcus phage vB_SepiS-phiIPLA5, complete genome 7011-7040 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 KU598975 Staphylococcus phage CNPx, complete genome 7065-7094 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 JN192401 Staphylococcus phage vB_SepiS-phiIPLA7, complete genome 6610-6639 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NC_008723 Staphylococcus phage PH15, complete genome 7713-7742 5 0.833
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 DQ831957 Staphylococcus phage CNPH82, complete genome 7065-7094 5 0.833
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 MF417885 Uncultured Caudovirales phage clone 3S_9, partial genome 20847-20876 5 0.833
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 532065-532094 5 0.833
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 AP013811 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S36-C173, *** SEQUENCING IN PROGRESS *** 1367-1396 5 0.833
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 JX519263 Uncultured Mediterranean phage MEDS1 group fosmid MedDCM-OCT-S13-C2, complete sequence 5766-5795 5 0.833
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 MH992183 Apis mellifera associated microvirus 33 isolate INH_SP_169, complete genome 3086-3115 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP019166 Listeria monocytogenes strain HPB5415 plasmid pLM5578, complete sequence 50298-50327 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_KU513859 Listeria monocytogenes strain IZSAM_Lm_15_17439_A144 plasmid pLmA144, complete sequence 83451-83480 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP022021 Listeria monocytogenes strain FDA709873-33 plasmid pCFSAN021445, complete sequence 87659-87688 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP022021 Listeria monocytogenes strain FDA709873-33 plasmid pCFSAN021445, complete sequence 149577-149606 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP023753 Listeria monocytogenes strain AT3E plasmid pLM58, complete sequence 18401-18430 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP025439 Listeria monocytogenes strain MF4697 plasmid pMF4697, complete sequence 18399-18428 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NC_022045 Listeria monocytogenes strain N1-011A plasmid, complete sequence 3994-4023 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NC_022045 Listeria monocytogenes strain N1-011A plasmid, complete sequence 61547-61576 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP023053 Listeria monocytogenes strain FDA709873-31 plasmid pCFSAN021143, complete sequence 6095-6124 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 MK134858 Listeria monocytogenes plasmid pLM1686, complete sequence 85667-85696 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NC_013767 Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence 67798-67827 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP025561 Listeria monocytogenes strain PIR00545 plasmid pPIR00545, complete sequence 25451-25480 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP045744 Listeria innocua strain CFSAN044836 plasmid pCFSAN044836, complete sequence 36506-36535 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NC_014495 Listeria monocytogenes serotype 1-2b str. SLCC2755 plasmid pLM1-2bUG1 complete sequence 18860-18889 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP014251 Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence 24056-24085 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NC_003383 Listeria innocua Clip11262 plasmid pLI100, complete sequence 41937-41966 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP025569 Listeria monocytogenes strain PIR00540 plasmid pPIR00540, complete sequence 31627-31656 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP015985 Listeria monocytogenes strain 2015TE24968 plasmid pl2015TE24968, complete sequence 3985-4014 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP013725 Listeria monocytogenes strain Lm N1546 plasmid pLmN1546, complete sequence 20901-20930 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_HG813248 Listeria monocytogenes R479a plasmid pLMR479a, complete sequence 83451-83480 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP025260 Listeria monocytogenes strain MF4624 plasmid pMF4624, complete sequence 18399-18428 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP032307 Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence 229953-229982 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP025083 Listeria monocytogenes strain MF4626 plasmid pMF4626, complete sequence 18401-18430 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP023051 Listeria monocytogenes strain FDA971911-001-001 plasmid pCFSAN059932, complete sequence 26372-26401 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NC_021828 Listeria monocytogenes strain R2-502 plasmid, complete sequence 52835-52864 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP041214 Listeria monocytogenes strain LMP18-H8393 plasmid pCFSAN074382, complete sequence 21637-21666 6 0.8
CP026367_2 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762300-762329 30 NZ_CP045973 Listeria monocytogenes strain AUSMDU00000224 plasmid pAUSMDU00000224_01, complete sequence 18531-18560 6 0.8
CP026367_3 3.1|768340|29|CP026367|CRISPRCasFinder 768340-768368 29 MN692980 Marine virus AFVG_117M21, complete genome 5261-5289 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NC_010381 Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence 56088-56116 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 MT075580 Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence 103918-103946 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NZ_CP014644 Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence 138449-138477 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NZ_CP014857 Lysinibacillus sphaericus III(3)7 plasmid, complete sequence 118518-118546 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 CP002963 Emticicia oligotrophica DSM 17448 plasmid pEMTOL02, complete sequence 15961-15989 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NZ_CP024218 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-10 13971-13999 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NZ_CP024405 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp18-1, complete sequence 13948-13976 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NZ_CP024384 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-9 13774-13802 6 0.793
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 NZ_CP024364 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-9 3898-3926 6 0.793
CP026367_2 2.2|761706|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761706-761735 30 NZ_CP030933 Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence 826096-826125 7 0.767
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 NZ_CP015733 Arthrobacter sp. U41 plasmid unnamed1, complete sequence 20965-20994 7 0.767
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 MK737937 Raoultella phage RP180, complete genome 21150-21179 7 0.767
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 NZ_CP014283 Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence 576234-576263 7 0.767
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 NZ_CP032614 Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence 265418-265447 7 0.767
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 NZ_CP011156 Bacillus cereus strain HN001 plasmid pRML01, complete sequence 157212-157241 7 0.767
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MT833282 Escherichia coli phage vB_EcoM_Shy, complete genome 82694-82722 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 LC473039 Escherichia phage L27 DNA, complete genome 6498-6526 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 NC_005282 Enterobacteria phage Felix 01, complete genome 79563-79591 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 JF461087 Salmonella phage FO1a, complete genome 79461-79489 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MK482690 Escherichia phage vB_EcoM_LMP34, partial genome 70812-70840 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MK482689 Escherichia phage vB_EcoM_LMP33, complete genome 41804-41832 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN994499 Phage NBEco005, complete genome 66179-66207 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KC139638 Salmonella phage FSL SP-107 thymidylate synthase, dihydrofolate reductase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, putative deoxynucleotide monophosphate kinase, hypothetical protein, putative phage DNA primase/helicase, hypothetical proteins, putative exodeoxyribonuclease, NAD synthetase, hypothetical proteins, ribonucleoside triphosphate reductase, alpha chain, hypothetical protein, ribonucleoside triphosphate reductase, beta chain, putative glutaredoxin, hypothetical protein, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, putative ribose-phosphate pyrophosphokinase, nicotinamide phosphoribosyl transferase, hypothetical proteins, rIIA protein, rIIB protein, hypothetical protein, putative PseT polynucleotide 5'-kinase/3'-phosphatase, and hypothetical proteins genes, complete cds 26818-26846 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MG646671 Salmonella phage BPS17S6, complete genome 66066-66094 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MG065668 UNVERIFIED: Campylobacter phage A126, complete genome 28115-28143 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN994503 Phage NBSal004, complete genome 66032-66060 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MH571750 Escherichia phage vB_EcoM-Ro111lw, complete genome 65652-65680 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 LR699048 Escherichia phage VpaE1_ev035 genome assembly, chromosome: 1 81764-81792 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MK965970 Salmonella phage DaR-2019b isolate 6717_4FA, complete genome 50856-50884 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 LR597663 Escherichia phage VpaE1_ev78 genome assembly, chromosome: 1 81257-81285 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MT446388 UNVERIFIED: Escherichia virus TH10, complete genome 74759-74787 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850637 Escherichia phage warpig, complete genome 22675-22703 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850635 Escherichia phage bumzen, complete genome 58542-58570 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850564 Escherichia phage humlepung, complete genome 64947-64975 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MK524176 Escherichia phage PHB11, complete genome 66016-66044 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 AF320576 Bacteriophage Felix 01, complete genome 79563-79591 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 JX560968 Escherichia phage EC6, complete genome 67575-67603 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 NC_028872 Escherichia phage HY02, complete genome 80399-80427 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN882542 Escherichia phage JN01,complete genome 1402-1430 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MG065664 UNVERIFIED: Campylobacter phage A132, complete genome 54599-54627 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MK965969 Salmonella phage DaR-2019a isolate 6712_28b, complete genome 51554-51582 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 NC_031939 Salmonella phage BPS15Q2, complete genome 67975-68003 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MG646670 Salmonella phage BPS15S6, complete genome 55974-56002 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 GU169904 Staphylococcus phage SA1, complete genome 114043-114071 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850566 Escherichia phage garuso, complete genome 28386-28414 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 LR597658 Escherichia phage VpaE1_ev108 genome assembly, chromosome: 1 81425-81453 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KP010413 Salmonella phage vB_SPuM_SP116, complete genome 81413-81441 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KT184316 Enterobacteria phage XTG1, complete genome 55930-55958 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 NC_027337 Escherichia phage vB_EcoM-VpaE1, complete genome 81644-81672 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850644 Escherichia phage ekra, complete genome 21649-21677 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850636 Escherichia phage dune, complete genome 22371-22399 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN655999 Shigella phage Z31, complete genome 23510-23538 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850577 Escherichia phage heid, complete genome 44521-44549 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850585 Escherichia phage skuden, complete genome 312-340 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MT322327 UNVERIFIED: Escherichia phage SSBS18_WS_10_728, complete genome 59670-59698 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850631 Escherichia phage mio, complete genome 22624-22652 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850639 Escherichia phage radambza, complete genome 74305-74333 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MG646669 Salmonella phage BPS17W1, complete genome 20709-20737 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MK482688 Escherichia phage vB_EcoM_LMP25, complete genome 23421-23449 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KF055347 Escherichia phage JH2, complete genome 18387-18415 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 NC_042096 Salmonella phage BPS17L1, complete genome 18911-18939 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 NC_027360 Enterobacteriaphage UAB_Phi87, complete genome 36232-36260 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN227145 Salmonella phage BPSELC-1, complete genome 59712-59740 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850633 Escherichia phage allfine, complete genome 66607-66635 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850619 Escherichia phage finno, complete genome 40629-40657 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KT184313 Enterobacteria phage KhF1, complete genome 14211-14239 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KT184315 Enterobacteria phage KhF3, complete genome 64684-64712 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN481367 Salmonella phage D1-2, complete genome 19769-19797 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MH586731 Salmonella phage Meda, complete genome 9079-9107 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 KT184314 Enterobacteria phage KhF2, complete genome 37322-37350 7 0.759
CP026367_3 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR 768472-768500 29 MN850647 Escherichia phage tootiki, complete genome 76517-76545 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP014434 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S35-C88, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 22419-22447 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP013443 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C22C-MedDCM-OCT-S23-C7 4067-4095 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP013724 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S34-C281, *** SEQUENCING IN PROGRESS *** 4067-4095 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP014429 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S29-C111, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces 11334-11362 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP013726 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S39-C204, *** SEQUENCING IN PROGRESS *** 7957-7985 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP014426 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S27-C233, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 1594-1622 7 0.759
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 AP013713 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S31-C252, *** SEQUENCING IN PROGRESS *** 1166-1194 7 0.759
CP026367_3 3.5|768339|30|CP026367|CRT 768339-768368 30 MN692980 Marine virus AFVG_117M21, complete genome 5260-5289 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MT833282 Escherichia coli phage vB_EcoM_Shy, complete genome 82694-82723 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 LC473039 Escherichia phage L27 DNA, complete genome 6498-6527 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NC_005282 Enterobacteria phage Felix 01, complete genome 79563-79592 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 JF461087 Salmonella phage FO1a, complete genome 79461-79490 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MK482690 Escherichia phage vB_EcoM_LMP34, partial genome 70812-70841 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MK482689 Escherichia phage vB_EcoM_LMP33, complete genome 41804-41833 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN994499 Phage NBEco005, complete genome 66179-66208 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KC139638 Salmonella phage FSL SP-107 thymidylate synthase, dihydrofolate reductase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, putative deoxynucleotide monophosphate kinase, hypothetical protein, putative phage DNA primase/helicase, hypothetical proteins, putative exodeoxyribonuclease, NAD synthetase, hypothetical proteins, ribonucleoside triphosphate reductase, alpha chain, hypothetical protein, ribonucleoside triphosphate reductase, beta chain, putative glutaredoxin, hypothetical protein, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, putative ribose-phosphate pyrophosphokinase, nicotinamide phosphoribosyl transferase, hypothetical proteins, rIIA protein, rIIB protein, hypothetical protein, putative PseT polynucleotide 5'-kinase/3'-phosphatase, and hypothetical proteins genes, complete cds 26818-26847 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MG646671 Salmonella phage BPS17S6, complete genome 66066-66095 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MG065668 UNVERIFIED: Campylobacter phage A126, complete genome 28115-28144 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN994503 Phage NBSal004, complete genome 66032-66061 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MH571750 Escherichia phage vB_EcoM-Ro111lw, complete genome 65652-65681 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 LR699048 Escherichia phage VpaE1_ev035 genome assembly, chromosome: 1 81764-81793 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MK965970 Salmonella phage DaR-2019b isolate 6717_4FA, complete genome 50856-50885 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 LR597663 Escherichia phage VpaE1_ev78 genome assembly, chromosome: 1 81257-81286 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MT446388 UNVERIFIED: Escherichia virus TH10, complete genome 74759-74788 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850637 Escherichia phage warpig, complete genome 22675-22704 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850635 Escherichia phage bumzen, complete genome 58542-58571 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850564 Escherichia phage humlepung, complete genome 64947-64976 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MK524176 Escherichia phage PHB11, complete genome 66016-66045 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 AF320576 Bacteriophage Felix 01, complete genome 79563-79592 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 JX560968 Escherichia phage EC6, complete genome 67575-67604 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NC_028872 Escherichia phage HY02, complete genome 80399-80428 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN882542 Escherichia phage JN01,complete genome 1402-1431 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MG065664 UNVERIFIED: Campylobacter phage A132, complete genome 54599-54628 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MK965969 Salmonella phage DaR-2019a isolate 6712_28b, complete genome 51554-51583 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NC_031939 Salmonella phage BPS15Q2, complete genome 67975-68004 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MG646670 Salmonella phage BPS15S6, complete genome 55974-56003 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 GU169904 Staphylococcus phage SA1, complete genome 114043-114072 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850566 Escherichia phage garuso, complete genome 28386-28415 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 LR597658 Escherichia phage VpaE1_ev108 genome assembly, chromosome: 1 81425-81454 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KP010413 Salmonella phage vB_SPuM_SP116, complete genome 81413-81442 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KT184316 Enterobacteria phage XTG1, complete genome 55930-55959 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NC_027337 Escherichia phage vB_EcoM-VpaE1, complete genome 81644-81673 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850644 Escherichia phage ekra, complete genome 21648-21677 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850636 Escherichia phage dune, complete genome 22370-22399 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN655999 Shigella phage Z31, complete genome 23509-23538 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850577 Escherichia phage heid, complete genome 44520-44549 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850585 Escherichia phage skuden, complete genome 311-340 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MT322327 UNVERIFIED: Escherichia phage SSBS18_WS_10_728, complete genome 59669-59698 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850631 Escherichia phage mio, complete genome 22623-22652 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850639 Escherichia phage radambza, complete genome 74304-74333 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MG646669 Salmonella phage BPS17W1, complete genome 20708-20737 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MK482688 Escherichia phage vB_EcoM_LMP25, complete genome 23420-23449 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KF055347 Escherichia phage JH2, complete genome 18386-18415 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NC_042096 Salmonella phage BPS17L1, complete genome 18910-18939 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NC_027360 Enterobacteriaphage UAB_Phi87, complete genome 36231-36260 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN227145 Salmonella phage BPSELC-1, complete genome 59711-59740 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850633 Escherichia phage allfine, complete genome 66606-66635 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850619 Escherichia phage finno, complete genome 40628-40657 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KT184313 Enterobacteria phage KhF1, complete genome 14210-14239 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KT184315 Enterobacteria phage KhF3, complete genome 64683-64712 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN481367 Salmonella phage D1-2, complete genome 19768-19797 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MH586731 Salmonella phage Meda, complete genome 9078-9107 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 KT184314 Enterobacteria phage KhF2, complete genome 37321-37350 7 0.767
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 MN850647 Escherichia phage tootiki, complete genome 76516-76545 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NZ_CP014857 Lysinibacillus sphaericus III(3)7 plasmid, complete sequence 118518-118547 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NC_010381 Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence 56087-56116 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 MT075580 Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence 103917-103946 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NZ_CP014644 Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence 138448-138477 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NZ_CP024364 Borrelia miyamotoi strain Izh-16 plasmid pIzh16-9 3898-3927 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NZ_CP024218 Borrelia miyamotoi strain Izh-5 plasmid pIzh5-10 13970-13999 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NZ_CP024405 Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp18-1, complete sequence 13947-13976 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 NZ_CP024384 Borrelia miyamotoi strain Izh-14 plasmid pIzh14-9 13773-13802 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP013726 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S39-C204, *** SEQUENCING IN PROGRESS *** 7957-7986 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP014426 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S27-C233, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces 1594-1623 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP013713 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S31-C252, *** SEQUENCING IN PROGRESS *** 1166-1195 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP014434 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S35-C88, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces 22418-22447 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP013443 Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C22C-MedDCM-OCT-S23-C7 4066-4095 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP013724 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S34-C281, *** SEQUENCING IN PROGRESS *** 4066-4095 7 0.767
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 AP014429 Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S29-C111, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces 11333-11362 7 0.767
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024110 Bacillus cytotoxicus strain CH_13 plasmid pCh13_79, complete sequence 30876-30905 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP020005 Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence 191362-191391 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024106 Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence 45638-45667 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024118 Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence 40730-40759 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024103 Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence 15820-15849 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024108 Bacillus cytotoxicus strain CH_15 plasmid pCh15_83, complete sequence 74225-74254 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024100 Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence 53527-53556 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024122 Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence 57500-57529 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024115 Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence 61190-61219 8 0.733
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 NZ_CP024097 Bacillus cytotoxicus strain CH_39 plasmid pCh39_83, complete sequence 78385-78414 8 0.733
CP026367_2 2.2|761706|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761706-761735 30 NZ_CP016898 Acinetobacter soli strain GFJ2 plasmid pGFJ2, complete sequence 74939-74968 8 0.733
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 NZ_CP038617 Arsenophonus nasoniae strain FIN plasmid pArsFIN5, complete sequence 102835-102864 8 0.733
CP026367_2 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761772-761801 30 NZ_CP020456 Vibrio coralliilyticus strain SNUTY-1 plasmid pSNUTY2, complete sequence 50581-50610 8 0.733
CP026367_2 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 761970-761999 30 AP014720 Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8 11543-11572 8 0.733
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 NC_002806 Microscilla sp. PRE1 plasmid pSD15, complete sequence 100048-100077 8 0.733
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 NC_047702 Uncultured phage_MedDCM-OCT-S35-C6 DNA, complete genome, group G8, isolate: uvMED-CGR-U-MedDCM-OCT-S35-C6 29733-29762 8 0.733
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 MN693242 Marine virus AFVG_25M170, complete genome 137-166 8 0.733
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 MN693242 Marine virus AFVG_25M170, complete genome 32922-32951 8 0.733
CP026367_3 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR 768538-768566 29 MN693358 Marine virus AFVG_25M395, complete genome 21689-21717 8 0.724
CP026367_2 2.1|761640|30|CP026367|CRISPRCasFinder,CRT 761640-761669 30 MN692989 Marine virus AFVG_117M66, complete genome 12965-12994 9 0.7
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 MK448913 Streptococcus phage Javan346, complete genome 15118-15147 9 0.7
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 MK448722 Streptococcus phage Javan269, complete genome 15101-15130 9 0.7
CP026367_2 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR 762432-762461 30 MK448907 Streptococcus phage Javan320, complete genome 15121-15150 9 0.7
CP026367_3 3.7|768471|30|CP026367|CRT 768471-768500 30 NZ_AP019635 Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence 38640-38669 9 0.7
CP026367_3 3.8|768537|30|CP026367|CRT 768537-768566 30 MN693358 Marine virus AFVG_25M395, complete genome 21689-21718 9 0.7
CP026367_1 1.1|511580|32|CP026367|CRISPRCasFinder 511580-511611 32 MK016664 Synechococcus phage S-B68, complete genome 136020-136051 10 0.688

1. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to MF417891 (Uncultured Caudovirales phage clone 10S_13, partial genome) position: , mismatch: 0, identity: 1.0

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgtaaaattcatgtgaatcaaaagaataa	Protospacer
*****************************

2. spacer 3.8|768537|30|CP026367|CRT matches to MF417891 (Uncultured Caudovirales phage clone 10S_13, partial genome) position: , mismatch: 0, identity: 1.0

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
ttgtaaaattcatgtgaatcaaaagaataa	Protospacer
******************************

3. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KY653129 (Staphylococcus phage IME1365_01, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cctggtcgacaggttcacctacaataccaa	Protospacer
*.**************.***********. 

4. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KR709302 (Staphylococcus phage 55-2, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

5. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_003288 (Staphylococcus phage phiETA, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

6. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AP001553 (Staphylococcus phage phiETA DNA, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

7. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007061 (Staphylococcus phage 29, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

8. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954962 (Bacteriophage 71, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

9. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AB370268 (Staphylococcus phage phiMR11 DNA, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

10. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007063 (Staphylococcus phage 88, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

11. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954966 (Bacteriophage 88, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

12. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954963 (Bacteriophage 55, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

13. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954964 (Bacteriophage 29, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

14. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007065 (Staphylococcus phage X2, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

15. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MG564297 (Staphylococcus phage UPMK_2, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

16. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007059 (Staphylococcus phage 71, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

17. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KR709303 (Staphylococcus phage 55-3, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

18. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KC595279 (Staphylococcus phage StauST398-5, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

19. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MG543995 (Staphylococcus phage UPMK_1, partial genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

20. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_028915 (Staphylococcus phage B236, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

21. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MK211557 (Staphylococcus phage Henu2, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

22. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_010147 (Staphylococcus phage phiMR11, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

23. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to JX094501 (Staphylococcus phage SA13, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

24. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954967 (Bacteriophage 92, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

25. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954968 (Bacteriophage X2, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

26. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007060 (Staphylococcus phage 55, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

27. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007064 (Staphylococcus phage 92, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

28. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to JX013863 (Staphylococcus phage StauST398-1, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

29. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MN904510 (Staphylococcus phage vB_SauS-SAP27, complete genome) position: , mismatch: 4, identity: 0.867

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaacttcgt	Protospacer
********** *************. .***

30. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP013811 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S36-C173, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 4, identity: 0.862

acactgatgaccataattccatttgacca-	CRISPR spacer
gcaatgatgaccataactccattt-accac	Protospacer
.** ************.******* **** 

31. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to JX519263 (Uncultured Mediterranean phage MEDS1 group fosmid MedDCM-OCT-S13-C2, complete sequence) position: , mismatch: 4, identity: 0.862

acactgatgaccataattccatttgacca-	CRISPR spacer
gcaatgatgaccataactccattt-accac	Protospacer
.** ************.******* **** 

32. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP009640 (Bacillus cereus 03BB108 plasmid pBFI_3, complete sequence) position: , mismatch: 5, identity: 0.833

attgctgcattttattaatttc-tgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttgtatca-	Protospacer
 *********.*********** **. *** 

33. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP053961 (Bacillus cereus strain FDAARGOS_802 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.833

attgctgcattttattaatttc-tgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttgtatca-	Protospacer
 *********.*********** **. *** 

34. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KT878766 (Staphylococcus phage P1105, complete genome) position: , mismatch: 5, identity: 0.833

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
atcatttttattagtgataaaacctaattc	Protospacer
.**. ****.***********.********

35. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MH384261 (Staphylococcus phage SA137ruMSSAST121PVL, complete genome) position: , mismatch: 5, identity: 0.833

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
atcatttttattagtgataaaacctaattc	Protospacer
.**. ****.***********.********

36. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_025460 (Staphylococcus phage phiSa119, complete genome) position: , mismatch: 5, identity: 0.833

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
atcatttttattagtgataaaacctaattc	Protospacer
.**. ****.***********.********

37. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954956 (Bacteriophage 3A, complete genome) position: , mismatch: 5, identity: 0.833

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
atcatttttattagtgataaaacctaattc	Protospacer
.**. ****.***********.********

38. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007053 (Staphylococcus phage 3A, complete genome) position: , mismatch: 5, identity: 0.833

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
atcatttttattagtgataaaacctaattc	Protospacer
.**. ****.***********.********

39. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_007062 (Staphylococcus phage 52A, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaactttgt	Protospacer
********** *************. ..**

40. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AY954965 (Bacteriophage 52A, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaactttgt	Protospacer
********** *************. ..**

41. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to DQ908929 (Staphylococcus phage 80, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgaccggttcgcctacaactttgt	Protospacer
********** *************. ..**

42. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KY653120 (Staphylococcus phage IME1348_01, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacaggttctcctactacttcgt	Protospacer
**************** ***** *. .***

43. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to JN192400 (Staphylococcus phage vB_SepiS-phiIPLA5, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacaggttctcctactacttcgt	Protospacer
**************** ***** *. .***

44. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to KU598975 (Staphylococcus phage CNPx, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacaggttctcctactacttcgt	Protospacer
**************** ***** *. .***

45. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to JN192401 (Staphylococcus phage vB_SepiS-phiIPLA7, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacaggttctcctactacttcgt	Protospacer
**************** ***** *. .***

46. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_008723 (Staphylococcus phage PH15, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacaggttctcctactacttcgt	Protospacer
**************** ***** *. .***

47. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to DQ831957 (Staphylococcus phage CNPH82, complete genome) position: , mismatch: 5, identity: 0.833

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacaggttctcctactacttcgt	Protospacer
**************** ***** *. .***

48. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MF417885 (Uncultured Caudovirales phage clone 3S_9, partial genome) position: , mismatch: 5, identity: 0.833

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
tacttcaactcctaaaataaaaagccggca	Protospacer
  .************************.*.

49. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 5, identity: 0.833

attttcaactcctaaaataaaaagccgacg--	CRISPR spacer
tttttcatctcctaaaataaaaag--gacagt	Protospacer
 ****** ****************  ***.  

50. spacer 3.7|768471|30|CP026367|CRT matches to AP013811 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C15-MedDCM-OCT-S36-C173, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 5, identity: 0.833

tacactgatgaccataattccatttgacca-	CRISPR spacer
agcaatgatgaccataactccattt-accac	Protospacer
 .** ************.******* **** 

51. spacer 3.7|768471|30|CP026367|CRT matches to JX519263 (Uncultured Mediterranean phage MEDS1 group fosmid MedDCM-OCT-S13-C2, complete sequence) position: , mismatch: 5, identity: 0.833

tacactgatgaccataattccatttgacca-	CRISPR spacer
agcaatgatgaccataactccattt-accac	Protospacer
 .** ************.******* **** 

52. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to MH992183 (Apis mellifera associated microvirus 33 isolate INH_SP_169, complete genome) position: , mismatch: 6, identity: 0.8

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttttttcattttattgatttcttcctcag	Protospacer
 ** .* *********.****** ******

53. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP019166 (Listeria monocytogenes strain HPB5415 plasmid pLM5578, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

54. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_KU513859 (Listeria monocytogenes strain IZSAM_Lm_15_17439_A144 plasmid pLmA144, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

55. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022021 (Listeria monocytogenes strain FDA709873-33 plasmid pCFSAN021445, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

56. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP022021 (Listeria monocytogenes strain FDA709873-33 plasmid pCFSAN021445, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

57. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023753 (Listeria monocytogenes strain AT3E plasmid pLM58, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

58. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025439 (Listeria monocytogenes strain MF4697 plasmid pMF4697, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

59. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_022045 (Listeria monocytogenes strain N1-011A plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

60. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_022045 (Listeria monocytogenes strain N1-011A plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

61. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023053 (Listeria monocytogenes strain FDA709873-31 plasmid pCFSAN021143, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

62. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MK134858 (Listeria monocytogenes plasmid pLM1686, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

63. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_013767 (Listeria monocytogenes 08-5578 plasmid pLM5578, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

64. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025561 (Listeria monocytogenes strain PIR00545 plasmid pPIR00545, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

65. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045744 (Listeria innocua strain CFSAN044836 plasmid pCFSAN044836, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

66. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_014495 (Listeria monocytogenes serotype 1-2b str. SLCC2755 plasmid pLM1-2bUG1 complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

67. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014251 (Listeria monocytogenes strain CFSAN010068 plasmid pCFSAN010068_01, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

68. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_003383 (Listeria innocua Clip11262 plasmid pLI100, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

69. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025569 (Listeria monocytogenes strain PIR00540 plasmid pPIR00540, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

70. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015985 (Listeria monocytogenes strain 2015TE24968 plasmid pl2015TE24968, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

71. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP013725 (Listeria monocytogenes strain Lm N1546 plasmid pLmN1546, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

72. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_HG813248 (Listeria monocytogenes R479a plasmid pLMR479a, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

73. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025260 (Listeria monocytogenes strain MF4624 plasmid pMF4624, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

74. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032307 (Enterococcus faecium strain HY07 plasmid unnamed2, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

75. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP025083 (Listeria monocytogenes strain MF4626 plasmid pMF4626, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

76. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP023051 (Listeria monocytogenes strain FDA971911-001-001 plasmid pCFSAN059932, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

77. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_021828 (Listeria monocytogenes strain R2-502 plasmid, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

78. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP041214 (Listeria monocytogenes strain LMP18-H8393 plasmid pCFSAN074382, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

79. spacer 2.11|762300|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP045973 (Listeria monocytogenes strain AUSMDU00000224 plasmid pAUSMDU00000224_01, complete sequence) position: , mismatch: 6, identity: 0.8

tagtatttaaaagtgcaaaccaaataattt	CRISPR spacer
ctgtatttataagtgtaaaccaaatagtct	Protospacer
. ******* *****.**********.*.*

80. spacer 3.1|768340|29|CP026367|CRISPRCasFinder matches to MN692980 (Marine virus AFVG_117M21, complete genome) position: , mismatch: 6, identity: 0.793

atactggcttaggaatgctttcttattca	CRISPR spacer
ctacgggctttggaatgctttcttttata	Protospacer
 *** ***** ************* * .*

81. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_010381 (Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aagaaaattcatgtaaatcaaaagaattg	Protospacer
 . ***********.************ .

82. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to MT075580 (Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aagaaaattcatgtaaatcaaaagaattg	Protospacer
 . ***********.************ .

83. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NZ_CP014644 (Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aagaaaattcatgtaaatcaaaagaattg	Protospacer
 . ***********.************ .

84. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NZ_CP014857 (Lysinibacillus sphaericus III(3)7 plasmid, complete sequence) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aagaaaattcatgtaaatcaaaagaattg	Protospacer
 . ***********.************ .

85. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to CP002963 (Emticicia oligotrophica DSM 17448 plasmid pEMTOL02, complete sequence) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tttaaactttatgtgaatcaaaagaactc	Protospacer
* **** **.****************.  

86. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NZ_CP024218 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-10) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aacaaaattcatgtcaatcaaaataatga	Protospacer
 ..*********** ******** ***.*

87. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NZ_CP024405 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp18-1, complete sequence) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aacaaaattcatgtcaatcaaaataatga	Protospacer
 ..*********** ******** ***.*

88. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NZ_CP024384 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-9) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aacaaaattcatgtcaatcaaaataatga	Protospacer
 ..*********** ******** ***.*

89. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to NZ_CP024364 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-9) position: , mismatch: 6, identity: 0.793

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aacaaaattcatgtcaatcaaaataatga	Protospacer
 ..*********** ******** ***.*

90. spacer 2.2|761706|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP030933 (Enterococcus gilvus strain CR1 plasmid pCR1A, complete sequence) position: , mismatch: 7, identity: 0.767

ctaactcatccattgaatcaagaacttctg	CRISPR spacer
atagctcatccattgaatcaagcccatatc	Protospacer
 **.******************  * * * 

91. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP015733 (Arthrobacter sp. U41 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.767

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacagcttcgccttcaggtcccg	Protospacer
************ ******* **.  **  

92. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MK737937 (Raoultella phage RP180, complete genome) position: , mismatch: 7, identity: 0.767

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
tttggtcgataggttcgccgacaagaagtt	Protospacer
.********.********* **** *   *

93. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP014283 (Bacillus thuringiensis strain Bt185 plasmid pBT1850636, complete sequence) position: , mismatch: 7, identity: 0.767

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
attttcaactcatacaataaaaaatatagg	Protospacer
*********** ** ********..  * *

94. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP032614 (Bacillus thuringiensis strain QZL38 plasmid p.1, complete sequence) position: , mismatch: 7, identity: 0.767

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
attttcaactcatacaataaaaaatatagg	Protospacer
*********** ** ********..  * *

95. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP011156 (Bacillus cereus strain HN001 plasmid pRML01, complete sequence) position: , mismatch: 7, identity: 0.767

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
attttcaactcatacaataaaaaatatagg	Protospacer
*********** ** ********..  * *

96. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MT833282 (Escherichia coli phage vB_EcoM_Shy, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

97. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to LC473039 (Escherichia phage L27 DNA, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataagtccatctgacca	Protospacer
  *   ********** *****.******

98. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_005282 (Enterobacteria phage Felix 01, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataagtccatctgacca	Protospacer
  *   ********** *****.******

99. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to JF461087 (Salmonella phage FO1a, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataagtccatctgacca	Protospacer
  *   ********** *****.******

100. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MK482690 (Escherichia phage vB_EcoM_LMP34, partial genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

101. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MK482689 (Escherichia phage vB_EcoM_LMP33, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

102. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN994499 (Phage NBEco005, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

103. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KC139638 (Salmonella phage FSL SP-107 thymidylate synthase, dihydrofolate reductase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, putative deoxynucleotide monophosphate kinase, hypothetical protein, putative phage DNA primase/helicase, hypothetical proteins, putative exodeoxyribonuclease, NAD synthetase, hypothetical proteins, ribonucleoside triphosphate reductase, alpha chain, hypothetical protein, ribonucleoside triphosphate reductase, beta chain, putative glutaredoxin, hypothetical protein, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, putative ribose-phosphate pyrophosphokinase, nicotinamide phosphoribosyl transferase, hypothetical proteins, rIIA protein, rIIB protein, hypothetical protein, putative PseT polynucleotide 5'-kinase/3'-phosphatase, and hypothetical proteins genes, complete cds) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

104. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MG646671 (Salmonella phage BPS17S6, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

105. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MG065668 (UNVERIFIED: Campylobacter phage A126, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

106. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN994503 (Phage NBSal004, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

107. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MH571750 (Escherichia phage vB_EcoM-Ro111lw, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

108. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to LR699048 (Escherichia phage VpaE1_ev035 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

109. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MK965970 (Salmonella phage DaR-2019b isolate 6717_4FA, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

110. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to LR597663 (Escherichia phage VpaE1_ev78 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

111. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MT446388 (UNVERIFIED: Escherichia virus TH10, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

112. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850637 (Escherichia phage warpig, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

113. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850635 (Escherichia phage bumzen, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

114. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850564 (Escherichia phage humlepung, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

115. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MK524176 (Escherichia phage PHB11, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

116. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to AF320576 (Bacteriophage Felix 01, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataagtccatctgacca	Protospacer
  *   ********** *****.******

117. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to JX560968 (Escherichia phage EC6, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

118. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_028872 (Escherichia phage HY02, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

119. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN882542 (Escherichia phage JN01,complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

120. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MG065664 (UNVERIFIED: Campylobacter phage A132, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

121. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MK965969 (Salmonella phage DaR-2019a isolate 6712_28b, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

122. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_031939 (Salmonella phage BPS15Q2, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

123. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MG646670 (Salmonella phage BPS15S6, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

124. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to GU169904 (Staphylococcus phage SA1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

125. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850566 (Escherichia phage garuso, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

126. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to LR597658 (Escherichia phage VpaE1_ev108 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

127. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KP010413 (Salmonella phage vB_SPuM_SP116, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

128. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KT184316 (Enterobacteria phage XTG1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

129. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_027337 (Escherichia phage vB_EcoM-VpaE1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

130. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850644 (Escherichia phage ekra, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

131. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850636 (Escherichia phage dune, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

132. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN655999 (Shigella phage Z31, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

133. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850577 (Escherichia phage heid, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

134. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850585 (Escherichia phage skuden, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

135. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MT322327 (UNVERIFIED: Escherichia phage SSBS18_WS_10_728, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

136. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850631 (Escherichia phage mio, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

137. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850639 (Escherichia phage radambza, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

138. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MG646669 (Salmonella phage BPS17W1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

139. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MK482688 (Escherichia phage vB_EcoM_LMP25, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

140. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KF055347 (Escherichia phage JH2, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

141. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_042096 (Salmonella phage BPS17L1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

142. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to NC_027360 (Enterobacteriaphage UAB_Phi87, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

143. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN227145 (Salmonella phage BPSELC-1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

144. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850633 (Escherichia phage allfine, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaaacatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

145. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850619 (Escherichia phage finno, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

146. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KT184313 (Enterobacteria phage KhF1, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

147. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KT184315 (Enterobacteria phage KhF3, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

148. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN481367 (Salmonella phage D1-2, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatttgtcca	Protospacer
  *   ********** ******** ***

149. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MH586731 (Salmonella phage Meda, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

150. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to KT184314 (Enterobacteria phage KhF2, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

151. spacer 3.3|768472|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN850647 (Escherichia phage tootiki, complete genome) position: , mismatch: 7, identity: 0.759

acactgatgaccataattccatttgacca	CRISPR spacer
tgaagcatgaccataaatccatctgacca	Protospacer
  *   ********** *****.******

152. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP014434 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S35-C88, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

153. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP013443 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C22C-MedDCM-OCT-S23-C7) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

154. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP013724 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S34-C281, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

155. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP014429 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S29-C111, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

156. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP013726 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S39-C204, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

157. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP014426 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S27-C233, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

158. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to AP013713 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S31-C252, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.759

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
gaaagaattcttgtgattcaaaagaatat	Protospacer
 . *.***** ***** *********** 

159. spacer 3.5|768339|30|CP026367|CRT matches to MN692980 (Marine virus AFVG_117M21, complete genome) position: , mismatch: 7, identity: 0.767

aatactggcttaggaatgctttcttattca	CRISPR spacer
cctacgggctttggaatgctttcttttata	Protospacer
  *** ***** ************* * .*

160. spacer 3.7|768471|30|CP026367|CRT matches to MT833282 (Escherichia coli phage vB_EcoM_Shy, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

161. spacer 3.7|768471|30|CP026367|CRT matches to LC473039 (Escherichia phage L27 DNA, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataagtccatctgacca	Protospacer
*  *   ********** *****.******

162. spacer 3.7|768471|30|CP026367|CRT matches to NC_005282 (Enterobacteria phage Felix 01, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataagtccatctgacca	Protospacer
*  *   ********** *****.******

163. spacer 3.7|768471|30|CP026367|CRT matches to JF461087 (Salmonella phage FO1a, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataagtccatctgacca	Protospacer
*  *   ********** *****.******

164. spacer 3.7|768471|30|CP026367|CRT matches to MK482690 (Escherichia phage vB_EcoM_LMP34, partial genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

165. spacer 3.7|768471|30|CP026367|CRT matches to MK482689 (Escherichia phage vB_EcoM_LMP33, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

166. spacer 3.7|768471|30|CP026367|CRT matches to MN994499 (Phage NBEco005, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

167. spacer 3.7|768471|30|CP026367|CRT matches to KC139638 (Salmonella phage FSL SP-107 thymidylate synthase, dihydrofolate reductase, hypothetical proteins, putative transcriptional regulatory protein, hypothetical proteins, ATP-dependent DNA ligase, hypothetical proteins, putative DNA polymerase, endonuclease, putative DNA polymerase, hypothetical proteins, putative deoxynucleotide monophosphate kinase, hypothetical protein, putative phage DNA primase/helicase, hypothetical proteins, putative exodeoxyribonuclease, NAD synthetase, hypothetical proteins, ribonucleoside triphosphate reductase, alpha chain, hypothetical protein, ribonucleoside triphosphate reductase, beta chain, putative glutaredoxin, hypothetical protein, ribonucleotide reductase of class III, hypothetical proteins, ribonucleotide reductase of class III, hypothetical proteins, putative ribose-phosphate pyrophosphokinase, nicotinamide phosphoribosyl transferase, hypothetical proteins, rIIA protein, rIIB protein, hypothetical protein, putative PseT polynucleotide 5'-kinase/3'-phosphatase, and hypothetical proteins genes, complete cds) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

168. spacer 3.7|768471|30|CP026367|CRT matches to MG646671 (Salmonella phage BPS17S6, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

169. spacer 3.7|768471|30|CP026367|CRT matches to MG065668 (UNVERIFIED: Campylobacter phage A126, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

170. spacer 3.7|768471|30|CP026367|CRT matches to MN994503 (Phage NBSal004, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

171. spacer 3.7|768471|30|CP026367|CRT matches to MH571750 (Escherichia phage vB_EcoM-Ro111lw, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

172. spacer 3.7|768471|30|CP026367|CRT matches to LR699048 (Escherichia phage VpaE1_ev035 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

173. spacer 3.7|768471|30|CP026367|CRT matches to MK965970 (Salmonella phage DaR-2019b isolate 6717_4FA, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

174. spacer 3.7|768471|30|CP026367|CRT matches to LR597663 (Escherichia phage VpaE1_ev78 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

175. spacer 3.7|768471|30|CP026367|CRT matches to MT446388 (UNVERIFIED: Escherichia virus TH10, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

176. spacer 3.7|768471|30|CP026367|CRT matches to MN850637 (Escherichia phage warpig, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

177. spacer 3.7|768471|30|CP026367|CRT matches to MN850635 (Escherichia phage bumzen, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

178. spacer 3.7|768471|30|CP026367|CRT matches to MN850564 (Escherichia phage humlepung, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

179. spacer 3.7|768471|30|CP026367|CRT matches to MK524176 (Escherichia phage PHB11, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

180. spacer 3.7|768471|30|CP026367|CRT matches to AF320576 (Bacteriophage Felix 01, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataagtccatctgacca	Protospacer
*  *   ********** *****.******

181. spacer 3.7|768471|30|CP026367|CRT matches to JX560968 (Escherichia phage EC6, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

182. spacer 3.7|768471|30|CP026367|CRT matches to NC_028872 (Escherichia phage HY02, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

183. spacer 3.7|768471|30|CP026367|CRT matches to MN882542 (Escherichia phage JN01,complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

184. spacer 3.7|768471|30|CP026367|CRT matches to MG065664 (UNVERIFIED: Campylobacter phage A132, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

185. spacer 3.7|768471|30|CP026367|CRT matches to MK965969 (Salmonella phage DaR-2019a isolate 6712_28b, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

186. spacer 3.7|768471|30|CP026367|CRT matches to NC_031939 (Salmonella phage BPS15Q2, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

187. spacer 3.7|768471|30|CP026367|CRT matches to MG646670 (Salmonella phage BPS15S6, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

188. spacer 3.7|768471|30|CP026367|CRT matches to GU169904 (Staphylococcus phage SA1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

189. spacer 3.7|768471|30|CP026367|CRT matches to MN850566 (Escherichia phage garuso, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

190. spacer 3.7|768471|30|CP026367|CRT matches to LR597658 (Escherichia phage VpaE1_ev108 genome assembly, chromosome: 1) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

191. spacer 3.7|768471|30|CP026367|CRT matches to KP010413 (Salmonella phage vB_SPuM_SP116, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

192. spacer 3.7|768471|30|CP026367|CRT matches to KT184316 (Enterobacteria phage XTG1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

193. spacer 3.7|768471|30|CP026367|CRT matches to NC_027337 (Escherichia phage vB_EcoM-VpaE1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

194. spacer 3.7|768471|30|CP026367|CRT matches to MN850644 (Escherichia phage ekra, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

195. spacer 3.7|768471|30|CP026367|CRT matches to MN850636 (Escherichia phage dune, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

196. spacer 3.7|768471|30|CP026367|CRT matches to MN655999 (Shigella phage Z31, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

197. spacer 3.7|768471|30|CP026367|CRT matches to MN850577 (Escherichia phage heid, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

198. spacer 3.7|768471|30|CP026367|CRT matches to MN850585 (Escherichia phage skuden, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

199. spacer 3.7|768471|30|CP026367|CRT matches to MT322327 (UNVERIFIED: Escherichia phage SSBS18_WS_10_728, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

200. spacer 3.7|768471|30|CP026367|CRT matches to MN850631 (Escherichia phage mio, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

201. spacer 3.7|768471|30|CP026367|CRT matches to MN850639 (Escherichia phage radambza, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

202. spacer 3.7|768471|30|CP026367|CRT matches to MG646669 (Salmonella phage BPS17W1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

203. spacer 3.7|768471|30|CP026367|CRT matches to MK482688 (Escherichia phage vB_EcoM_LMP25, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

204. spacer 3.7|768471|30|CP026367|CRT matches to KF055347 (Escherichia phage JH2, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

205. spacer 3.7|768471|30|CP026367|CRT matches to NC_042096 (Salmonella phage BPS17L1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

206. spacer 3.7|768471|30|CP026367|CRT matches to NC_027360 (Enterobacteriaphage UAB_Phi87, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

207. spacer 3.7|768471|30|CP026367|CRT matches to MN227145 (Salmonella phage BPSELC-1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

208. spacer 3.7|768471|30|CP026367|CRT matches to MN850633 (Escherichia phage allfine, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaaacatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

209. spacer 3.7|768471|30|CP026367|CRT matches to MN850619 (Escherichia phage finno, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

210. spacer 3.7|768471|30|CP026367|CRT matches to KT184313 (Enterobacteria phage KhF1, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

211. spacer 3.7|768471|30|CP026367|CRT matches to KT184315 (Enterobacteria phage KhF3, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

212. spacer 3.7|768471|30|CP026367|CRT matches to MN481367 (Salmonella phage D1-2, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatttgtcca	Protospacer
*  *   ********** ******** ***

213. spacer 3.7|768471|30|CP026367|CRT matches to MH586731 (Salmonella phage Meda, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

214. spacer 3.7|768471|30|CP026367|CRT matches to KT184314 (Enterobacteria phage KhF2, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

215. spacer 3.7|768471|30|CP026367|CRT matches to MN850647 (Escherichia phage tootiki, complete genome) position: , mismatch: 7, identity: 0.767

tacactgatgaccataattccatttgacca	CRISPR spacer
ttgaagcatgaccataaatccatctgacca	Protospacer
*  *   ********** *****.******

216. spacer 3.8|768537|30|CP026367|CRT matches to NZ_CP014857 (Lysinibacillus sphaericus III(3)7 plasmid, complete sequence) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aaagaaaattcatgtaaatcaaaagaattg	Protospacer
  . ***********.************ .

217. spacer 3.8|768537|30|CP026367|CRT matches to NC_010381 (Lysinibacillus sphaericus C3-41 plasmid pBsph, complete sequence) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aaagaaaattcatgtaaatcaaaagaattg	Protospacer
  . ***********.************ .

218. spacer 3.8|768537|30|CP026367|CRT matches to MT075580 (Lysinibacillus sphaericus strain SSII-1 plasmid pSSII-1, complete sequence) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aaagaaaattcatgtaaatcaaaagaattg	Protospacer
  . ***********.************ .

219. spacer 3.8|768537|30|CP026367|CRT matches to NZ_CP014644 (Lysinibacillus sphaericus strain OT4b.25 plasmid unnamed, complete sequence) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aaagaaaattcatgtaaatcaaaagaattg	Protospacer
  . ***********.************ .

220. spacer 3.8|768537|30|CP026367|CRT matches to NZ_CP024364 (Borrelia miyamotoi strain Izh-16 plasmid pIzh16-9) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
caacaaaattcatgtcaatcaaaataatga	Protospacer
. ..*********** ******** ***.*

221. spacer 3.8|768537|30|CP026367|CRT matches to NZ_CP024218 (Borrelia miyamotoi strain Izh-5 plasmid pIzh5-10) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
caacaaaattcatgtcaatcaaaataatga	Protospacer
. ..*********** ******** ***.*

222. spacer 3.8|768537|30|CP026367|CRT matches to NZ_CP024405 (Borrelia miyamotoi strain Izh-4 plasmid pIzh4-lp18-1, complete sequence) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
caacaaaattcatgtcaatcaaaataatga	Protospacer
. ..*********** ******** ***.*

223. spacer 3.8|768537|30|CP026367|CRT matches to NZ_CP024384 (Borrelia miyamotoi strain Izh-14 plasmid pIzh14-9) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
caacaaaattcatgtcaatcaaaataatga	Protospacer
. ..*********** ******** ***.*

224. spacer 3.8|768537|30|CP026367|CRT matches to AP013726 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S39-C204, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

225. spacer 3.8|768537|30|CP026367|CRT matches to AP014426 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S27-C233, *** SEQUENCING IN PROGRESS ***, 2 ordered pieces) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

226. spacer 3.8|768537|30|CP026367|CRT matches to AP013713 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S31-C252, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

227. spacer 3.8|768537|30|CP026367|CRT matches to AP014434 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S35-C88, *** SEQUENCING IN PROGRESS ***, 4 ordered pieces) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

228. spacer 3.8|768537|30|CP026367|CRT matches to AP013443 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G17, isolate: uvMED-CGR-C22C-MedDCM-OCT-S23-C7) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

229. spacer 3.8|768537|30|CP026367|CRT matches to AP013724 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22C-MedDCM-OCT-S34-C281, *** SEQUENCING IN PROGRESS ***) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

230. spacer 3.8|768537|30|CP026367|CRT matches to AP014429 (Uncultured Mediterranean phage uvMED isolate uvMED-CGF-C22-MedDCM-OCT-S29-C111, *** SEQUENCING IN PROGRESS ***, 3 ordered pieces) position: , mismatch: 7, identity: 0.767

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
tgaaagaattcttgtgattcaaaagaatat	Protospacer
* . *.***** ***** *********** 

231. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024110 (Bacillus cytotoxicus strain CH_13 plasmid pCh13_79, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

232. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP020005 (Bacillus thuringiensis strain Bacillus thuringiensis L-7601 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

233. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024106 (Bacillus cytotoxicus strain CH_23 plasmid pCh23_67, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

234. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024118 (Bacillus cytotoxicus strain CH_2 plasmid pCh2_83, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

235. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024103 (Bacillus cytotoxicus strain CH_25 plasmid pCh25_67, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

236. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024108 (Bacillus cytotoxicus strain CH_15 plasmid pCh15_83, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

237. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024100 (Bacillus cytotoxicus strain CH_38 plasmid pCh38_83, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

238. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024122 (Bacillus cytotoxicus strain CH_1 plasmid pCh1_67, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

239. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024115 (Bacillus cytotoxicus strain CH_3 plasmid pCh3_83, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

240. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to NZ_CP024097 (Bacillus cytotoxicus strain CH_39 plasmid pCh39_83, complete sequence) position: , mismatch: 8, identity: 0.733

attgctgcattttattaatttctgcctcag	CRISPR spacer
cttgctgcatcttattaatttcttctatca	Protospacer
 *********.************ *. . .

241. spacer 2.2|761706|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP016898 (Acinetobacter soli strain GFJ2 plasmid pGFJ2, complete sequence) position: , mismatch: 8, identity: 0.733

ctaactcatccattgaatcaagaacttctg	CRISPR spacer
ctaactcatccattaaatcaattaatgtat	Protospacer
**************.******  * * .  

242. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP038617 (Arsenophonus nasoniae strain FIN plasmid pArsFIN5, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
tcgggttttggtagtgataaaacctataac	Protospacer
 . ******* **********.****   *

243. spacer 2.3|761772|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NZ_CP020456 (Vibrio coralliilyticus strain SNUTY-1 plasmid pSNUTY2, complete sequence) position: , mismatch: 8, identity: 0.733

gtcggttttgttagtgataaagcctaattc	CRISPR spacer
gtcggtgttgttagtgataaataaaaacat	Protospacer
****** **************    **. .

244. spacer 2.6|761970|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to AP014720 (Arthrobacter sp. Hiyo8 plasmid pHiyo8-1 DNA, complete genome, strain: Hiyo8) position: , mismatch: 8, identity: 0.733

cttggtcgacaggttcgcctacaataccgt	CRISPR spacer
cttggtcgacagcttcgccttcaggtctcg	Protospacer
************ ******* **.  *.  

245. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_002806 (Microscilla sp. PRE1 plasmid pSD15, complete sequence) position: , mismatch: 8, identity: 0.733

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
gttttcaactcctaaaataggaagaaaatt	Protospacer
.******************..***  .*. 

246. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to NC_047702 (Uncultured phage_MedDCM-OCT-S35-C6 DNA, complete genome, group G8, isolate: uvMED-CGR-U-MedDCM-OCT-S35-C6) position: , mismatch: 8, identity: 0.733

attttcaactcctaaaataaaaagccgacg--	CRISPR spacer
attgtcaacacctaaaataaaaa--taattat	Protospacer
*** ***** *************  ..*.   

247. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MN693242 (Marine virus AFVG_25M170, complete genome) position: , mismatch: 8, identity: 0.733

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
attgtcaacccctaaaataaaaaaatgtta	Protospacer
*** *****.*************. .* ..

248. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MN693242 (Marine virus AFVG_25M170, complete genome) position: , mismatch: 8, identity: 0.733

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
attgtcaacccctaaaataaaaaaatgtta	Protospacer
*** *****.*************. .* ..

249. spacer 3.4|768538|29|CP026367|CRISPRCasFinder,PILER-CR matches to MN693358 (Marine virus AFVG_25M395, complete genome) position: , mismatch: 8, identity: 0.724

tgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
acgaaaatccatttgaatcaaaagaagtt	Protospacer
   *****.*** *************   

250. spacer 2.1|761640|30|CP026367|CRISPRCasFinder,CRT matches to MN692989 (Marine virus AFVG_117M66, complete genome) position: , mismatch: 9, identity: 0.7

attgctgcattttattaatttctgcctcag	CRISPR spacer
agccctgcatattattaatttctgcaattc	Protospacer
* . ****** **************  .  

251. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MK448913 (Streptococcus phage Javan346, complete genome) position: , mismatch: 9, identity: 0.7

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
taattcacctcctaaaataaaaagaactca	Protospacer
   **** ****************    *.

252. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MK448722 (Streptococcus phage Javan269, complete genome) position: , mismatch: 9, identity: 0.7

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
taattcacctcctaaaataaaaagaactca	Protospacer
   **** ****************    *.

253. spacer 2.13|762432|30|CP026367|CRISPRCasFinder,CRT,PILER-CR matches to MK448907 (Streptococcus phage Javan320, complete genome) position: , mismatch: 9, identity: 0.7

attttcaactcctaaaataaaaagccgacg	CRISPR spacer
taattcacctcctaaaataaaaagaactca	Protospacer
   **** ****************    *.

254. spacer 3.7|768471|30|CP026367|CRT matches to NZ_AP019635 (Enterobacter sp. 18A13 plasmid pECC18A13-1, complete sequence) position: , mismatch: 9, identity: 0.7

tacactgatgaccataattccatttgacca	CRISPR spacer
tacgctgatgaccataataccatccattag	Protospacer
***.************** ****... . .

255. spacer 3.8|768537|30|CP026367|CRT matches to MN693358 (Marine virus AFVG_25M395, complete genome) position: , mismatch: 9, identity: 0.7

ttgtaaaattcatgtgaatcaaaagaataa	CRISPR spacer
aacgaaaatccatttgaatcaaaagaagtt	Protospacer
    *****.*** *************   

256. spacer 1.1|511580|32|CP026367|CRISPRCasFinder matches to MK016664 (Synechococcus phage S-B68, complete genome) position: , mismatch: 10, identity: 0.688

tagcccaacttgcattgcttgtagagtttctg	CRISPR spacer
acgttgcgcttggagtgcttgtagagtttctc	Protospacer
  *..  .**** * **************** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 951243 : 968886 25 Staphylococcus_phage(72.22%) terminase,integrase,protease,transposase attL 957843:957857|attR 968290:968304
DBSCAN-SWA_2 1301107 : 1308051 8 Staphylococcus_phage(14.29%) NA NA
DBSCAN-SWA_3 1321063 : 1332817 10 uncultured_Caudovirales_phage(50.0%) NA NA
DBSCAN-SWA_4 1562268 : 1570738 9 Synechococcus_phage(33.33%) NA NA
DBSCAN-SWA_5 2133360 : 2142385 7 uncultured_Mediterranean_phage(50.0%) tRNA NA
DBSCAN-SWA_6 2267354 : 2303723 32 Staphylococcus_phage(96.3%) tRNA NA
DBSCAN-SWA_7 2431120 : 2439548 11 Staphylococcus_phage(55.56%) integrase attL 2435282:2435296|attR 2438496:2438510
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage