Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP035509 Haematobacter massiliensis strain OT1 plasmid pOT1-9, complete sequence 0 crisprs NA 0 0 0 0
CP035514 Haematobacter massiliensis strain OT1 plasmid pOT1-4, complete sequence 0 crisprs cas3,cas8e,cse2gr11,cas7,cas5,cas6e,cas1,cas2,csa3 0 0 0 0
CP035510 Haematobacter massiliensis strain OT1 chromosome, complete genome 0 crisprs csa3,cas3,DEDDh 0 0 2 0
CP035506 Haematobacter massiliensis strain OT1 plasmid pOT1-6, complete sequence 0 crisprs NA 0 0 0 0
CP035513 Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence 1 crisprs NA 0 2 0 0
CP035507 Haematobacter massiliensis strain OT1 plasmid pOT1-7, complete sequence 0 crisprs WYL,cas3 0 0 0 0
CP035512 Haematobacter massiliensis strain OT1 plasmid pOT1-2, complete sequence 0 crisprs DEDDh,WYL,RT 0 0 0 0
CP035508 Haematobacter massiliensis strain OT1 plasmid pOT1-8, complete sequence 0 crisprs csa3 0 0 1 0
CP035511 Haematobacter massiliensis strain OT1 plasmid pOT1-1, complete sequence 0 crisprs csa3 0 0 0 0
CP035515 Haematobacter massiliensis strain OT1 plasmid pOT1-5, complete sequence 0 crisprs WYL,cas3 0 0 1 0

Results visualization

1. CP035508
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 20588 : 79419 55 Streptococcus_phage(20.0%) transposase NA
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
2. CP035510
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 161870 : 168992 7 Phage_NCTB(16.67%) NA NA
DBSCAN-SWA_2 1069535 : 1137502 69 Paracoccus_phage(13.33%) tail,tRNA,head,integrase,protease,capsid,transposase,portal attL 1069512:1069529|attR 1083972:1083989
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
3. CP035513
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP035513_1 277088-277236 Orphan NA
2 spacers

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP035513_1 1.1|277116|32|CP035513|CRISPRCasFinder 277116-277147 32 NZ_CP035513 Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence 277116-277147 0 1.0
CP035513_1 1.2|277176|33|CP035513|CRISPRCasFinder 277176-277208 33 NZ_CP035513 Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence 277176-277208 0 1.0

1. spacer 1.1|277116|32|CP035513|CRISPRCasFinder matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 0, identity: 1.0

gctggcgccgatccacacccttccaaggcggg	CRISPR spacer
gctggcgccgatccacacccttccaaggcggg	Protospacer
********************************

2. spacer 1.2|277176|33|CP035513|CRISPRCasFinder matches to NZ_CP035513 (Haematobacter massiliensis strain OT1 plasmid pOT1-3, complete sequence) position: , mismatch: 0, identity: 1.0

tgatctgaccgcgacccgcaatgcgctcaggtc	CRISPR spacer
tgatctgaccgcgacccgcaatgcgctcaggtc	Protospacer
*********************************

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
4. CP035515
Click the left colored region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 49356 : 177856 108 Bacillus_phage(12.5%) transposase,protease,integrase attL 48779:48796|attR 148435:148451
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage