Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035537 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-21711 plasmid pKp711-2, complete sequence 0 crisprs NA 0 0 1 0
CP035539 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-21711 plasmid pKp711-4, complete sequence 0 crisprs NA 0 0 0 0
CP035540 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-21711 chromosome, complete genome 1 crisprs csa3,cas3,RT,DEDDh,DinG,WYL 0 1 10 0
CP035536 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-21711 plasmid pKp711-1, complete sequence 0 crisprs c2c9_V-U4,RT,cas3,csa3 0 0 2 0
CP035538 Klebsiella pneumoniae subsp. pneumoniae strain CCRI-21711 plasmid pKp711-3, complete sequence 0 crisprs RT 0 0 2 0

Results visualization

1. CP035537
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 47351 : 82106 32 Escherichia_phage(30.77%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP035540
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035540_2 4454646-4454740 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035540_1 1.1|3970704|36|CP035540|CRISPRCasFinder 3970704-3970739 36 MK448233 Klebsiella phage ST11-VIM1phi8.1, complete genome 8447-8482 0 1.0
CP035540_1 1.1|3970704|36|CP035540|CRISPRCasFinder 3970704-3970739 36 MK448235 Klebsiella phage ST512-KPC3phi13.1, complete genome 8447-8482 0 1.0
CP035540_1 1.1|3970704|36|CP035540|CRISPRCasFinder 3970704-3970739 36 MK448231 Klebsiella phage ST101-KPC2phi6.1, complete genome 11383-11418 0 1.0

1. spacer 1.1|3970704|36|CP035540|CRISPRCasFinder matches to MK448233 (Klebsiella phage ST11-VIM1phi8.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

2. spacer 1.1|3970704|36|CP035540|CRISPRCasFinder matches to MK448235 (Klebsiella phage ST512-KPC3phi13.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

3. spacer 1.1|3970704|36|CP035540|CRISPRCasFinder matches to MK448231 (Klebsiella phage ST101-KPC2phi6.1, complete genome) position: , mismatch: 0, identity: 1.0

cctcgccggtacgcagcgtggttactgggtttgcgt	CRISPR spacer
cctcgccggtacgcagcgtggttactgggtttgcgt	Protospacer
************************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 445190 : 478448 36 uncultured_Caudovirales_phage(75.0%) head,terminase,capsid,portal,protease,tRNA NA
DBSCAN-SWA_2 2686703 : 2697590 9 Escherichia_phage(87.5%) NA NA
DBSCAN-SWA_3 2906348 : 2966542 73 uncultured_Caudovirales_phage(30.77%) head,terminase,capsid,portal,protease,plate,transposase,tail NA
DBSCAN-SWA_4 2999475 : 3015624 16 Salmonella_phage(21.43%) transposase NA
DBSCAN-SWA_5 3137633 : 3145564 6 Pseudomonas_phage(50.0%) NA NA
DBSCAN-SWA_6 3395892 : 3490753 95 Salmonella_phage(55.17%) terminase,capsid,portal,protease,plate,tail,tRNA NA
DBSCAN-SWA_7 3902149 : 3981794 96 Escherichia_phage(22.95%) head,terminase,capsid,portal,lysis,transposase,tail,tRNA NA
DBSCAN-SWA_8 4191349 : 4203003 13 Enterobacteria_phage(70.0%) integrase attL 4191799:4191813|attR 4214856:4214870
DBSCAN-SWA_9 4671247 : 4677072 8 Enterobacteria_phage(100.0%) NA NA
DBSCAN-SWA_10 4869485 : 4874647 7 Escherichia_phage(33.33%) NA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP035536
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 6210 : 43185 36 Shigella_phage(15.79%) integrase,transposase,holin attL 5540:5556|attR 37915:37931
DBSCAN-SWA_2 55209 : 118054 52 Escherichia_phage(30.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP035538
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 261 : 9884 9 Escherichia_phage(42.86%) integrase attL 5025:5038|attR 15214:15227
DBSCAN-SWA_2 13046 : 25160 11 Escherichia_phage(80.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage