Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP036403 Serinicoccus sp. HY006 chromosome, complete genome 4 crisprs NA 0 3 0 0

Results visualization

1. CP036403
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036403_1 598422-598519 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036403_2 3588206-3588281 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036403_3 3647437-3647601 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP036403_4 3659550-3659628 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP036403_4 4.1|3659576|27|CP036403|CRISPRCasFinder 3659576-3659602 27 AY048850 Natrinema virus SNJ1, complete genome 4892-4918 4 0.852
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 NZ_AP022593 Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence 629363-629392 5 0.833
CP036403_1 1.1|598456|30|CP036403|CRISPRCasFinder 598456-598485 30 NZ_CP028352 Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence 62689-62718 7 0.767
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 NZ_LR134456 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence 126773-126802 8 0.733
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 NZ_CP017565 Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence 234212-234241 8 0.733
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 MK524490 Mycobacterium phage Donny, complete genome 33995-34024 8 0.733
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 JN699007 Mycobacterium phage Acadian, complete genome 33990-34019 8 0.733
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 MT889381 Mycobacterium phage Suigeneris, complete genome 33995-34024 8 0.733
CP036403_2 2.1|3588229|30|CP036403|CRISPRCasFinder 3588229-3588258 30 NZ_CP044283 Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence 154520-154549 9 0.7

1. spacer 4.1|3659576|27|CP036403|CRISPRCasFinder matches to AY048850 (Natrinema virus SNJ1, complete genome) position: , mismatch: 4, identity: 0.852 

tgacgatggttacgattccgtcctccc	CRISPR spacer
tgacgacggtgacgattccgtcctcga	Protospacer
******.*** **************

2. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to NZ_AP022593 (Mycolicibacterium arabiense strain JCM 18538 plasmid pJCM18538, complete sequence) position: , mismatch: 5, identity: 0.833 

tgggctgccgcgcccagcggcgacggaggt--	CRISPR spacer
tgggctgccgcggcctgcggcga--gcggtcg	Protospacer
************ ** *******  * ***

3. spacer 1.1|598456|30|CP036403|CRISPRCasFinder matches to NZ_CP028352 (Pantoea vagans strain PV989 plasmid pPV989-94, complete sequence) position: , mismatch: 7, identity: 0.767 

gcttctcccgaccgggcgcacgcttctccc	CRISPR spacer
acttcacccgaccgggggcacgcttgacgt	Protospacer
.**** ********** ********  * .

4. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to NZ_LR134456 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 14, complete sequence) position: , mismatch: 8, identity: 0.733 

tgggctgccgcgcccagcggcgacggaggt	CRISPR spacer
cccgtggccgcgcgcagcggcgacggagac	Protospacer
.  *. ******* **************..

5. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to NZ_CP017565 (Paraburkholderia sprentiae WSM5005 plasmid pl2WSM5005, complete sequence) position: , mismatch: 8, identity: 0.733 

tgggctgccgcgcccagcggcgacggaggt	CRISPR spacer
acagctgccgcgcccagcgccgacagcagc	Protospacer
  .**************** ****.* .*.

6. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to MK524490 (Mycobacterium phage Donny, complete genome) position: , mismatch: 8, identity: 0.733 

tgggctgccgcgcccagcggcgacggaggt	CRISPR spacer
accggagccgcgcccggcggcggcggaggc	Protospacer
   *  *********.******.******.

7. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to JN699007 (Mycobacterium phage Acadian, complete genome) position: , mismatch: 8, identity: 0.733 

tgggctgccgcgcccagcggcgacggaggt	CRISPR spacer
accggagccgcgcccggcggcggcggaggc	Protospacer
   *  *********.******.******.

8. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to MT889381 (Mycobacterium phage Suigeneris, complete genome) position: , mismatch: 8, identity: 0.733 

tgggctgccgcgcccagcggcgacggaggt	CRISPR spacer
accggagccgcgcccggcggcggcggaggc	Protospacer
   *  *********.******.******.

9. spacer 2.1|3588229|30|CP036403|CRISPRCasFinder matches to NZ_CP044283 (Rhodococcus erythropolis strain X5 plasmid pRhX5, complete sequence) position: , mismatch: 9, identity: 0.7 

tgggctgccgcgcccagcggcgacggaggt	CRISPR spacer
caggctgccgagcccagcagcgacgtgtcg	Protospacer
..******** *******.****** .

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage