CRISPRimmunity

Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID	Contig_def	CRISPR array number	Contig Signature genes	Self targeting spacer number	Target MGE spacer number
CP036355	Bacillus sp. SYJ plasmid unnamed1, complete sequence	0 crisprs	NA	0	0
CP036356	Bacillus sp. SYJ chromosome, complete genome	8 crisprs	NA	33	23
CP036354	Bacillus sp. SYJ plasmid unnamed2, complete sequence	0 crisprs	NA	0	0

Results visualization

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Crispr_ID: CP036356_1

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_1

75321-75421

Orphan

Consensus_repeat	Method
CCTGTTGGCCCACCAGGTGGACC	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP036356_1

>merge|CP036356|1|75321-75421|CRISPRCasFinder
CCTGTTGGCCCACCAGGTGGACCGGGTGGACCAGATGGACCAGTCACTCCACTAGACGGACCAATGGGACCGGTTGTTCCTGTTGGCCCACCAGGCGGACC

>CP036356|1|1|75321-75421|CRISPRCasFinder
CCTGTTGGCCCACCAGGTGGACC	GGGTGGACCAGATGGACCAGTCACTCCACTAGACGGACCAATGGGACCGGTTGTT
CCTGTTGGCCCACCAGGCGGACC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_2

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_2

429274-431109

Orphan

Consensus_repeat	Method
TAACACGGGNGCTACTGG	CRT

45 spacers

The CRISPR arrays of CP036356_2

>merge|CP036356|2|429274-431109|CRT
TAACACGGGCGCTACTGGTGCCACTGGACCTCAAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCAAGGTAACACGGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACCGGACCTCAAGGTAACACGGGCGCTACTGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACCGGACCTCAAGGTAACACGGGCGCTACTGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCAAGGTAACACGGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACCGGACCTCAAGGTAACACGGGCGCTACTGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACCGGACCTCAAGGTAACACGGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCAAGGTAACACGGGCGCTACCGGTGCCACTGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACCGGACCTCAAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCAAGGGCCTCAAGGTAACACGGGCGCTACTGGTGCTACTGGACCTCAGGGCATTCAAGGTAACACGGGTGCTACTGGTGCCACTGGACCTCAAGGGCCTCAAGGTAACACGGGCGCTACTGGTGCTACCGGACCTCGAGGTAACACGGGCGCTACTGGCGCCACTGGACCTCAAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCAGGGCATTCAAGGTAACACAGGTGCTACCGGCGCTACCGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACTGGACCTCAGGGCATTCAAGGTAACACGGGTGCTACTGGTGCCACTGGACCTCAAGGGCCTCAAGGTAACACGGGCGCTACTGGCGCCACTGGACCTCAAGGGCCTCAAGGTAACACGGGCGCTACTGGCGCCACTGGACCTCAAGGTAACACGGGCGCTACTGGTGCCACTGGACCTCAGGGCATTCAAGGTAACACAGGTGCTACCGGCGCTACCGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACTGGACCTCAGGGCATTCAAGGTAACACGGGTGCTACTGGTGCCACTGGACCTCAGGGCATTCAAGGTAACACAGGTGCTACCGGCGCTACCGGACCTCGAGGTAACACGGGCGCTACTGGTGCTACTGGACCTCAGGGCATTCAAGGTAACACGGGTGCTACTGGTGCCACTGGACCTCAAGGGCCTCAAGGTAACACGGGTGCTACCGGCGCTACTGGACCTCAGGGTGCTCAAGGTAACACAGGTGCTACTGGACCTCAAGGTGCTCAAGGTAACACGGGTGCTACCGGCGCTACTGGACCTCAGGGTGCTCAAGGTAACACAGGTGCTACTGGACCTCAAGGTGCTCAAGGTAACACGGGTGCTACCGGCGCTACTGGACCTCAAGGTGTTCAAGGTAACACGGGTGCTACTGGTGCTACCGGACCTCAAGGTGTTCAAGGACCAGCGGGTGCTACTGGTGCTACCGGACCTCAAGGTGCTCAAGGTAACACGGGTGCTACTGGTGCTACCGGACCTCAAGGTGTTCAAGGACCAGCGGGTGCTACTGGTGCTACCGGACCTCAAGGTGCTCAAGGTAACACGGGTGCTACCGGACCTCAGGGTATTCAAGGACCAACGGGCGCTACTGG

>CP036356|2|1|429274-431109|CRT
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAAGG
TAACACGGGCGCTACCGG	TGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACCGGACCTCAAGG
TAACACGGGCGCTACTGG	CGCTACCGGTGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACCGGACCTCAAGG
TAACACGGGCGCTACTGG	CGCTACCGGTGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAAGG
TAACACGGGCGCTACCGG	TGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACCGGACCTCAAGG
TAACACGGGCGCTACTGG	CGCTACCGGTGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACCGGACCTCAAGG
TAACACGGGCGCTACCGG	TGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAAGG
TAACACGGGCGCTACCGG	TGCCACTGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACCGGACCTCAAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAAGGGCCTCAAGG
TAACACGGGCGCTACTGG	TGCTACTGGACCTCAGGGCATTCAAGG
TAACACGGGTGCTACTGG	TGCCACTGGACCTCAAGGGCCTCAAGG
TAACACGGGCGCTACTGG	TGCTACCGGACCTCGAGG
TAACACGGGCGCTACTGG	CGCCACTGGACCTCAAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAGGGCATTCAAGG
TAACACAGGTGCTACCGG	CGCTACCGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACTGGACCTCAGGGCATTCAAGG
TAACACGGGTGCTACTGG	TGCCACTGGACCTCAAGGGCCTCAAGG
TAACACGGGCGCTACTGG	CGCCACTGGACCTCAAGGGCCTCAAGG
TAACACGGGCGCTACTGG	CGCCACTGGACCTCAAGG
TAACACGGGCGCTACTGG	TGCCACTGGACCTCAGGGCATTCAAGG
TAACACAGGTGCTACCGG	CGCTACCGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACTGGACCTCAGGGCATTCAAGG
TAACACGGGTGCTACTGG	TGCCACTGGACCTCAGGGCATTCAAGG
TAACACAGGTGCTACCGG	CGCTACCGGACCTCGAGG
TAACACGGGCGCTACTGG	TGCTACTGGACCTCAGGGCATTCAAGG
TAACACGGGTGCTACTGG	TGCCACTGGACCTCAAGGGCCTCAAGG
TAACACGGGTGCTACCGG	CGCTACTGGACCTCAGGGTGCTCAAGG
TAACACAGGTGCTACTGG	ACCTCAAGGTGCTCAAGG
TAACACGGGTGCTACCGG	CGCTACTGGACCTCAGGGTGCTCAAGG
TAACACAGGTGCTACTGG	ACCTCAAGGTGCTCAAGG
TAACACGGGTGCTACCGG	CGCTACTGGACCTCAAGGTGTTCAAGG
TAACACGGGTGCTACTGG	TGCTACCGGACCTCAAGGTGTTCAAGG
ACCAGCGGGTGCTACTGG	TGCTACCGGACCTCAAGGTGCTCAAGG
TAACACGGGTGCTACTGG	TGCTACCGGACCTCAAGGTGTTCAAGG
ACCAGCGGGTGCTACTGG	TGCTACCGGACCTCAAGGTGCTCAAGG
TAACACGGGTGCTACCGG	ACCTCAGGGTATTCAAGG
ACCAACGGGCGCTACTGG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_3

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_3

1394365-1394472

Orphan

Consensus_repeat	Method
TATATCAGCGATTTTTCAAATATATC	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP036356_3

>merge|CP036356|3|1394365-1394472|CRISPRCasFinder
TATATCAGCGATTTTTCAAATATATCAACCGCAACTCGAAATATATCAGCGATTTTCCAAATATATCGACCACAACTCAAAATATATCAGCGATTTTCCAAATATATC

>CP036356|3|2|1394365-1394472|CRISPRCasFinder
TATATCAGCGATTTTTCAAATATATC	AACCGCAACTCGAAATATATCAGCGATTTTCCAAATATATCGACCACAACTCAAAA
TATATCAGCGATTTTCCAAATATATC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_4

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_4

1673608-1673729

Orphan

Consensus_repeat	Method
CTTAAACAAACGTTTGATTAACTCCCTATTTTTCTTTGTTC	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP036356_4

>merge|CP036356|4|1673608-1673729|CRISPRCasFinder
CTTAAACAAACGTTTGATTAACTCCCTATTTTTCTTTGTTCACCCTTGAGCTGCAACAATTTCTCCCTACCGAACATATCCCTTAAACAAACGTTTGATTAACTCCCTATTTTTCTTTGTTC

>CP036356|4|3|1673608-1673729|CRISPRCasFinder
CTTAAACAAACGTTTGATTAACTCCCTATTTTTCTTTGTTC	ACCCTTGAGCTGCAACAATTTCTCCCTACCGAACATATCC
CTTAAACAAACGTTTGATTAACTCCCTATTTTTCTTTGTTC

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_5

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_5

1791809-1791884

Orphan

Consensus_repeat	Method
TAAAGCGGAAGCGGCTCGTTCAG	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP036356_5

>merge|CP036356|5|1791809-1791884|CRISPRCasFinder
TAAAGCGGAAGCGGCTCGTTCAGAATCACAGGGCGATGGAGCTAGATACAACTAAAAGCGGAAGCGGCTCGTTCAG

>CP036356|5|4|1791809-1791884|CRISPRCasFinder
TAAAGCGGAAGCGGCTCGTTCAG	AATCACAGGGCGATGGAGCTAGATACAACT
AAAAGCGGAAGCGGCTCGTTCAG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_6

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_6

2744591-2744838

Orphan

Consensus_repeat	Method
AAAGAGGAAGTAAAAGAATCAACAAAAGAAGTTGAAGA	CRISPRCasFinder

3 spacers

The CRISPR arrays of CP036356_6

>merge|CP036356|6|2744591-2744838|CRISPRCasFinder
AAAGAAGAAGTAAAAGAGCCAACAAAAGAAGTTGAAGAAGAGAAAGAGGAAGTAAAAGAATCAACAAAAGAAGTTGAAGAGGTAAAAGAGGAAGTAAAAGAATCAACAAAAGAAGTTGAAGAGGTAAAAGAGGAAGTAAAAGAATCAACAAAAGAAGTTGAAGAAGCAAAAGAAGAAGTGGACGAGCCAACAACAGGAGTTGAAGGGTCGAAAGCGGAGATAAAAGAAACAGGAAAAGAAATTGAAGG

>CP036356|6|5|2744591-2744838|CRISPRCasFinder
AAAGAAGAAGTAAAAGAGCCAACAAAAGAAGTTGAAGA	AGAGAAAGAGGAAGTAAAAGAATCAACAAAAGAAGTTGAAGAGGTA
AAAGAGGAAGTAAAAGAATCAACAAAAGAAGTTGAAGA	GGTAAAAGAGGAAGTAAAAGAATCA
ACAAAAGAAGTTGAAGAAGCAAAAGAAGAAGTGGACGA	GCCAACAACAGGAGTTGAAGGGTCG
AAAGCGGAGATAAAAGAAACAGGAAAAGAAATTGAAGG

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_7

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_7

3360994-3361102

Orphan

Consensus_repeat	Method
TGTATGATTACCTTCCGCATGAGAA	CRISPRCasFinder

1 spacers

The CRISPR arrays of CP036356_7

>merge|CP036356|7|3360994-3361102|CRISPRCasFinder
TGTATGATTACCTTCCGCATGAGAAGAGAATCCGTTAGCGATAGTAGCGGTTCCTTCTGCATGTGCTGCTTCGCCTAAAGCGATTGTATGTTTACCTTCCGCATGAGAA

>CP036356|7|6|3360994-3361102|CRISPRCasFinder
TGTATGATTACCTTCCGCATGAGAA	GAGAATCCGTTAGCGATAGTAGCGGTTCCTTCTGCATGTGCTGCTTCGCCTAAAGCGAT
TGTATGTTTACCTTCCGCATGAGAA

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Crispr_ID: CP036356_8

CRISPR_ID

CRISPR_location

CRISPR_type

Repeat_type

Spacer_info

Cas_protein_info

CRISPR-Cas_info

CP036356_8

4976521-4976676

Orphan

Consensus_repeat	Method
TTACGGAATGAATATTCATTCCT	CRISPRCasFinder

2 spacers

The CRISPR arrays of CP036356_8

>merge|CP036356|8|4976521-4976676|CRISPRCasFinder
TTACGGAATGAATATTCATTCCTATCATTTTATTACATTATTTTGTAAACTCTATTAAACTAGTCTTTCCGGAATGAATATTCATTCCTTTAGTTGCACAAATCCCCTCTCCTACTCTCATTTTTTAATTCTATTTAGGAATGAATATTCATTCCT

>CP036356|8|7|4976521-4976676|CRISPRCasFinder
TTACGGAATGAATATTCATTCCT	ATCATTTTATTACATTATTTTGTAAACTCTATTAAACTAGTCT
TTCCGGAATGAATATTCATTCCT	TTAGTTGCACAAATCCCCTCTCCTACTCTCATTTTTTAATTCTA
TTTAGGAATGAATATTCATTCCT

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

Self-targeting detection

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_ID	Protospacer_location	Mismatch	Identity
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	431443-431460	0	1.0
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	431533-431550	0	1.0
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	431578-431595	0	1.0
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	431443-431460	0	1.0
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	431533-431550	0	1.0
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	431578-431595	0	1.0
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	431443-431460	0	1.0
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	431533-431550	0	1.0
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	431578-431595	0	1.0
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	431443-431460	0	1.0
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	431533-431550	0	1.0
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	431578-431595	0	1.0
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	431443-431460	0	1.0
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	431533-431550	0	1.0
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	431578-431595	0	1.0
CP036356_2	2.24\|430183\|18\|CP036356\|CRT	430183-430200	18	CP036356.1	429256-429273	0	1.0
CP036356_2	2.30\|430435\|18\|CP036356\|CRT	430435-430452	18	CP036356.1	429256-429273	0	1.0
CP036356_2	2.33\|430561\|18\|CP036356\|CRT	430561-430578	18	CP036356.1	429256-429273	0	1.0
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	CP036356.1	431227-431253	0	1.0
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	431497-431514	0	1.0
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	431542-431559	0	1.0
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	3598695-3598712	0	1.0
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	CP036356.1	431227-431253	0	1.0
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	431497-431514	0	1.0
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	431542-431559	0	1.0
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	3598695-3598712	0	1.0
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP036356.1	431443-431469	0	1.0
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP036356.1	431578-431604	0	1.0
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	CP036356.1	431533-431559	0	1.0
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP036356.1	431443-431469	0	1.0
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP036356.1	431578-431604	0	1.0
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	CP036356.1	431533-431559	0	1.0
CP036356_2	2.45\|431074\|18\|CP036356\|CRT	431074-431091	18	CP036356.1	431281-431298	0	1.0
CP036356_2	2.1\|429292\|18\|CP036356\|CRT	429292-429309	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.1\|429292\|18\|CP036356\|CRT	429292-429309	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.1\|429292\|18\|CP036356\|CRT	429292-429309	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.3\|429364\|18\|CP036356\|CRT	429364-429381	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.3\|429364\|18\|CP036356\|CRT	429364-429381	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.3\|429364\|18\|CP036356\|CRT	429364-429381	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	431272-431289	1	0.944
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	431623-431640	1	0.944
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.5\|429436\|18\|CP036356\|CRT	429436-429453	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	431272-431289	1	0.944
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	431623-431640	1	0.944
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.7\|429517\|18\|CP036356\|CRT	429517-429534	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.9\|429598\|18\|CP036356\|CRT	429598-429615	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.9\|429598\|18\|CP036356\|CRT	429598-429615	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.9\|429598\|18\|CP036356\|CRT	429598-429615	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	431272-431289	1	0.944
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	431623-431640	1	0.944
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.11\|429670\|18\|CP036356\|CRT	429670-429687	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	431272-431289	1	0.944
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	431623-431640	1	0.944
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.13\|429751\|18\|CP036356\|CRT	429751-429768	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.15\|429823\|18\|CP036356\|CRT	429823-429840	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.15\|429823\|18\|CP036356\|CRT	429823-429840	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.15\|429823\|18\|CP036356\|CRT	429823-429840	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	431272-431289	1	0.944
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	431398-431415	1	0.944
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	431623-431640	1	0.944
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	3598659-3598676	1	0.944
CP036356_2	2.17\|429895\|18\|CP036356\|CRT	429895-429912	18	CP036356.1	3598713-3598730	1	0.944
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	CP036356.1	3598650-3598676	1	0.963
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	CP036356.1	3598650-3598676	1	0.963
CP036356_2	2.21\|430066\|18\|CP036356\|CRT	430066-430083	18	CP036356.1	431443-431460	1	0.944
CP036356_2	2.21\|430066\|18\|CP036356\|CRT	430066-430083	18	CP036356.1	431533-431550	1	0.944
CP036356_2	2.21\|430066\|18\|CP036356\|CRT	430066-430083	18	CP036356.1	431578-431595	1	0.944
CP036356_2	2.22\|430102\|18\|CP036356\|CRT	430102-430119	18	CP036356.1	431488-431505	1	0.944
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	CP036356.1	3598650-3598676	1	0.963
CP036356_2	2.28\|430354\|18\|CP036356\|CRT	430354-430371	18	CP036356.1	431488-431505	1	0.944
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	CP036356.1	3598650-3598676	1	0.963
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	CP036356.1	431488-431514	1	0.963
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	431236-431253	1	0.944
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	431407-431424	1	0.944
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	431452-431469	1	0.944
CP036356_2	2.37\|430732\|18\|CP036356\|CRT	430732-430749	18	CP036356.1	431587-431604	1	0.944
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	CP036356.1	431488-431514	1	0.963
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	431236-431253	1	0.944
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	431407-431424	1	0.944
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	431452-431469	1	0.944
CP036356_2	2.39\|430813\|18\|CP036356\|CRT	430813-430830	18	CP036356.1	431587-431604	1	0.944
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP036356.1	431488-431514	1	0.963
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP036356.1	431398-431424	1	0.963
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP036356.1	431533-431559	1	0.963
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP036356.1	431623-431649	1	0.963
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	CP036356.1	431443-431469	1	0.963
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	CP036356.1	431578-431604	1	0.963
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP036356.1	431398-431424	1	0.963
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP036356.1	431533-431559	1	0.963
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP036356.1	431623-431649	1	0.963
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	CP036356.1	431443-431469	1	0.963
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	CP036356.1	431578-431604	1	0.963
CP036356_2	2.45\|431074\|18\|CP036356\|CRT	431074-431091	18	CP036356.1	431632-431649	1	0.944
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	CP036356.1	3598704-3598730	2	0.926
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	CP036356.1	431272-431298	2	0.926
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	CP036356.1	3598704-3598730	2	0.926
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	CP036356.1	431272-431298	2	0.926
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	CP036356.1	3598704-3598730	2	0.926
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	CP036356.1	431272-431298	2	0.926
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	CP036356.1	431272-431298	2	0.926
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	CP036356.1	3598704-3598730	2	0.926
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	CP036356.1	431191-431217	2	0.926
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	CP036356.1	431191-431217	2	0.926
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP036356.1	431227-431253	2	0.926
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP036356.1	431272-431298	2	0.926
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	CP036356.1	431398-431424	2	0.926
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	CP036356.1	431623-431649	2	0.926
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP036356.1	431272-431298	2	0.926
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	CP036356.1	431398-431424	2	0.926
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	CP036356.1	431623-431649	2	0.926

1. spacer 2.5|429436|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

2. spacer 2.5|429436|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

3. spacer 2.5|429436|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

4. spacer 2.7|429517|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

5. spacer 2.7|429517|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

6. spacer 2.7|429517|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

7. spacer 2.11|429670|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

8. spacer 2.11|429670|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

9. spacer 2.11|429670|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

10. spacer 2.13|429751|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

11. spacer 2.13|429751|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

12. spacer 2.13|429751|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

13. spacer 2.17|429895|18|CP036356|CRT matches to position: 431443-431460, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

14. spacer 2.17|429895|18|CP036356|CRT matches to position: 431533-431550, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

15. spacer 2.17|429895|18|CP036356|CRT matches to position: 431578-431595, mismatch: 0, identity: 1.0

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
******************

16. spacer 2.24|430183|18|CP036356|CRT matches to position: 429256-429273, mismatch: 0, identity: 1.0

cgctaccggacctcgagg	CRISPR spacer
cgctaccggacctcgagg	Protospacer
******************

17. spacer 2.30|430435|18|CP036356|CRT matches to position: 429256-429273, mismatch: 0, identity: 1.0

cgctaccggacctcgagg	CRISPR spacer
cgctaccggacctcgagg	Protospacer
******************

18. spacer 2.33|430561|18|CP036356|CRT matches to position: 429256-429273, mismatch: 0, identity: 1.0

cgctaccggacctcgagg	CRISPR spacer
cgctaccggacctcgagg	Protospacer
******************

19. spacer 2.36|430687|27|CP036356|CRT matches to position: 431227-431253, mismatch: 0, identity: 1.0

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggtgctcaagg	Protospacer
***************************

20. spacer 2.37|430732|18|CP036356|CRT matches to position: 431497-431514, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

21. spacer 2.37|430732|18|CP036356|CRT matches to position: 431542-431559, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

22. spacer 2.37|430732|18|CP036356|CRT matches to position: 3598695-3598712, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

23. spacer 2.38|430768|27|CP036356|CRT matches to position: 431227-431253, mismatch: 0, identity: 1.0

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggtgctcaagg	Protospacer
***************************

24. spacer 2.39|430813|18|CP036356|CRT matches to position: 431497-431514, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

25. spacer 2.39|430813|18|CP036356|CRT matches to position: 431542-431559, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

26. spacer 2.39|430813|18|CP036356|CRT matches to position: 3598695-3598712, mismatch: 0, identity: 1.0

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgctcaagg	Protospacer
******************

27. spacer 2.41|430894|27|CP036356|CRT matches to position: 431443-431469, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

28. spacer 2.41|430894|27|CP036356|CRT matches to position: 431578-431604, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

29. spacer 2.42|430939|27|CP036356|CRT matches to position: 431533-431559, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
***************************

30. spacer 2.43|430984|27|CP036356|CRT matches to position: 431443-431469, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

31. spacer 2.43|430984|27|CP036356|CRT matches to position: 431578-431604, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
***************************

32. spacer 2.44|431029|27|CP036356|CRT matches to position: 431533-431559, mismatch: 0, identity: 1.0

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
***************************

33. spacer 2.45|431074|18|CP036356|CRT matches to position: 431281-431298, mismatch: 0, identity: 1.0

acctcagggtattcaagg	CRISPR spacer
acctcagggtattcaagg	Protospacer
******************

34. spacer 2.1|429292|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

35. spacer 2.1|429292|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

36. spacer 2.1|429292|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

37. spacer 2.3|429364|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

38. spacer 2.3|429364|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

39. spacer 2.3|429364|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

40. spacer 2.5|429436|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

41. spacer 2.5|429436|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

42. spacer 2.5|429436|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

43. spacer 2.5|429436|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

44. spacer 2.5|429436|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

45. spacer 2.7|429517|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

46. spacer 2.7|429517|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

47. spacer 2.7|429517|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

48. spacer 2.7|429517|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

49. spacer 2.7|429517|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

50. spacer 2.9|429598|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

51. spacer 2.9|429598|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

52. spacer 2.9|429598|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

53. spacer 2.11|429670|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

54. spacer 2.11|429670|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

55. spacer 2.11|429670|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

56. spacer 2.11|429670|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

57. spacer 2.11|429670|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

58. spacer 2.13|429751|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

59. spacer 2.13|429751|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

60. spacer 2.13|429751|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

61. spacer 2.13|429751|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

62. spacer 2.13|429751|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

63. spacer 2.15|429823|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

64. spacer 2.15|429823|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

65. spacer 2.15|429823|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgccactggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
***.**************

66. spacer 2.17|429895|18|CP036356|CRT matches to position: 431272-431289, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

67. spacer 2.17|429895|18|CP036356|CRT matches to position: 431398-431415, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

68. spacer 2.17|429895|18|CP036356|CRT matches to position: 431623-431640, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctaccggacctcaggg	Protospacer
***************.**

69. spacer 2.17|429895|18|CP036356|CRT matches to position: 3598659-3598676, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

70. spacer 2.17|429895|18|CP036356|CRT matches to position: 3598713-3598730, mismatch: 1, identity: 0.944

tgctaccggacctcaagg	CRISPR spacer
tgctactggacctcaagg	Protospacer
******.***********

71. spacer 2.18|429931|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

72. spacer 2.20|430021|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

73. spacer 2.21|430066|18|CP036356|CRT matches to position: 431443-431460, mismatch: 1, identity: 0.944

tgctaccggacctcgagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
**************.***

74. spacer 2.21|430066|18|CP036356|CRT matches to position: 431533-431550, mismatch: 1, identity: 0.944

tgctaccggacctcgagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
**************.***

75. spacer 2.21|430066|18|CP036356|CRT matches to position: 431578-431595, mismatch: 1, identity: 0.944

tgctaccggacctcgagg	CRISPR spacer
tgctaccggacctcaagg	Protospacer
**************.***

76. spacer 2.22|430102|18|CP036356|CRT matches to position: 431488-431505, mismatch: 1, identity: 0.944

cgccactggacctcaagg	CRISPR spacer
cgctactggacctcaagg	Protospacer
***.**************

77. spacer 2.26|430264|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

78. spacer 2.28|430354|18|CP036356|CRT matches to position: 431488-431505, mismatch: 1, identity: 0.944

cgccactggacctcaagg	CRISPR spacer
cgctactggacctcaagg	Protospacer
***.**************

79. spacer 2.35|430642|27|CP036356|CRT matches to position: 3598650-3598676, mismatch: 1, identity: 0.963

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaagggcctcaagg	Protospacer
***.***********************

80. spacer 2.36|430687|27|CP036356|CRT matches to position: 431488-431514, mismatch: 1, identity: 0.963

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcaaggtgctcaagg	Protospacer
***************.***********

81. spacer 2.37|430732|18|CP036356|CRT matches to position: 431236-431253, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcagggtgctcaagg	Protospacer
******.***********

82. spacer 2.37|430732|18|CP036356|CRT matches to position: 431407-431424, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

83. spacer 2.37|430732|18|CP036356|CRT matches to position: 431452-431469, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

84. spacer 2.37|430732|18|CP036356|CRT matches to position: 431587-431604, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

85. spacer 2.38|430768|27|CP036356|CRT matches to position: 431488-431514, mismatch: 1, identity: 0.963

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcaaggtgctcaagg	Protospacer
***************.***********

86. spacer 2.39|430813|18|CP036356|CRT matches to position: 431236-431253, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcagggtgctcaagg	Protospacer
******.***********

87. spacer 2.39|430813|18|CP036356|CRT matches to position: 431407-431424, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

88. spacer 2.39|430813|18|CP036356|CRT matches to position: 431452-431469, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

89. spacer 2.39|430813|18|CP036356|CRT matches to position: 431587-431604, mismatch: 1, identity: 0.944

acctcaaggtgctcaagg	CRISPR spacer
acctcaaggtgttcaagg	Protospacer
***********.******

90. spacer 2.40|430849|27|CP036356|CRT matches to position: 431488-431514, mismatch: 1, identity: 0.963

cgctactggacctcaaggtgttcaagg	CRISPR spacer
cgctactggacctcaaggtgctcaagg	Protospacer
********************.******

91. spacer 2.41|430894|27|CP036356|CRT matches to position: 431398-431424, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.********************

92. spacer 2.41|430894|27|CP036356|CRT matches to position: 431533-431559, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
********************.******

93. spacer 2.41|430894|27|CP036356|CRT matches to position: 431623-431649, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.***********

94. spacer 2.42|430939|27|CP036356|CRT matches to position: 431443-431469, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

95. spacer 2.42|430939|27|CP036356|CRT matches to position: 431578-431604, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

96. spacer 2.43|430984|27|CP036356|CRT matches to position: 431398-431424, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.********************

97. spacer 2.43|430984|27|CP036356|CRT matches to position: 431533-431559, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcaaggtgctcaagg	Protospacer
********************.******

98. spacer 2.43|430984|27|CP036356|CRT matches to position: 431623-431649, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.***********

99. spacer 2.44|431029|27|CP036356|CRT matches to position: 431443-431469, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

100. spacer 2.44|431029|27|CP036356|CRT matches to position: 431578-431604, mismatch: 1, identity: 0.963

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcaaggtgttcaagg	Protospacer
********************.******

101. spacer 2.45|431074|18|CP036356|CRT matches to position: 431632-431649, mismatch: 1, identity: 0.944

acctcagggtattcaagg	CRISPR spacer
acctcagggtgttcaagg	Protospacer
**********.*******

102. spacer 2.18|429931|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

103. spacer 2.19|429976|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

104. spacer 2.20|430021|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

105. spacer 2.25|430219|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

106. spacer 2.26|430264|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

107. spacer 2.31|430471|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

108. spacer 2.34|430597|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctactggacctcagggcattcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
******.***********.********

109. spacer 2.35|430642|27|CP036356|CRT matches to position: 3598704-3598730, mismatch: 2, identity: 0.926

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgctactggacctcaaggacctcaagg	Protospacer
***.**************.********

110. spacer 2.36|430687|27|CP036356|CRT matches to position: 431191-431217, mismatch: 2, identity: 0.926

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggacctcaagg	Protospacer
******************  *******

111. spacer 2.38|430768|27|CP036356|CRT matches to position: 431191-431217, mismatch: 2, identity: 0.926

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctactggacctcagggacctcaagg	Protospacer
******************  *******

112. spacer 2.40|430849|27|CP036356|CRT matches to position: 431227-431253, mismatch: 2, identity: 0.926

cgctactggacctcaaggtgttcaagg	CRISPR spacer
cgctactggacctcagggtgctcaagg	Protospacer
***************.****.******

113. spacer 2.41|430894|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
***************.***.*******

114. spacer 2.42|430939|27|CP036356|CRT matches to position: 431398-431424, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.*************.******

115. spacer 2.42|430939|27|CP036356|CRT matches to position: 431623-431649, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.****.******

116. spacer 2.43|430984|27|CP036356|CRT matches to position: 431272-431298, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgctaccggacctcagggtattcaagg	Protospacer
***************.***.*******

117. spacer 2.44|431029|27|CP036356|CRT matches to position: 431398-431424, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgttcaagg	Protospacer
******.*************.******

118. spacer 2.44|431029|27|CP036356|CRT matches to position: 431623-431649, mismatch: 2, identity: 0.926

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctaccggacctcagggtgttcaagg	Protospacer
***************.****.******

MGE targeting detection<

CRISPR_ID	Spacer_Info	Spacer_region	Spacer_length	Hit_phage_ID	Hit_phage_def	Protospacer_location	Mismatch	Identity
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	2	0.926
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	2	0.926
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	2	0.926
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	3	0.889
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	3	0.889
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	3	0.889
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	3	0.889
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MT446392	UNVERIFIED: Escherichia virus TH15, complete genome	67531-67557	3	0.889
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	MN693226	Marine virus AFVG_25M419, complete genome	12225-12251	3	0.889
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MT446392	UNVERIFIED: Escherichia virus TH15, complete genome	67531-67557	3	0.889
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	MN693226	Marine virus AFVG_25M419, complete genome	12225-12251	3	0.889
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	KT264760	Gokushovirus WZ-2015a isolate 12Fra21, complete genome	5191-5215	3	0.88
CP036356_2	2.6\|429472\|27\|CP036356\|CRT	429472-429498	27	CP011076	Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence	1995-2021	4	0.852
CP036356_2	2.8\|429553\|27\|CP036356\|CRT	429553-429579	27	CP011076	Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence	1995-2021	4	0.852
CP036356_2	2.12\|429706\|27\|CP036356\|CRT	429706-429732	27	CP011076	Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence	1995-2021	4	0.852
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	MH884513	Bacillus phage vB_BpsS-36, complete genome	21540-21566	4	0.852
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	MH616963	CrAssphage sp. isolate ctbg_1, complete genome	22441-22467	4	0.852
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	MN101228	Klebsiella phage KPN4, complete genome	27774-27800	4	0.852
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	MN101228	Klebsiella phage KPN4, complete genome	28986-29012	4	0.852
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	MT446415	UNVERIFIED: Escherichia virus TH44, complete genome	2868-2894	4	0.852
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	4	0.852
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	4	0.852
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	4	0.852
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	4	0.852
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	MH884513	Bacillus phage vB_BpsS-36, complete genome	21540-21566	4	0.852
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	MH616963	CrAssphage sp. isolate ctbg_1, complete genome	22441-22467	4	0.852
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	MN101228	Klebsiella phage KPN4, complete genome	27774-27800	4	0.852
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	MN101228	Klebsiella phage KPN4, complete genome	28986-29012	4	0.852
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	MT446415	UNVERIFIED: Escherichia virus TH44, complete genome	2868-2894	4	0.852
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	NZ_CP045296	Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence	719922-719948	4	0.852
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	NC_024210	Escherichia phage e4/1c, complete genome	8033-8059	4	0.852
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	4	0.852
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	4	0.852
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	4	0.852
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	4	0.852
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	MH884513	Bacillus phage vB_BpsS-36, complete genome	21540-21566	4	0.852
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	MH616963	CrAssphage sp. isolate ctbg_1, complete genome	22441-22467	4	0.852
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	MN101228	Klebsiella phage KPN4, complete genome	27774-27800	4	0.852
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	MN101228	Klebsiella phage KPN4, complete genome	28986-29012	4	0.852
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	MT446415	UNVERIFIED: Escherichia virus TH44, complete genome	2868-2894	4	0.852
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	MH616963	CrAssphage sp. isolate ctbg_1, complete genome	22441-22467	4	0.852
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	MN101228	Klebsiella phage KPN4, complete genome	27774-27800	4	0.852
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	MN101228	Klebsiella phage KPN4, complete genome	28986-29012	4	0.852
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NC_006569	Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence	178449-178475	4	0.852
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	EU246945	Lactobacillus phage Lrm1, complete sequence	17376-17402	4	0.852
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NC_011104	Lactobacillus phage Lrm1, complete genome	17376-17402	4	0.852
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	NZ_CP045296	Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence	719922-719948	4	0.852
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	NC_024210	Escherichia phage e4/1c, complete genome	8033-8059	4	0.852
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	4	0.852
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	4	0.852
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	4	0.852
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	4	0.852
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	NZ_CP045296	Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence	719922-719948	4	0.852
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	NC_024210	Escherichia phage e4/1c, complete genome	8033-8059	4	0.852
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	4	0.852
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	4	0.852
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	4	0.852
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	4	0.852
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	MH884513	Bacillus phage vB_BpsS-36, complete genome	21540-21566	4	0.852
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	MH616963	CrAssphage sp. isolate ctbg_1, complete genome	22441-22467	4	0.852
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	MN101228	Klebsiella phage KPN4, complete genome	27774-27800	4	0.852
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	MN101228	Klebsiella phage KPN4, complete genome	28986-29012	4	0.852
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	MT446415	UNVERIFIED: Escherichia virus TH44, complete genome	2868-2894	4	0.852
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	FR682616	Roseovarius sp. 217 phage 1 partial genome sequence	14631-14657	4	0.852
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	FR719956	Roseovarius Plymouth Podovirus 1 partial sequence	14631-14657	4	0.852
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	FR682616	Roseovarius sp. 217 phage 1 partial genome sequence	14631-14657	4	0.852
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	FR719956	Roseovarius Plymouth Podovirus 1 partial sequence	14631-14657	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2677-2703	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2785-2811	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	8366-8392	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	8420-8446	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	8474-8500	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168901-168927	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	4	0.852
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	4	0.852
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MH513984	Mycobacterium phage Steamy, complete genome	4653-4679	4	0.852
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MN855617	Myoviridae sp. isolate 527, complete genome	7158-7184	4	0.852
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2632-2658	4	0.852
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	MN693092	Marine virus AFVG_25M37, complete genome	19120-19146	4	0.852
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MH513984	Mycobacterium phage Steamy, complete genome	4653-4679	4	0.852
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MN855617	Myoviridae sp. isolate 527, complete genome	7158-7184	4	0.852
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2632-2658	4	0.852
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	MN693092	Marine virus AFVG_25M37, complete genome	19120-19146	4	0.852
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	NZ_CP031069	Bacillus sp. JAS24-2 plasmid pl626, complete sequence	570384-570408	4	0.84
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	NZ_CP040346	Bacillus albus strain DLOU-Yingkou plasmid unnamed2, complete sequence	52379-52403	4	0.84
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	NZ_LR134433	Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24	307060-307084	4	0.84
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	KC430106	Bacillus phage BPS10C, complete genome	153087-153111	4	0.84
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	AP013516	Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44	11070-11094	4	0.84
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	AP013516	Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44	11082-11106	4	0.84
CP036356_2	2.6\|429472\|27\|CP036356\|CRT	429472-429498	27	CP011076	Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence	2040-2066	5	0.815
CP036356_2	2.8\|429553\|27\|CP036356\|CRT	429553-429579	27	CP011076	Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence	2040-2066	5	0.815
CP036356_2	2.12\|429706\|27\|CP036356\|CRT	429706-429732	27	CP011076	Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence	2040-2066	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	2984-3010	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	3074-3100	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NC_006569	Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence	178449-178475	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP012399	Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence	723561-723587	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP018096	Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence	478126-478152	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2893-2919	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2983-3009	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	394-420	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	484-510	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	177-203	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	267-293	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	EU246945	Lactobacillus phage Lrm1, complete sequence	17376-17402	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	MH937462	Streptococcus phage CHPC663, complete genome	17555-17581	5	0.815
CP036356_2	2.18\|429931\|27\|CP036356\|CRT	429931-429957	27	NC_011104	Lactobacillus phage Lrm1, complete genome	17376-17402	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	2984-3010	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	3074-3100	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NC_006569	Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence	178449-178475	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP012399	Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence	723561-723587	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP018096	Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence	478126-478152	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2893-2919	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2983-3009	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	394-420	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	484-510	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	177-203	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	267-293	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	EU246945	Lactobacillus phage Lrm1, complete sequence	17376-17402	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	MH937462	Streptococcus phage CHPC663, complete genome	17555-17581	5	0.815
CP036356_2	2.20\|430021\|27\|CP036356\|CRT	430021-430047	27	NC_011104	Lactobacillus phage Lrm1, complete genome	17376-17402	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	5	0.815
CP036356_2	2.23\|430138\|27\|CP036356\|CRT	430138-430164	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	2984-3010	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	3074-3100	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NC_006569	Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence	178449-178475	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP012399	Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence	723561-723587	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP018096	Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence	478126-478152	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2893-2919	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2983-3009	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	394-420	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	484-510	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	177-203	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	267-293	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	EU246945	Lactobacillus phage Lrm1, complete sequence	17376-17402	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	MH937462	Streptococcus phage CHPC663, complete genome	17555-17581	5	0.815
CP036356_2	2.26\|430264\|27\|CP036356\|CRT	430264-430290	27	NC_011104	Lactobacillus phage Lrm1, complete genome	17376-17402	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	MH884513	Bacillus phage vB_BpsS-36, complete genome	21540-21566	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	2984-3010	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	3074-3100	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP012399	Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence	723561-723587	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP018096	Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence	478126-478152	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2893-2919	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2983-3009	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	394-420	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	484-510	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	177-203	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	267-293	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	MT446415	UNVERIFIED: Escherichia virus TH44, complete genome	2868-2894	5	0.815
CP036356_2	2.27\|430309\|27\|CP036356\|CRT	430309-430335	27	MH937462	Streptococcus phage CHPC663, complete genome	17555-17581	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	5	0.815
CP036356_2	2.29\|430390\|27\|CP036356\|CRT	430390-430416	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	DQ222855	Bacillus anthracis phage Gamma isolate 53, complete genome	30899-30925	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	DQ289555	Bacillus anthracis phage W Beta, complete genome	33699-33725	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	NC_007734	Bacillus phage WBeta, complete genome	33699-33725	5	0.815
CP036356_2	2.32\|430516\|27\|CP036356\|CRT	430516-430542	27	DQ222854	Bacillus anthracis phage Gamma collagen region, complete sequence	3816-3842	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	2984-3010	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP053975	Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence	3074-3100	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NC_006569	Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence	178449-178475	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP012399	Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence	723561-723587	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP018096	Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence	478126-478152	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2893-2919	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NC_018512	Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence	2983-3009	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	394-420	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NC_004334	Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence	484-510	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	177-203	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NZ_CP009344	Bacillus thuringiensis HD1002 plasmid 7, complete sequence	267-293	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	EU246945	Lactobacillus phage Lrm1, complete sequence	17376-17402	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	MH937462	Streptococcus phage CHPC663, complete genome	17555-17581	5	0.815
CP036356_2	2.35\|430642\|27\|CP036356\|CRT	430642-430668	27	NC_011104	Lactobacillus phage Lrm1, complete genome	17376-17402	5	0.815
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	NZ_CP025547	Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence	134821-134847	5	0.815
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	5	0.815
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	MN693092	Marine virus AFVG_25M37, complete genome	19120-19146	5	0.815
CP036356_2	2.36\|430687\|27\|CP036356\|CRT	430687-430713	27	NC_022968	Enterobacteria phage 4MG, complete genome	48915-48941	5	0.815
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	NZ_CP025547	Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence	134821-134847	5	0.815
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	5	0.815
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	MN693092	Marine virus AFVG_25M37, complete genome	19120-19146	5	0.815
CP036356_2	2.38\|430768\|27\|CP036356\|CRT	430768-430794	27	NC_022968	Enterobacteria phage 4MG, complete genome	48915-48941	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2839-2865	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	169009-169035	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	169063-169089	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	169117-169143	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	KY705251	Streptococcus phage P0091, complete genome	17095-17121	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	MG708274	Streptococcus phage vB_SthS_VA214, complete genome	20008-20034	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	MH937499	Streptococcus phage CHPC1062, complete genome	17279-17305	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	MT354570	Pseudomonas phage phiB1_1, complete genome	30767-30793	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	274933-274959	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	275041-275067	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	NC_021795	Cellulophaga phage phi17:1, complete genome	26453-26479	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	MK373793	Escherichia phage vB_EcoS_MM01, complete genome	10523-10549	5	0.815
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	MN693092	Marine virus AFVG_25M37, complete genome	19120-19146	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	274825-274851	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	274933-274959	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	275041-275067	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2677-2703	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2785-2811	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168901-168927	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	169117-169143	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NZ_CP040335	Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence	9129-9155	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MG812496	Gordonia phage SallySpecial, complete genome	11678-11704	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MH622922	Microviridae sp. isolate ctce123, complete genome	4046-4072	5	0.815
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	NC_021795	Cellulophaga phage phi17:1, complete genome	26426-26452	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	274825-274851	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	274933-274959	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012101	Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence	275041-275067	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2677-2703	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2731-2757	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP012105	Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence	2785-2811	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168901-168927	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	168955-168981	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	CP024687	Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence	169117-169143	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NZ_CP040335	Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence	9129-9155	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MG812496	Gordonia phage SallySpecial, complete genome	11678-11704	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MH622922	Microviridae sp. isolate ctce123, complete genome	4046-4072	5	0.815
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	NC_021795	Cellulophaga phage phi17:1, complete genome	26426-26452	5	0.815
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	NC_049380	Vibrio phage JSF3, complete genome	17817-17841	5	0.8
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	KP280062	Vibrio phage phi 1, complete genome	50723-50747	5	0.8
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	NC_049350	Vibrio phage VCO139, complete genome	50483-50507	5	0.8
CP036356_6	6.2\|2744713\|25\|CP036356\|CRISPRCasFinder	2744713-2744737	25	NC_021540	Vibrio phage JA-1, complete genome	50790-50814	5	0.8
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	6	0.778
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	6	0.778
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	6	0.778
CP036356_2	2.19\|429976\|27\|CP036356\|CRT	429976-430002	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	6	0.778
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	6	0.778
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	6	0.778
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	6	0.778
CP036356_2	2.25\|430219\|27\|CP036356\|CRT	430219-430245	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	6	0.778
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	6	0.778
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	6	0.778
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	6	0.778
CP036356_2	2.31\|430471\|27\|CP036356\|CRT	430471-430497	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	6	0.778
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	MT776810	Gordonia phage BigChungus, complete genome	22339-22365	6	0.778
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	MN284906	Gordonia phage CherryonLim, complete genome	24076-24102	6	0.778
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	MK967385	Gordonia phage SheckWes, complete genome	22302-22328	6	0.778
CP036356_2	2.34\|430597\|27\|CP036356\|CRT	430597-430623	27	MT776808	Gordonia phage Feastonyeet, complete genome	22339-22365	6	0.778
CP036356_2	2.40\|430849\|27\|CP036356\|CRT	430849-430875	27	MH576968	Streptomyces phage Wofford, complete genome	74327-74353	6	0.778
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	KY705251	Streptococcus phage P0091, complete genome	17095-17121	6	0.778
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MG708274	Streptococcus phage vB_SthS_VA214, complete genome	20008-20034	6	0.778
CP036356_2	2.41\|430894\|27\|CP036356\|CRT	430894-430920	27	MH937499	Streptococcus phage CHPC1062, complete genome	17279-17305	6	0.778
CP036356_2	2.42\|430939\|27\|CP036356\|CRT	430939-430965	27	NZ_CP025547	Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence	134821-134847	6	0.778
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	KY705251	Streptococcus phage P0091, complete genome	17095-17121	6	0.778
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MG708274	Streptococcus phage vB_SthS_VA214, complete genome	20008-20034	6	0.778
CP036356_2	2.43\|430984\|27\|CP036356\|CRT	430984-431010	27	MH937499	Streptococcus phage CHPC1062, complete genome	17279-17305	6	0.778
CP036356_2	2.44\|431029\|27\|CP036356\|CRT	431029-431055	27	NZ_CP025547	Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence	134821-134847	6	0.778

1. spacer 2.23|430138|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 2, identity: 0.926

tgccactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** ***************.********

2. spacer 2.29|430390|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 2, identity: 0.926

tgccactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** ***************.********

3. spacer 2.32|430516|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 2, identity: 0.926

tgccactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** ***************.********

4. spacer 2.19|429976|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

5. spacer 2.25|430219|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

6. spacer 2.31|430471|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

7. spacer 2.34|430597|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 3, identity: 0.889

tgctactggacctcagggcattcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
** .**************.********

8. spacer 2.41|430894|27|CP036356|CRT matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ggctaccggccctcaaggtattcaagg	Protospacer
 ******** *********.*******

9. spacer 2.42|430939|27|CP036356|CRT matches to MN693226 (Marine virus AFVG_25M419, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
agctaccggccctcaaggtcctcaagg	Protospacer
 ******** ********* *******

10. spacer 2.43|430984|27|CP036356|CRT matches to MT446392 (UNVERIFIED: Escherichia virus TH15, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ggctaccggccctcaaggtattcaagg	Protospacer
 ******** *********.*******

11. spacer 2.44|431029|27|CP036356|CRT matches to MN693226 (Marine virus AFVG_25M419, complete genome) position: , mismatch: 3, identity: 0.889

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
agctaccggccctcaaggtcctcaagg	Protospacer
 ******** ********* *******

12. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to KT264760 (Gokushovirus WZ-2015a isolate 12Fra21, complete genome) position: , mismatch: 3, identity: 0.88

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
ggtaaaggaggaagttaaagaatga	Protospacer
******.******** ******* *

13. spacer 2.6|429472|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

cgctaccggtgccactggacctcgagg	CRISPR spacer
cgctaccggtgctactggacctaccgg	Protospacer
************.*********   **

14. spacer 2.8|429553|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

cgctaccggtgccactggacctcgagg	CRISPR spacer
cgctaccggtgctactggacctaccgg	Protospacer
************.*********   **

15. spacer 2.12|429706|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.852

cgctaccggtgccactggacctcgagg	CRISPR spacer
cgctaccggtgctactggacctaccgg	Protospacer
************.*********   **

16. spacer 2.18|429931|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

17. spacer 2.18|429931|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

18. spacer 2.18|429931|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

19. spacer 2.18|429931|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

20. spacer 2.18|429931|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

21. spacer 2.19|429976|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

22. spacer 2.19|429976|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

23. spacer 2.19|429976|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

24. spacer 2.19|429976|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

25. spacer 2.20|430021|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

26. spacer 2.20|430021|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

27. spacer 2.20|430021|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

28. spacer 2.20|430021|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

29. spacer 2.20|430021|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

30. spacer 2.23|430138|27|CP036356|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tcccactggacttcagggcattctcgg	Protospacer
* *********.***********  **

31. spacer 2.23|430138|27|CP036356|CRT matches to NC_024210 (Escherichia phage e4/1c, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tgataccggaccgcagggcattcaagg	Protospacer
** .**.***** **************

32. spacer 2.25|430219|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

33. spacer 2.25|430219|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

34. spacer 2.25|430219|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

35. spacer 2.25|430219|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

36. spacer 2.26|430264|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

37. spacer 2.26|430264|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

38. spacer 2.26|430264|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

39. spacer 2.26|430264|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

40. spacer 2.26|430264|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

41. spacer 2.27|430309|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

42. spacer 2.27|430309|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

43. spacer 2.27|430309|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

44. spacer 2.27|430309|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 4, identity: 0.852

----cgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    ****    *******************

45. spacer 2.27|430309|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
** .***** ******** ********

46. spacer 2.27|430309|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 4, identity: 0.852

cgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
** .***** ******** ********

47. spacer 2.29|430390|27|CP036356|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tcccactggacttcagggcattctcgg	Protospacer
* *********.***********  **

48. spacer 2.29|430390|27|CP036356|CRT matches to NC_024210 (Escherichia phage e4/1c, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tgataccggaccgcagggcattcaagg	Protospacer
** .**.***** **************

49. spacer 2.31|430471|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

50. spacer 2.31|430471|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

51. spacer 2.31|430471|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

52. spacer 2.31|430471|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

53. spacer 2.32|430516|27|CP036356|CRT matches to NZ_CP045296 (Paenibacillus cellulositrophicus strain KACC 16577 plasmid unnamed1, complete sequence) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tcccactggacttcagggcattctcgg	Protospacer
* *********.***********  **

54. spacer 2.32|430516|27|CP036356|CRT matches to NC_024210 (Escherichia phage e4/1c, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcagggcattcaagg	CRISPR spacer
tgataccggaccgcagggcattcaagg	Protospacer
** .**.***** **************

55. spacer 2.34|430597|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

56. spacer 2.34|430597|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

57. spacer 2.34|430597|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

58. spacer 2.34|430597|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

tgctactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*************.** ********

59. spacer 2.35|430642|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
*. .**************.********

60. spacer 2.35|430642|27|CP036356|CRT matches to MH616963 (CrAssphage sp. isolate ctbg_1, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agctgctggacctcaaggtcctcaagg	Protospacer
 **..************* ********

61. spacer 2.35|430642|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

62. spacer 2.35|430642|27|CP036356|CRT matches to MN101228 (Klebsiella phage KPN4, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
agacactggtcctcaaggtcctcaagg	Protospacer
 * ****** ******** ********

63. spacer 2.35|430642|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 4, identity: 0.852

tgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
** .***** ******** ********

64. spacer 2.36|430687|27|CP036356|CRT matches to FR682616 (Roseovarius sp. 217 phage 1 partial genome sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

65. spacer 2.36|430687|27|CP036356|CRT matches to FR719956 (Roseovarius Plymouth Podovirus 1 partial sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

66. spacer 2.38|430768|27|CP036356|CRT matches to FR682616 (Roseovarius sp. 217 phage 1 partial genome sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

67. spacer 2.38|430768|27|CP036356|CRT matches to FR719956 (Roseovarius Plymouth Podovirus 1 partial sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcagggtgctcaagg	CRISPR spacer
cccgacaggaccacagggtgctcaagg	Protospacer
* * ** ***** **************

68. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * ************** ********

69. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * ************** ********

70. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * ************** ********

71. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
acctactggaccccaaggagttcaagg	Protospacer
  **********.***** ********

72. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
acctactggaccccaaggagttcaagg	Protospacer
  **********.***** ********

73. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
acctactggaccccaaggagttcaagg	Protospacer
  **********.***** ********

74. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * ************** ********

75. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * ************** ********

76. spacer 2.40|430849|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

77. spacer 2.40|430849|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

78. spacer 2.40|430849|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

79. spacer 2.40|430849|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 4, identity: 0.852

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .**************** .*******

80. spacer 2.41|430894|27|CP036356|CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgaccccggacctcagggtgttcaagg	Protospacer
** . **********.***********

81. spacer 2.41|430894|27|CP036356|CRT matches to MN855617 (Myoviridae sp. isolate 527, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agataccggaccgcaaggtattcaagg	Protospacer
 * ********* ******.*******

82. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tccaaccggacctcaaggaattcaagg	Protospacer
* * ************** .*******

83. spacer 2.42|430939|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
******.***************   **

84. spacer 2.43|430984|27|CP036356|CRT matches to MH513984 (Mycobacterium phage Steamy, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tgaccccggacctcagggtgttcaagg	Protospacer
** . **********.***********

85. spacer 2.43|430984|27|CP036356|CRT matches to MN855617 (Myoviridae sp. isolate 527, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agataccggaccgcaaggtattcaagg	Protospacer
 * ********* ******.*******

86. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
tccaaccggacctcaaggaattcaagg	Protospacer
* * ************** .*******

87. spacer 2.44|431029|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 4, identity: 0.852

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
******.***************   **

88. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NZ_CP031069 (Bacillus sp. JAS24-2 plasmid pl626, complete sequence) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
tataaaagaggaagtaaaagaagaa	Protospacer
 .********************  *

89. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NZ_CP040346 (Bacillus albus strain DLOU-Yingkou plasmid unnamed2, complete sequence) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
ggatctagaggaagtaaaagaatca	Protospacer
**    *******************

90. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NZ_LR134433 (Legionella adelaidensis strain NCTC12735 genome assembly, plasmid: 24) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtaatagaggaagtaaaagaagaa	Protospacer
.**** ****************  *

91. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to KC430106 (Bacillus phage BPS10C, complete genome) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtagaagaggaagtaaaagaagaa	Protospacer
.***.*****************  *

92. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to AP013516 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtaaaagaagaagtaaaagaagaa	Protospacer
.********.************  *

93. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to AP013516 (Uncultured Mediterranean phage uvMED DNA, complete genome, group G21, isolate: uvMED-CGR-U-MedDCM-OCT-S29-C44) position: , mismatch: 4, identity: 0.84

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
agtaaaagaagaagtaaaagaagaa	Protospacer
.********.************  *

94. spacer 2.6|429472|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctaccggtgccactggacctcgagg	CRISPR spacer
tgctaccggtgctactggacctaccgg	Protospacer
.***********.*********   **

95. spacer 2.8|429553|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctaccggtgccactggacctcgagg	CRISPR spacer
tgctaccggtgctactggacctaccgg	Protospacer
.***********.*********   **

96. spacer 2.12|429706|27|CP036356|CRT matches to CP011076 (Brevibacillus laterosporus strain B9 plasmid unnamed2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctaccggtgccactggacctcgagg	CRISPR spacer
tgctaccggtgctactggacctaccgg	Protospacer
.***********.*********   **

97. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

98. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

99. spacer 2.18|429931|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

100. spacer 2.18|429931|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

101. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

102. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

103. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

104. spacer 2.18|429931|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

105. spacer 2.18|429931|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

106. spacer 2.18|429931|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

107. spacer 2.18|429931|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

108. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

109. spacer 2.18|429931|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

110. spacer 2.18|429931|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

111. spacer 2.18|429931|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

112. spacer 2.18|429931|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

113. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

114. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

115. spacer 2.20|430021|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

116. spacer 2.20|430021|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

117. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

118. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

119. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

120. spacer 2.20|430021|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

121. spacer 2.20|430021|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

122. spacer 2.20|430021|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

123. spacer 2.20|430021|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

124. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

125. spacer 2.20|430021|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

126. spacer 2.20|430021|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

127. spacer 2.20|430021|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

128. spacer 2.20|430021|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

129. spacer 2.23|430138|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

130. spacer 2.23|430138|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

131. spacer 2.23|430138|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. ***.**************.*****

132. spacer 2.23|430138|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

133. spacer 2.23|430138|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

134. spacer 2.23|430138|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

135. spacer 2.23|430138|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

136. spacer 2.23|430138|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

137. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

138. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

139. spacer 2.26|430264|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

140. spacer 2.26|430264|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

141. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

142. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

143. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

144. spacer 2.26|430264|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

145. spacer 2.26|430264|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

146. spacer 2.26|430264|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

147. spacer 2.26|430264|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

148. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

149. spacer 2.26|430264|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

150. spacer 2.26|430264|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

151. spacer 2.26|430264|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

152. spacer 2.26|430264|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

153. spacer 2.27|430309|27|CP036356|CRT matches to MH884513 (Bacillus phage vB_BpsS-36, complete genome) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
taatactggacctcaaggacctcaagg	Protospacer
.. .**************.********

154. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

155. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

156. spacer 2.27|430309|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

157. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

158. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

159. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

160. spacer 2.27|430309|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

161. spacer 2.27|430309|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

162. spacer 2.27|430309|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

163. spacer 2.27|430309|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

164. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

165. spacer 2.27|430309|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

166. spacer 2.27|430309|27|CP036356|CRT matches to MT446415 (UNVERIFIED: Escherichia virus TH44, complete genome) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
tgatactggtcctcaaggtcctcaagg	Protospacer
.* .***** ******** ********

167. spacer 2.27|430309|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

cgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

168. spacer 2.29|430390|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

169. spacer 2.29|430390|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

170. spacer 2.29|430390|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. ***.**************.*****

171. spacer 2.29|430390|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

172. spacer 2.29|430390|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

173. spacer 2.29|430390|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

174. spacer 2.29|430390|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

175. spacer 2.29|430390|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

176. spacer 2.32|430516|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

177. spacer 2.32|430516|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

178. spacer 2.32|430516|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. ***.**************.*****

179. spacer 2.32|430516|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. *** **************.*****

180. spacer 2.32|430516|27|CP036356|CRT matches to DQ222855 (Bacillus anthracis phage Gamma isolate 53, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

181. spacer 2.32|430516|27|CP036356|CRT matches to DQ289555 (Bacillus anthracis phage W Beta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

182. spacer 2.32|430516|27|CP036356|CRT matches to NC_007734 (Bacillus phage WBeta, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

183. spacer 2.32|430516|27|CP036356|CRT matches to DQ222854 (Bacillus anthracis phage Gamma collagen region, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcagggcattcaagg	CRISPR spacer
aactactggacctcaaggaattcaagg	Protospacer
 .*.***********.** ********

184. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

185. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP053975 (Bacillus thuringiensis strain FDAARGOS_796 plasmid unnamed6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

186. spacer 2.35|430642|27|CP036356|CRT matches to NC_006569 (Ruegeria pomeroyi DSS-3 megaplasmid, complete sequence) position: , mismatch: 5, identity: 0.815

----tgccactggacctcaagggcctcaagg	CRISPR spacer
aaatcgcc----gacctcaagggcctcaagg	Protospacer
    .***    *******************

187. spacer 2.35|430642|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

188. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP012399 (Chelatococcus sp. CO-6 plasmid pCO-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

189. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * *************** .******

190. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP018096 (Chelatococcus daeguensis strain TAD1 plasmid pTAD1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agccgtcggacctcaagggcctcaaga	Protospacer
 ***...*******************.

191. spacer 2.35|430642|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

192. spacer 2.35|430642|27|CP036356|CRT matches to NC_018512 (Bacillus thuringiensis HD-789 plasmid pBTHD789-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

193. spacer 2.35|430642|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

194. spacer 2.35|430642|27|CP036356|CRT matches to NC_004334 (Bacillus thuringiensis 4Q2 plasmid pTX14-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

195. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

196. spacer 2.35|430642|27|CP036356|CRT matches to NZ_CP009344 (Bacillus thuringiensis HD1002 plasmid 7, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
accaacaggacctcaaggacctcaagg	Protospacer
  * ** ***********.********

197. spacer 2.35|430642|27|CP036356|CRT matches to EU246945 (Lactobacillus phage Lrm1, complete sequence) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

198. spacer 2.35|430642|27|CP036356|CRT matches to MH937462 (Streptococcus phage CHPC663, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
agaccgtggacctcaaggtcctcaagg	Protospacer
 * *  ************ ********

199. spacer 2.35|430642|27|CP036356|CRT matches to NC_011104 (Lactobacillus phage Lrm1, complete genome) position: , mismatch: 5, identity: 0.815

tgccactggacctcaagggcctcaagg	CRISPR spacer
cgatactggtcctcaaggccctcaagg	Protospacer
.* .***** ******** ********

200. spacer 2.36|430687|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
******. ****************.

201. spacer 2.36|430687|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
.* .***************..******

202. spacer 2.36|430687|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
.**************.******   **

203. spacer 2.36|430687|27|CP036356|CRT matches to NC_022968 (Enterobacteria phage 4MG, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
accaactggacctcagggtccacaagg	Protospacer
  * *************** * *****

204. spacer 2.38|430768|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
******. ****************.

205. spacer 2.38|430768|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
.* .***************..******

206. spacer 2.38|430768|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
.**************.******   **

207. spacer 2.38|430768|27|CP036356|CRT matches to NC_022968 (Enterobacteria phage 4MG, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcagggtgctcaagg	CRISPR spacer
accaactggacctcagggtccacaagg	Protospacer
  * *************** * *****

208. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggaccccaaggagttcaagg	Protospacer
  * ********.***** ********

209. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggaccccaaggagttcaagg	Protospacer
  * ********.***** ********

210. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaactggaccccaaggagttcaagg	Protospacer
  * ********.***** ********

211. spacer 2.40|430849|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

212. spacer 2.40|430849|27|CP036356|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  *********************

213. spacer 2.40|430849|27|CP036356|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  *********************

214. spacer 2.40|430849|27|CP036356|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  *********************

215. spacer 2.40|430849|27|CP036356|CRT matches to MT354570 (Pseudomonas phage phiB1_1, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
agggcctggacctcaaggtgtacaagg	Protospacer
 *   **************** *****

216. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

217. spacer 2.40|430849|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
accgacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

218. spacer 2.40|430849|27|CP036356|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
tgagactggacctcaaggtatacaagg	Protospacer
.*  ***************.* *****

219. spacer 2.40|430849|27|CP036356|CRT matches to MK373793 (Escherichia phage vB_EcoS_MM01, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
tgacactggacctcagggtattcaagg	Protospacer
.* .***********.***.*******

220. spacer 2.40|430849|27|CP036356|CRT matches to MN693092 (Marine virus AFVG_25M37, complete genome) position: , mismatch: 5, identity: 0.815

cgctactggacctcaaggtgttcaagg	CRISPR spacer
tgctactggacctcaaggtgctaccgg	Protospacer
.*******************.*   **

221. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggatctcaaggagttcaagg	Protospacer
  * ******.******* ********

222. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

223. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accgacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

224. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

225. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

226. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

227. spacer 2.41|430894|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

228. spacer 2.41|430894|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

229. spacer 2.41|430894|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

230. spacer 2.41|430894|27|CP036356|CRT matches to NZ_CP040335 (Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggacttcaaggtattcaagg	Protospacer
  * *******.*******.*******

231. spacer 2.41|430894|27|CP036356|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ccccaccggaccccaaggtgtgcaagg	Protospacer
. *.********.******** *****

232. spacer 2.41|430894|27|CP036356|CRT matches to MH622922 (Microviridae sp. isolate ctce123, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
acccatcggaccacaaggtgttcaagg	Protospacer
  *.*.****** **************

233. spacer 2.41|430894|27|CP036356|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agagaccggacctcaaggtatacaagg	Protospacer
 *  ***************.* *****

234. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggatctcaaggagttcaagg	Protospacer
  * ******.******* ********

235. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

236. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012101 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-2, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accgacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

237. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

238. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

239. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP012105 (Bacillus thuringiensis strain HS18-1 plasmid pHS18-6, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

240. spacer 2.43|430984|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggagttcaagg	Protospacer
  * **.*********** ********

241. spacer 2.43|430984|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaactggacctcaaggggttcaagg	Protospacer
  * **.*********** ********

242. spacer 2.43|430984|27|CP036356|CRT matches to CP024687 (Bacillus wiedmannii bv. thuringiensis strain FCC41 plasmid pFCC41-3-257K, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaacaggacctcaaggagttcaagg	Protospacer
  * ** *********** ********

243. spacer 2.43|430984|27|CP036356|CRT matches to NZ_CP040335 (Bacillus cereus strain DLOU-Changhai plasmid unnamed1, complete sequence) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
accaaccggacttcaaggtattcaagg	Protospacer
  * *******.*******.*******

244. spacer 2.43|430984|27|CP036356|CRT matches to MG812496 (Gordonia phage SallySpecial, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
ccccaccggaccccaaggtgtgcaagg	Protospacer
. *.********.******** *****

245. spacer 2.43|430984|27|CP036356|CRT matches to MH622922 (Microviridae sp. isolate ctce123, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
acccatcggaccacaaggtgttcaagg	Protospacer
  *.*.****** **************

246. spacer 2.43|430984|27|CP036356|CRT matches to NC_021795 (Cellulophaga phage phi17:1, complete genome) position: , mismatch: 5, identity: 0.815

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agagaccggacctcaaggtatacaagg	Protospacer
 *  ***************.* *****

247. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NC_049380 (Vibrio phage JSF3, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.**************

248. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to KP280062 (Vibrio phage phi 1, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.**************

249. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NC_049350 (Vibrio phage VCO139, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.**************

250. spacer 6.2|2744713|25|CP036356|CRISPRCasFinder matches to NC_021540 (Vibrio phage JA-1, complete genome) position: , mismatch: 5, identity: 0.8

ggtaaaagaggaagtaaaagaatca	CRISPR spacer
accaaaagaagaagtaaaagaatct	Protospacer
. .******.**************

251. spacer 2.19|429976|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

252. spacer 2.19|429976|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

253. spacer 2.19|429976|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

254. spacer 2.19|429976|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

255. spacer 2.25|430219|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

256. spacer 2.25|430219|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

257. spacer 2.25|430219|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

258. spacer 2.25|430219|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

259. spacer 2.31|430471|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

260. spacer 2.31|430471|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

261. spacer 2.31|430471|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

262. spacer 2.31|430471|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

263. spacer 2.34|430597|27|CP036356|CRT matches to MT776810 (Gordonia phage BigChungus, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

264. spacer 2.34|430597|27|CP036356|CRT matches to MN284906 (Gordonia phage CherryonLim, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

265. spacer 2.34|430597|27|CP036356|CRT matches to MK967385 (Gordonia phage SheckWes, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacaccggacctcagggcatccaagg	Protospacer
.. .**.**************.*****

266. spacer 2.34|430597|27|CP036356|CRT matches to MT776808 (Gordonia phage Feastonyeet, complete genome) position: , mismatch: 6, identity: 0.778

tgctactggacctcagggcattcaagg	CRISPR spacer
caacacgggacctcagggcatccaagg	Protospacer
.. .** **************.*****

267. spacer 2.40|430849|27|CP036356|CRT matches to MH576968 (Streptomyces phage Wofford, complete genome) position: , mismatch: 6, identity: 0.778

cgctactggacctcaaggtgttcaagg	CRISPR spacer
aatgactggacctcaaggtgtccaggg	Protospacer
 .. *****************.**.**

268. spacer 2.41|430894|27|CP036356|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

269. spacer 2.41|430894|27|CP036356|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

270. spacer 2.41|430894|27|CP036356|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

271. spacer 2.42|430939|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
.****** *******.********.

272. spacer 2.43|430984|27|CP036356|CRT matches to KY705251 (Streptococcus phage P0091, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

273. spacer 2.43|430984|27|CP036356|CRT matches to MG708274 (Streptococcus phage vB_SthS_VA214, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

274. spacer 2.43|430984|27|CP036356|CRT matches to MH937499 (Streptococcus phage CHPC1062, complete genome) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgttcaagg	CRISPR spacer
agaccgtggacctcaaggtgttcaagg	Protospacer
 * .  .********************

275. spacer 2.44|431029|27|CP036356|CRT matches to NZ_CP025547 (Mycobacterium paragordonae strain 49061 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.778

tgctaccggacctcaaggtgctcaagg	CRISPR spacer
cgctacccgacctcagggtgctcagcc	Protospacer
.****** *******.********.

Prophage detection

Region	Region Position	Protein_number	Hit_taxonomy	Key_proteins	Att_site	Prophage annotation

Anti-CRISPR protein detection

Acr ID	Acr position	Acr size	Homology with known anti	Neighbor HTH/AcRanker	Neighbor Aca	In prophage	Protospacer in prophage

Overview of predicted results

Overview of the results

Cas Category Instructions

Results visualization

1. CP036356

Click the left colored region to show detailed information

CRISPR-Cas detection and classification

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Click the colored protein region to show detailed information

Self-targeting detection

MGE targeting detection<

Prophage detection

Anti-CRISPR protein detection