Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP019373 Sterolibacteriaceae bacterium M52 DNA, complete genome 3 crisprs NA 1 2 0 0

Results visualization

1. AP019373
Click the left colored region to show detailed information

CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019373_1 518990-519069 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019373_2 1735909-1736015 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019373_3 1963758-1963840 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 AP019373.1 209063-209090 2 0.929
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 AP019373.1 793235-793262 2 0.929
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 AP019373.1 793289-793316 2 0.929

1. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to position: 209063-209090, mismatch: 2, identity: 0.929 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
acctcgcacagtcggcgctggcggaaat	Protospacer
****** * *******************

2. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to position: 793235-793262, mismatch: 2, identity: 0.929 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
acctccaaaagtcggcgctggcggaaat	Protospacer
***** .*********************

3. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to position: 793289-793316, mismatch: 2, identity: 0.929 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
acctccaaaagtcggcgctggcggaaat	Protospacer
***** .*********************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
AP019373_3 3.1|1963787|25|AP019373|CRISPRCasFinder 1963787-1963811 25 NZ_AP022319 Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence 385207-385231 4 0.84
AP019373_3 3.1|1963787|25|AP019373|CRISPRCasFinder 1963787-1963811 25 MK864266 Gordonia phage Arri, complete genome 43283-43307 4 0.84
AP019373_3 3.1|1963787|25|AP019373|CRISPRCasFinder 1963787-1963811 25 MK937603 Gordonia phage Bakery, complete genome 44473-44497 4 0.84
AP019373_3 3.1|1963787|25|AP019373|CRISPRCasFinder 1963787-1963811 25 MT639651 Gordonia phage Portcullis, complete genome 42945-42969 4 0.84
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NC_013860 Azospirillum sp. B510 plasmid pAB510f, complete sequence 79011-79038 5 0.821
AP019373_3 3.1|1963787|25|AP019373|CRISPRCasFinder 1963787-1963811 25 MN096362 Arthrobacter phage Vibaki, complete genome 5364-5388 5 0.8
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_LR134465 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence 176332-176359 6 0.786
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_CP014972 Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence 12177-12204 6 0.786
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_CP030074 Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence 453835-453862 6 0.786
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_CP030830 Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence 102750-102777 6 0.786
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_LR699117 Aquicella lusitana strain SGT-39 plasmid 4 9476-9503 7 0.75
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_CP017105 Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence 1951650-1951677 7 0.75
AP019373_1 1.1|519016|28|AP019373|CRISPRCasFinder 519016-519043 28 NZ_CP049249 Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence 630352-630379 8 0.714

1. spacer 3.1|1963787|25|AP019373|CRISPRCasFinder matches to NZ_AP022319 (Burkholderia sp. THE68 plasmid BTHE68_p1, complete sequence) position: , mismatch: 4, identity: 0.84 

agaatcgacgacgtcccgccgggcg	CRISPR spacer
ggcctcgacgacgtcgcgccgggcg	Protospacer
.*  *********** *********

2. spacer 3.1|1963787|25|AP019373|CRISPRCasFinder matches to MK864266 (Gordonia phage Arri, complete genome) position: , mismatch: 4, identity: 0.84 

agaatcgacgacgtcccgccgggcg	CRISPR spacer
agcatcgacgacgtcccgccgccgg	Protospacer
** ******************   *

3. spacer 3.1|1963787|25|AP019373|CRISPRCasFinder matches to MK937603 (Gordonia phage Bakery, complete genome) position: , mismatch: 4, identity: 0.84 

agaatcgacgacgtcccgccgggcg	CRISPR spacer
agcatcgacgacgtcccgccgccgg	Protospacer
** ******************   *

4. spacer 3.1|1963787|25|AP019373|CRISPRCasFinder matches to MT639651 (Gordonia phage Portcullis, complete genome) position: , mismatch: 4, identity: 0.84 

agaatcgacgacgtcccgccgggcg	CRISPR spacer
agcatcgacgacgtcccgccgccgg	Protospacer
** ******************   *

5. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NC_013860 (Azospirillum sp. B510 plasmid pAB510f, complete sequence) position: , mismatch: 5, identity: 0.821 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
aaaccggaaagttgccgctggcggaaat	Protospacer
*  .********.* *************

6. spacer 3.1|1963787|25|AP019373|CRISPRCasFinder matches to MN096362 (Arthrobacter phage Vibaki, complete genome) position: , mismatch: 5, identity: 0.8 

agaatcgacgacgtcccgccgggcg	CRISPR spacer
gcagctgacgacgtcccgccgggcg	Protospacer
. *...*******************

7. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_LR134465 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 23, complete sequence) position: , mismatch: 6, identity: 0.786 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
gcctcgggaactcggcgctggcggtgct	Protospacer
.******.** ************* . *

8. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_CP014972 (Salmonella enterica subsp. enterica serovar Typhimurium str. USDA-ARS-USMARC-1898 isolate ST073 plasmid pSTY1-1898, complete sequence) position: , mismatch: 6, identity: 0.786 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
attccggaaagtcggatctggcggaaac	Protospacer
*...***********  **********.

9. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_CP030074 (Streptomyces sp. ZFG47 plasmid unnamed1, complete sequence) position: , mismatch: 6, identity: 0.786 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
gtcccggaaaggcggcgctggcggagtt	Protospacer
..*.******* *************. *

10. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_CP030830 (Neorhizobium sp. NCHU2750 plasmid pNCHU2750c, complete sequence) position: , mismatch: 6, identity: 0.786 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
aggccggaaaatcggcgctggcgcaaag	Protospacer
*  .******.************ ***

11. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_LR699117 (Aquicella lusitana strain SGT-39 plasmid 4) position: , mismatch: 7, identity: 0.75 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
tggtataaatgtcggcgctggcggaaat	Protospacer
   *  .** ******************

12. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_CP017105 (Rhizobium gallicum strain IE4872 plasmid pRgalIE4872d, complete sequence) position: , mismatch: 7, identity: 0.75 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
cattcgcaaagtcggcgctggcgaaatc	Protospacer
  .*** ****************.** .

13. spacer 1.1|519016|28|AP019373|CRISPRCasFinder matches to NZ_CP049249 (Rhizobium rhizoryzae strain DSM 29514 plasmid unnamed3, complete sequence) position: , mismatch: 8, identity: 0.714 

acctcggaaagtcggcgctggcggaaat	CRISPR spacer
gatccggaaagtcgtcgctggcggatgc	Protospacer
. ..********** ********** ..

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation

Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage