Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
AP019378 Bordetella parapertussis Bpp01 DNA, complete genome 8 crisprs csa3,DEDDh,cas3,DinG,RT 3 0 2 0

Results visualization

1. AP019378
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_1 64056-64305 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_2 132486-132642 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_3 362435-362521 Orphan NA
1 spacers
csa3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_4 1508965-1509051 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_5 2401579-2401675 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_6 3077428-3077509 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_7 3230453-3230537 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
AP019378_8 3441110-3441203 Orphan NA
1 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
AP019378_1 1.1|64110|41|AP019378|PILER-CR 64110-64150 41 AP019378.1 64306-64346 0 1.0
AP019378_2 2.2|132600|24|AP019378|PILER-CR 132600-132623 24 AP019378.1 132462-132485 0 1.0
AP019378_2 2.2|132600|24|AP019378|PILER-CR 132600-132623 24 AP019378.1 132672-132695 0 1.0
AP019378_1 1.2|64205|80|AP019378|PILER-CR 64205-64284 80 AP019378.1 64368-64447 20 0.75
AP019378_1 1.2|64205|80|AP019378|PILER-CR 64205-64284 80 AP019378.1 63976-64055 20 0.75

1. spacer 1.1|64110|41|AP019378|PILER-CR matches to position: 64306-64346, mismatch: 0, identity: 1.0

caggcacccgccgcatacaccgcgctgctcgcagcggccat	CRISPR spacer
caggcacccgccgcatacaccgcgctgctcgcagcggccat	Protospacer
*****************************************

2. spacer 2.2|132600|24|AP019378|PILER-CR matches to position: 132462-132485, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

3. spacer 2.2|132600|24|AP019378|PILER-CR matches to position: 132672-132695, mismatch: 0, identity: 1.0

ggactggcaccggcaagatttcac	CRISPR spacer
ggactggcaccggcaagatttcac	Protospacer
************************

4. spacer 1.2|64205|80|AP019378|PILER-CR matches to position: 64368-64447, mismatch: 20, identity: 0.75

atgcaggcaccgtctcttccacgccaacaaccacgaccgcagcggacccgggtgcctggc	CRISPR spacer
atgcaggcaccgtctcttccacgccaacaaccacgaccgcagcggacccgggtgcctggc	Protospacer
************************************************************

5. spacer 1.2|64205|80|AP019378|PILER-CR matches to position: 63976-64055, mismatch: 20, identity: 0.75

atgcaggcaccgtctcttccacgccaacaaccacgaccgcagcggacccgggtgcctggc	CRISPR spacer
atgcaggcaccgtctcttccacgccaacaaccacgaccgcagcggacccgggtgcctggc	Protospacer
************************************************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 1454836 : 1520384 60 uncultured_Caudovirales_phage(11.76%) protease,transposase,tRNA NA
DBSCAN-SWA_2 2604349 : 2612415 9 uncultured_Mediterranean_phage(28.57%) tRNA NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage