Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP030849 Pandoraea sp. XY-2 chromosome, complete genome 2 crisprs csa3,cas3,DinG,DEDDh 1 0 0 0

Results visualization

1. CP030849
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030849_2 991351-991449 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP030849_3 2081793-2081956 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP030849_1 1.2|196331|20|CP030849|CRISPRCasFinder 196331-196350 20 CP030849.1 196367-196386 0 1.0

1. spacer 1.2|196331|20|CP030849|CRISPRCasFinder matches to position: 196367-196386, mismatch: 0, identity: 1.0

ccaacgacgaagccaacgac	CRISPR spacer
ccaacgacgaagccaacgac	Protospacer
********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage