Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026155 Klebsiella pneumoniae strain B12(AN) chromosome, complete genome 1 crisprs csa3,cas3,DEDDh,RT,DinG,WYL 0 1 6 0
CP026156 Klebsiella pneumoniae strain B12(AN) plasmid pB12AN_1, complete sequence 0 crisprs DEDDh 0 0 0 0

Results visualization

1. CP026155
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026155_2 4718115-4718209 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026155_1 1.1|4244923|36|CP026155|CRISPRCasFinder 4244923-4244958 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP026155_1 1.1|4244923|36|CP026155|CRISPRCasFinder 4244923-4244958 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP026155_1 1.1|4244923|36|CP026155|CRISPRCasFinder 4244923-4244958 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|4244923|36|CP026155|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|4244923|36|CP026155|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|4244923|36|CP026155|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 445176 : 514554 75 uncultured_Caudovirales_phage(61.11%) head,integrase,terminase,capsid,portal,tRNA,protease,tail attL 462784:462801|attR 478779:478796
DBSCAN-SWA_2 2796778 : 2879525 76 Escherichia_phage(42.86%) protease,transposase,holin NA
DBSCAN-SWA_3 2957930 : 2997620 36 Escherichia_phage(85.19%) transposase,bacteriocin NA
DBSCAN-SWA_4 3190885 : 3262382 82 uncultured_Caudovirales_phage(34.0%) head,integrase,terminase,plate,protease,tail,lysis attL 3253495:3253509|attR 3259504:3259518
DBSCAN-SWA_5 3674418 : 3764322 99 Salmonella_phage(58.33%) head,integrase,plate,capsid,portal,tRNA,protease,tail attL 3729944:3729962|attR 3764397:3764415
DBSCAN-SWA_6 4180904 : 4256013 88 Escherichia_phage(23.73%) head,integrase,terminase,coat,tRNA,transposase,tail,lysis attL 4202645:4202691|attR 4253085:4253131
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage