1. spacer 2.1|2824240|27|CP034752|CRISPRCasFinder matches to NZ_LN681228 (Xenorhabdus nematophila AN6/1 plasmid II, complete sequence) position: , mismatch: 5, identity: 0.815
gctggctgctgcctgttctgctttttc CRISPR spacer
tccggctgctgcccgttctgcttttag Protospacer
*.**********.***********
2. spacer 2.1|2824240|27|CP034752|CRISPRCasFinder matches to NZ_LN681228 (Xenorhabdus nematophila AN6/1 plasmid II, complete sequence) position: , mismatch: 5, identity: 0.815
gctggctgctgcctgttctgctttttc CRISPR spacer
tccggctgctgcccgttctgcttttag Protospacer
*.**********.***********
3. spacer 2.1|2824240|27|CP034752|CRISPRCasFinder matches to MN693884 (Marine virus AFVG_250M237, complete genome) position: , mismatch: 5, identity: 0.815
gctggctgctgcctgttctgctttttc CRISPR spacer
cctggctgctgccagttctgcttgtat Protospacer
************ ********* * .
4. spacer 2.1|2824240|27|CP034752|CRISPRCasFinder matches to MN694518 (Marine virus AFVG_250M326, complete genome) position: , mismatch: 5, identity: 0.815
gctggctgctgcctgttctgctttttc CRISPR spacer
cctggctgctgccagttctgcttgtat Protospacer
************ ********* * .
5. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 6, identity: 0.812
ttacc--atatgtacttatttcttttttataccc CRISPR spacer
--accaaatatgtacttatttctattttaaactt Protospacer
*** **************** ***** **..
6. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttattgaactcaatagtgatgaaattagcgtg- CRISPR spacer
ttattgaaatcaatagtgatgaaa-aagcaaat Protospacer
******** *************** ***. .
7. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttattgaactcaatagtgatgaaattagcgtg- CRISPR spacer
ttattgaaatcaatagtgatgaaa-aagcaaat Protospacer
******** *************** ***. .
8. spacer 1.52|2341819|32|CP034752|PILER-CR matches to NZ_AP014865 (Bacillus thuringiensis serovar tolworthi strain Pasteur Institute Standard strain plasmid pKK1, complete sequence) position: , mismatch: 6, identity: 0.812
ttacc--atatgtacttatttcttttttataccc CRISPR spacer
--accaaatatgtacttatttctattttaaactt Protospacer
*** **************** ***** **..
9. spacer 1.76|2343287|32|CP034752|PILER-CR matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttattgaactcaatagtgatgaaattagcgtg- CRISPR spacer
ttattgaaatcaatagtgatgaaa-aagcaaat Protospacer
******** *************** ***. .
10. spacer 1.76|2343287|32|CP034752|PILER-CR matches to NZ_CP033099 (Staphylococcus warneri strain SWO plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.812
ttattgaactcaatagtgatgaaattagcgtg- CRISPR spacer
ttattgaaatcaatagtgatgaaa-aagcaaat Protospacer
******** *************** ***. .
11. spacer 2.1|2824240|27|CP034752|CRISPRCasFinder matches to NC_048764 (Salmonella phage SE4, complete genome) position: , mismatch: 6, identity: 0.778
gctggctgctgcctgttctgctttttc CRISPR spacer
ggatgctgctgcctgttcagcttttgt Protospacer
* ************** ****** .
12. spacer 1.11|2341756|32|CP034752|CRISPRCasFinder,CRT matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 7, identity: 0.781
cagttgatgatgtgtctgaacgcatcacatat- CRISPR spacer
atattgatgatgtggcagaacgcatca-ataca Protospacer
.*********** * ********** ***.
13. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.781
ttaccatatgtacttatttcttttttataccc CRISPR spacer
aaatcatatggacttatttcttttttactcca Protospacer
*.****** ****************. **
14. spacer 1.35|2343224|32|CP034752|CRISPRCasFinder,CRT matches to NC_019763 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence) position: , mismatch: 7, identity: 0.781
ttccccattccccattccccatcaccaatccc CRISPR spacer
ctccccattccccattacccatcatgtctacc Protospacer
.*************** *******. * **
15. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to MN693322 (Marine virus AFVG_25M496, complete genome) position: , mismatch: 7, identity: 0.781
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
taattgaacaaaatagtgatgaaattatccga Protospacer
* ******* **************** * .
16. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to NC_041880 (Pseudomonas phage phiPMW, complete genome) position: , mismatch: 7, identity: 0.781
ttattgaactcaatagtgatgaaattagcgtg-- CRISPR spacer
ttattgaaatcaatagtggtgaaa--ggcattac Protospacer
******** *********.***** .**.*
17. spacer 1.39|2343468|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gcctcaatctcggcattacgcgccgccagatg CRISPR spacer
gcgatgatctcggccatacgcgccgccagacg Protospacer
** ..******** **************.*
18. spacer 1.51|2341758|32|CP034752|PILER-CR matches to NZ_AP014706 (Methylobacterium aquaticum strain MA-22A plasmid pMaq22A_2p, complete sequence) position: , mismatch: 7, identity: 0.781
cagttgatgatgtgtctgaacgcatcacatat- CRISPR spacer
atattgatgatgtggcagaacgcatca-ataca Protospacer
.*********** * ********** ***.
19. spacer 1.52|2341819|32|CP034752|PILER-CR matches to NZ_CP013238 (Clostridium butyricum strain CDC_51208 plasmid pNPD4_2, complete sequence) position: , mismatch: 7, identity: 0.781
ttaccatatgtacttatttcttttttataccc CRISPR spacer
aaatcatatggacttatttcttttttactcca Protospacer
*.****** ****************. **
20. spacer 1.75|2343226|32|CP034752|PILER-CR matches to NC_019763 (Oscillatoria nigro-viridis PCC 7112 plasmid pOSC7112.01, complete sequence) position: , mismatch: 7, identity: 0.781
ttccccattccccattccccatcaccaatccc CRISPR spacer
ctccccattccccattacccatcatgtctacc Protospacer
.*************** *******. * **
21. spacer 1.76|2343287|32|CP034752|PILER-CR matches to MN693322 (Marine virus AFVG_25M496, complete genome) position: , mismatch: 7, identity: 0.781
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
taattgaacaaaatagtgatgaaattatccga Protospacer
* ******* **************** * .
22. spacer 1.76|2343287|32|CP034752|PILER-CR matches to NC_041880 (Pseudomonas phage phiPMW, complete genome) position: , mismatch: 7, identity: 0.781
ttattgaactcaatagtgatgaaattagcgtg-- CRISPR spacer
ttattgaaatcaatagtggtgaaa--ggcattac Protospacer
******** *********.***** .**.*
23. spacer 1.79|2343470|32|CP034752|PILER-CR matches to NZ_CP022191 (Yangia pacifica strain YSBP01 plasmid unnamed1, complete sequence) position: , mismatch: 7, identity: 0.781
gcctcaatctcggcattacgcgccgccagatg CRISPR spacer
gcgatgatctcggccatacgcgccgccagacg Protospacer
** ..******** **************.*
24. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to NC_015598 (Lactobacillus kefiranofaciens ZW3 plasmid pWW1, complete sequence) position: , mismatch: 8, identity: 0.75
ttaccatatgtacttatttcttttttataccc CRISPR spacer
tcaggatatgtacctaattcttttttataaaa Protospacer
*.* ********.** ************
25. spacer 1.18|2342185|32|CP034752|CRISPRCasFinder,CRT matches to MN094788 (Achromobacter phage Motura, complete genome) position: , mismatch: 8, identity: 0.75
ttgcattaacccagggtcagacagcgattcag CRISPR spacer
acgggttcgccctgggtcagtcagcgattcag Protospacer
.* .** .*** ******* ***********
26. spacer 1.24|2342551|32|CP034752|CRISPRCasFinder,CRT matches to KM652554 (Streptomyces phage Jay2Jay, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
tgcttatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
27. spacer 1.24|2342551|32|CP034752|CRISPRCasFinder,CRT matches to MF358541 (Streptomyces phage Warpy, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
tgcttatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
28. spacer 1.24|2342551|32|CP034752|CRISPRCasFinder,CRT matches to MF347636 (Streptomyces phage NootNoot, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
cgcctatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
29. spacer 1.24|2342551|32|CP034752|CRISPRCasFinder,CRT matches to NC_042010 (Streptomyces phage Paradiddles, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
tgcctatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
30. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to MT774385 (CrAssphage cr108_1, complete genome) position: , mismatch: 8, identity: 0.75
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
ttcgtgaacttaatggtgatgaaattaaattt Protospacer
** ******.***.************. *
31. spacer 1.52|2341819|32|CP034752|PILER-CR matches to NC_015598 (Lactobacillus kefiranofaciens ZW3 plasmid pWW1, complete sequence) position: , mismatch: 8, identity: 0.75
ttaccatatgtacttatttcttttttataccc CRISPR spacer
tcaggatatgtacctaattcttttttataaaa Protospacer
*.* ********.** ************
32. spacer 1.58|2342187|32|CP034752|PILER-CR matches to MN094788 (Achromobacter phage Motura, complete genome) position: , mismatch: 8, identity: 0.75
ttgcattaacccagggtcagacagcgattcag CRISPR spacer
acgggttcgccctgggtcagtcagcgattcag Protospacer
.* .** .*** ******* ***********
33. spacer 1.64|2342553|32|CP034752|PILER-CR matches to KM652554 (Streptomyces phage Jay2Jay, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
tgcttatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
34. spacer 1.64|2342553|32|CP034752|PILER-CR matches to MF358541 (Streptomyces phage Warpy, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
tgcttatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
35. spacer 1.64|2342553|32|CP034752|PILER-CR matches to MF347636 (Streptomyces phage NootNoot, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
cgcctatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
36. spacer 1.64|2342553|32|CP034752|PILER-CR matches to NC_042010 (Streptomyces phage Paradiddles, complete genome) position: , mismatch: 8, identity: 0.75
ggaagatgtctcaaaaagcattacccgataaa CRISPR spacer
tgcctatggctcaaacagcattacccgagaca Protospacer
* *** ****** ************ * *
37. spacer 1.76|2343287|32|CP034752|PILER-CR matches to MT774385 (CrAssphage cr108_1, complete genome) position: , mismatch: 8, identity: 0.75
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
ttcgtgaacttaatggtgatgaaattaaattt Protospacer
** ******.***.************. *
38. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP018329 (Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-5, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
gtcctaaattatgtttatggtaaccctaaaaa Protospacer
.* ..*..***** *************.***.
39. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NC_013164 (Anaerococcus prevotii DSM 20548 plasmid pAPRE01, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atggaaggttatggtaatgataaccctggtgc Protospacer
**. ********** ***.********. .
40. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP025413 (Lactobacillus plantarum strain X7021 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
gtcctaaattatgtttatggtaaccctaaaaa Protospacer
.* ..*..***** *************.***.
41. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP028243 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
gtcctaaattatgtttatggtaaccctaaaaa Protospacer
.* ..*..***** *************.***.
42. spacer 1.10|2341695|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cggaaaccaaaaattacccatcagataacccc CRISPR spacer
gggaaaccaaaacttacccgtcaggacgccga Protospacer
*********** ******.****. .**
43. spacer 1.10|2341695|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
cggaaaccaaaaattacccatcagataacccc CRISPR spacer
gggaaaccaaaacttacccgtcaggacgccga Protospacer
*********** ******.****. .**
44. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
45. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
46. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
47. spacer 1.12|2341817|32|CP034752|CRISPRCasFinder,CRT matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
48. spacer 1.16|2342063|32|CP034752|CRISPRCasFinder,CRT matches to NC_047707 (Uncultured phage_MedDCM-OCT-S38-C3 DNA, complete genome, group G9, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C3) position: , mismatch: 9, identity: 0.719
ttttcgtgagccatctgcctgtcgttcataaa CRISPR spacer
ttttcgtaagccttctgcctgtcgccagtgcg Protospacer
*******.**** ***********.. .*. .
49. spacer 1.22|2342429|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 9, identity: 0.719
tcaccctcacaaatcgcaatcagattgcgctc CRISPR spacer
ccattctcaaaattcgcaatcagattgctaaa Protospacer
.**..**** ** ***************
50. spacer 1.29|2342856|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP019737 (Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-3, complete sequence) position: , mismatch: 9, identity: 0.719
agtaatgaaatcaatcacattcgagaatgttt CRISPR spacer
aattcagaaatcaatcactttcgataatggca Protospacer
*.* ************ ***** **** .
51. spacer 1.29|2342856|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP019746 (Lactobacillus brevis strain TMW 1.2111 plasmid pl12111-3, complete sequence) position: , mismatch: 9, identity: 0.719
agtaatgaaatcaatcacattcgagaatgttt CRISPR spacer
aattcagaaatcaatcactttcgataatggca Protospacer
*.* ************ ***** **** .
52. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to NC_015513 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence) position: , mismatch: 9, identity: 0.719
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
atattttactcaatagtgatgaaagtgaaggt Protospacer
**** ***************** *.. *
53. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to MF417885 (Uncultured Caudovirales phage clone 3S_9, partial genome) position: , mismatch: 9, identity: 0.719
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
gtggttctttcaatagagatgaaattagagtg Protospacer
*. * .******* *********** ***
54. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP018329 (Lactobacillus plantarum subsp. plantarum strain TS12 plasmid pLP12-5, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
gtcctaaattatgtttatggtaaccctaaaaa Protospacer
.* ..*..***** *************.***.
55. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NC_013164 (Anaerococcus prevotii DSM 20548 plasmid pAPRE01, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atggaaggttatggtaatgataaccctggtgc Protospacer
**. ********** ***.********. .
56. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP025413 (Lactobacillus plantarum strain X7021 plasmid unnamed1, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
gtcctaaattatgtttatggtaaccctaaaaa Protospacer
.* ..*..***** *************.***.
57. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP028243 (Lactobacillus plantarum strain SRCM101518 plasmid unnamed2, complete sequence) position: , mismatch: 9, identity: 0.719
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
gtcctaaattatgtttatggtaaccctaaaaa Protospacer
.* ..*..***** *************.***.
58. spacer 1.50|2341697|32|CP034752|PILER-CR matches to NZ_CP028965 (Burkholderia sp. IDO3 plasmid p1, complete sequence) position: , mismatch: 9, identity: 0.719
cggaaaccaaaaattacccatcagataacccc CRISPR spacer
gggaaaccaaaacttacccgtcaggacgccga Protospacer
*********** ******.****. .**
59. spacer 1.50|2341697|32|CP034752|PILER-CR matches to NZ_CP029828 (Burkholderia sp. JP2-270 plasmid p2, complete sequence) position: , mismatch: 9, identity: 0.719
cggaaaccaaaaattacccatcagataacccc CRISPR spacer
gggaaaccaaaacttacccgtcaggacgccga Protospacer
*********** ******.****. .**
60. spacer 1.52|2341819|32|CP034752|PILER-CR matches to KU057941 (Clostridium phage CDSH1, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
61. spacer 1.52|2341819|32|CP034752|PILER-CR matches to LN881738 (Escherichia phage slur17, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
62. spacer 1.52|2341819|32|CP034752|PILER-CR matches to HM568888 (Clostridium phage phiCD38-2, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
63. spacer 1.52|2341819|32|CP034752|PILER-CR matches to NC_028958 (Clostridium phage phiCD146, complete genome) position: , mismatch: 9, identity: 0.719
ttaccatatgtacttatttcttttttataccc CRISPR spacer
ttttcatatgtacatatttattttttagtttt Protospacer
** .********* ***** ******* ...
64. spacer 1.56|2342065|32|CP034752|PILER-CR matches to NC_047707 (Uncultured phage_MedDCM-OCT-S38-C3 DNA, complete genome, group G9, isolate: uvMED-CGR-U-MedDCM-OCT-S38-C3) position: , mismatch: 9, identity: 0.719
ttttcgtgagccatctgcctgtcgttcataaa CRISPR spacer
ttttcgtaagccttctgcctgtcgccagtgcg Protospacer
*******.**** ***********.. .*. .
65. spacer 1.62|2342431|32|CP034752|PILER-CR matches to NZ_CP054032 (Rhizobium sp. JKLM13E plasmid pPR13E01, complete sequence) position: , mismatch: 9, identity: 0.719
tcaccctcacaaatcgcaatcagattgcgctc CRISPR spacer
ccattctcaaaattcgcaatcagattgctaaa Protospacer
.**..**** ** ***************
66. spacer 1.69|2342858|32|CP034752|PILER-CR matches to NZ_CP019737 (Lactobacillus brevis strain TMW 1.2108 plasmid pl12108-3, complete sequence) position: , mismatch: 9, identity: 0.719
agtaatgaaatcaatcacattcgagaatgttt CRISPR spacer
aattcagaaatcaatcactttcgataatggca Protospacer
*.* ************ ***** **** .
67. spacer 1.69|2342858|32|CP034752|PILER-CR matches to NZ_CP019746 (Lactobacillus brevis strain TMW 1.2111 plasmid pl12111-3, complete sequence) position: , mismatch: 9, identity: 0.719
agtaatgaaatcaatcacattcgagaatgttt CRISPR spacer
aattcagaaatcaatcactttcgataatggca Protospacer
*.* ************ ***** **** .
68. spacer 1.76|2343287|32|CP034752|PILER-CR matches to NC_015513 (Haliscomenobacter hydrossis DSM 1100 plasmid pHALHY03, complete sequence) position: , mismatch: 9, identity: 0.719
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
atattttactcaatagtgatgaaagtgaaggt Protospacer
**** ***************** *.. *
69. spacer 1.76|2343287|32|CP034752|PILER-CR matches to MF417885 (Uncultured Caudovirales phage clone 3S_9, partial genome) position: , mismatch: 9, identity: 0.719
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
gtggttctttcaatagagatgaaattagagtg Protospacer
*. * .******* *********** ***
70. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP054369 (Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
71. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP012377 (Escherichia coli strain GE3 isolate human faeces plasmid pGE3, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
72. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP050647 (Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
73. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP010126 (Escherichia coli strain C8 plasmid A, complete genome) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
74. spacer 1.2|2341206|32|CP034752|CRISPRCasFinder,CRT matches to NZ_CP031323 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
75. spacer 1.29|2342856|32|CP034752|CRISPRCasFinder,CRT matches to CP000619 (Burkholderia vietnamiensis G4 plasmid pBVIE03, complete sequence) position: , mismatch: 10, identity: 0.688
agtaatgaaatcaatcacattcgagaatgttt CRISPR spacer
ccgactgagatcaatcacagtcgagaattggg Protospacer
* ***.********** ********
76. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to NC_026587 (Pseudomonas phage vB_PaeM_PAO1_Ab03, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
77. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to KC862296 (Pseudomonas phage P3_CHA, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
78. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to KC862301 (Pseudomonas phage PAK_P5, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
79. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to LN610581 (Pseudomonas phage vB_PaeM_PAO1_Ab04, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
80. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to KC862299 (Pseudomonas phage PAK_P3, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
81. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to LN610576 (Pseudomonas phage vB_PaeM_PAO1_Ab17, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
82. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to NC_022974 (Pseudomonas phage CHA_P1, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
83. spacer 1.33|2343102|32|CP034752|CRISPRCasFinder,CRT matches to NC_041968 (Pseudomonas phage vB_PaeM_G1, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
84. spacer 1.36|2343285|32|CP034752|CRISPRCasFinder,CRT matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
taggtgaactcaatagcgatgaaaataaatga Protospacer
* . ************.******* **. .
85. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP054369 (Escherichia coli strain SCU-115 plasmid pSCU-115-1, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
86. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP012377 (Escherichia coli strain GE3 isolate human faeces plasmid pGE3, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
87. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP050647 (Escherichia coli strain PapM-36-2 plasmid pIncFIB, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
88. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP010126 (Escherichia coli strain C8 plasmid A, complete genome) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
89. spacer 1.42|2341208|32|CP034752|PILER-CR matches to NZ_CP031323 (Escherichia coli strain ST2350 isolate Es_ST2350_SE1_NDM_03_2018 plasmid pEsST2350_SE_2, complete sequence) position: , mismatch: 10, identity: 0.688
atatcaggttatggttatggtaaccctgaaag CRISPR spacer
atgtcaggttgtggttatggtaatgttccgga Protospacer
**.*******.************. .* ...
90. spacer 1.69|2342858|32|CP034752|PILER-CR matches to CP000619 (Burkholderia vietnamiensis G4 plasmid pBVIE03, complete sequence) position: , mismatch: 10, identity: 0.688
agtaatgaaatcaatcacattcgagaatgttt CRISPR spacer
ccgactgagatcaatcacagtcgagaattggg Protospacer
* ***.********** ********
91. spacer 1.73|2343104|32|CP034752|PILER-CR matches to NC_026587 (Pseudomonas phage vB_PaeM_PAO1_Ab03, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
92. spacer 1.73|2343104|32|CP034752|PILER-CR matches to KC862296 (Pseudomonas phage P3_CHA, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
93. spacer 1.73|2343104|32|CP034752|PILER-CR matches to KC862301 (Pseudomonas phage PAK_P5, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
94. spacer 1.73|2343104|32|CP034752|PILER-CR matches to LN610581 (Pseudomonas phage vB_PaeM_PAO1_Ab04, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
95. spacer 1.73|2343104|32|CP034752|PILER-CR matches to KC862299 (Pseudomonas phage PAK_P3, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
96. spacer 1.73|2343104|32|CP034752|PILER-CR matches to LN610576 (Pseudomonas phage vB_PaeM_PAO1_Ab17, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
97. spacer 1.73|2343104|32|CP034752|PILER-CR matches to NC_022974 (Pseudomonas phage CHA_P1, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
98. spacer 1.73|2343104|32|CP034752|PILER-CR matches to NC_041968 (Pseudomonas phage vB_PaeM_G1, complete genome) position: , mismatch: 10, identity: 0.688
aaaagatgaacagcctgcaagaggatacctac CRISPR spacer
taaagctgaacagcctggaagaggcgtttcat Protospacer
**** *********** ****** ...*.
99. spacer 1.76|2343287|32|CP034752|PILER-CR matches to NC_022111 (Prevotella sp. oral taxon 299 str. F0039 plasmid, complete sequence) position: , mismatch: 10, identity: 0.688
ttattgaactcaatagtgatgaaattagcgtg CRISPR spacer
taggtgaactcaatagcgatgaaaataaatga Protospacer
* . ************.******* **. .
