Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP033337 Streptococcus pyogenes strain TSPY453 chromosome, complete genome 2 crisprs DinG,csm6,RT,cas3,DEDDh,csa3 0 1 7 0

Results visualization

1. CP033337
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033337_1 828844-829062 Orphan II-A
3 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP033337_2 1338880-1338973 Unclear NA
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP033337_2 2.1|1338907|40|CP033337|CRISPRCasFinder 1338907-1338946 40 MK448679 Streptococcus phage Javan137, complete genome 35066-35105 8 0.8
CP033337_2 2.1|1338907|40|CP033337|CRISPRCasFinder 1338907-1338946 40 MK448950 Streptococcus phage Javan464, complete genome 37224-37263 9 0.775

1. spacer 2.1|1338907|40|CP033337|CRISPRCasFinder matches to MK448679 (Streptococcus phage Javan137, complete genome) position: , mismatch: 8, identity: 0.8

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
ctagtggctatgcggagttacttatccaaattatcgagga	Protospacer
***************************** * **..    

2. spacer 2.1|1338907|40|CP033337|CRISPRCasFinder matches to MK448950 (Streptococcus phage Javan464, complete genome) position: , mismatch: 9, identity: 0.775

ctagtggctatgcggagttacttatccaactgattatttt	CRISPR spacer
cgagtggctatgcggagttgcttatccaactaatcgagga	Protospacer
* *****************.***********.**..    

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 36638 : 48950 8 Synechococcus_phage(28.57%) NA NA
DBSCAN-SWA_2 162768 : 210177 42 Bacillus_phage(33.33%) tRNA,transposase,protease,bacteriocin NA
DBSCAN-SWA_3 346326 : 352361 8 Streptococcus_phage(100.0%) NA NA
DBSCAN-SWA_4 537345 : 642197 108 Temperate_phage(44.26%) protease,bacteriocin,tail,terminase,holin,portal,capsid,integrase,tRNA attL 534028:534045|attR 616305:616322
DBSCAN-SWA_5 677605 : 688209 9 Streptococcus_phage(57.14%) NA NA
DBSCAN-SWA_6 987906 : 1082722 107 Streptococcus_phage(49.21%) protease,tail,head,terminase,transposase,holin,portal,capsid,integrase,tRNA attL 1021258:1021317|attR 1062656:1062751
DBSCAN-SWA_7 1482836 : 1556046 85 Streptococcus_phage(72.73%) tail,head,terminase,portal,capsid,integrase,tRNA attL 1511839:1511855|attR 1552642:1552658
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage