Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP026164 Klebsiella pneumoniae strain F81 chromosome, complete genome 3 crisprs csa3,WYL,cas3,DEDDh,DinG 0 1 5 0
CP026166 Klebsiella pneumoniae strain F81 plasmid pF81_2, complete sequence 0 crisprs NA 0 0 1 0
CP026165 Klebsiella pneumoniae strain F81 plasmid pF81_1, complete sequence 0 crisprs DEDDh 0 0 1 0

Results visualization

1. CP026164
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026164_1 3419812-3419894 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026164_2 4094450-4094589 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP026164_3 4311452-4311546 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP026164_1 1.1|3419840|27|CP026164|CRISPRCasFinder 3419840-3419866 27 NZ_CP015439 Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence 57276-57302 5 0.815

1. spacer 1.1|3419840|27|CP026164|CRISPRCasFinder matches to NZ_CP015439 (Anoxybacillus amylolyticus strain DSM 15939 plasmid pDSM15939_1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctattgcgcgattattttgccgggt	CRISPR spacer
agctattgcgcgactatgttgccgtgc	Protospacer
 ************.*** ****** *.

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1620947 : 1627852 6 Planktothrix_phage(33.33%) NA NA
DBSCAN-SWA_2 1671197 : 1684515 12 Enterobacteria_phage(22.22%) NA NA
DBSCAN-SWA_3 2607028 : 2617915 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_4 3281144 : 3290608 9 Brazilian_cedratvirus(16.67%) protease,tRNA NA
DBSCAN-SWA_5 3771706 : 3817198 66 Klebsiella_phage(22.22%) terminase,tail,integrase,holin,tRNA attL 3762773:3762818|attR 3814271:3814316
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP026166
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 12490 : 56219 36 Bacillus_phage(23.53%) integrase,transposase attL 9039:9054|attR 59718:59733
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP026165
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 68 : 110667 117 Salmonella_phage(89.0%) tail,integrase,capsid,terminase attL 45728:45743|attR 57041:57056
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage