Please click to download your results

Overview of predicted results

Overview of the results

Contig_ID Contig_def CRISPR array number Contig Signature genes Self targeting spacer number Target MGE spacer number Prophage number Anti-CRISPR protein number
CP025280 Salmonella enterica subsp. enterica strain USDA-ARS-USMARC-60983 chromosome, complete genome 2 crisprs PD-DExK,WYL,cas3,csa3,RT,DEDDh,DinG,cas14j 1 4 9 2

Results visualization

1. CP025280
Click the left colored region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025280_2 986430-986904 Unclear I-E
7 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID CRISPR_location CRISPR_type Repeat_type Spacer_info Cas_protein_info CRISPR-Cas_info
CP025280_3 996021-996108 Unclear I-E
1 spacers
cas3

You can click texts colored in the table to view more detailed information

Click the colored protein region to show detailed information
CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_ID Protospacer_location Mismatch Identity
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 CP025280.1 2680460-2680491 0 1.0

1. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to position: 2680460-2680491, mismatch: 0, identity: 1.0

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
acgacgtccgcccggaggcgctgcgacgtttt	Protospacer
********************************

CRISPR_ID Spacer_Info Spacer_region Spacer_length Hit_phage_ID Hit_phage_def Protospacer_location Mismatch Identity
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NC_010392 Phage Gifsy-1, complete genome 8230-8261 0 1.0
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP044185 Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403 9440-9471 1 0.969
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 65573-65604 1 0.969
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP054718 Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence 87586-87617 1 0.969
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NC_010393 Phage Gifsy-2, complete genome 38576-38607 1 0.969
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_AP020327 Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1 66325-66356 5 0.844
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP032341 Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence 232048-232079 7 0.781
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP032347 Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence 88878-88909 7 0.781
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 7992-8023 7 0.781
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP012916 Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence 816560-816591 7 0.781
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_CP021083 Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence 331601-331632 8 0.75
CP025280_2 2.5|986722|32|CP025280|PILER-CR,CRISPRCasFinder,CRT 986722-986753 32 MN807249 Mycobacterium phage Megiddo, complete genome 40628-40659 8 0.75
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 LR606152 Rhizobium sp. Q54 genome assembly, plasmid: 9 87306-87337 9 0.719
CP025280_2 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder 986459-986490 32 NZ_LR134466 Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence 6692-6723 9 0.719
CP025280_2 2.9|986539|32|CP025280|CRT 986539-986570 32 NZ_CP007129 Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence 321477-321508 9 0.719
CP025280_2 2.4|986661|32|CP025280|PILER-CR,CRISPRCasFinder,CRT 986661-986692 32 GQ478088 Enterococcus phage phiFL4A, complete genome 32488-32519 10 0.688
CP025280_2 2.4|986661|32|CP025280|PILER-CR,CRISPRCasFinder,CRT 986661-986692 32 MG945146 UNVERIFIED: Microviridae sp. isolate 192-18011, partial genome 2565-2596 10 0.688

1. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NC_010392 (Phage Gifsy-1, complete genome) position: , mismatch: 0, identity: 1.0

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
acgacgtccgcccggaggcgctgcgacgtttt	Protospacer
********************************

2. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP044185 (Salmonella enterica subsp. enterica strain AR-0403 plasmid pAR-0403) position: , mismatch: 1, identity: 0.969

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
acgacgtccgcccggaggcgctgcggcgtttt	Protospacer
*************************.******

3. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
acgacgtccgcccggaggcgctgcggcgtttt	Protospacer
*************************.******

4. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP054718 (Salmonella enterica strain 85-0120 plasmid unnamed2, complete sequence) position: , mismatch: 1, identity: 0.969

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
acgacgtccgcccggaggcgctgcggcgtttt	Protospacer
*************************.******

5. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NC_010393 (Phage Gifsy-2, complete genome) position: , mismatch: 1, identity: 0.969

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
acgacgtccgcccggaggcgctgcggcgtttt	Protospacer
*************************.******

6. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_AP020327 (Mycobacterium avium subsp. hominissuis strain JP-H-1 plasmid p1-JPH1) position: , mismatch: 5, identity: 0.844

acgacgtccgcccggaggcgctg--cgacgtttt	CRISPR spacer
acgacgtccgcacggtggcgctgtccgacgat--	Protospacer
*********** *** *******  ***** *  

7. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP032341 (Azospirillum brasilense strain MTCC4038 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

acgacgtccgcccggaggcgctgcgacgtttt--	CRISPR spacer
acgacatccgctcggaggcgct--gaccttcgcg	Protospacer
*****.*****.**********  *** **.   

8. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP032347 (Azospirillum brasilense strain MTCC4039 plasmid p2, complete sequence) position: , mismatch: 7, identity: 0.781

acgacgtccgcccggaggcgctgcgacgtttt--	CRISPR spacer
acgacatccgctcggaggcgct--gaccttcgcg	Protospacer
*****.*****.**********  *** **.   

9. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.781

acgacgtccgcccggaggcgctgcgacgtttt--	CRISPR spacer
acgacatccgctcggaggcgct--gaccttcgcg	Protospacer
*****.*****.**********  *** **.   

10. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP012916 (Azospirillum brasilense strain Sp 7 plasmid ABSP7_p2, complete sequence) position: , mismatch: 7, identity: 0.781

acgacgtccgcccggaggcgctgcgacgtttt--	CRISPR spacer
acgacatccgctcggaggcgct--gaccttcgcg	Protospacer
*****.*****.**********  *** **.   

11. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_CP021083 (Deinococcus ficus strain CC-FR2-10 plasmid pDFI2, complete sequence) position: , mismatch: 8, identity: 0.75

acgacgtccgcccggaggcgctgcgacgtttt-	CRISPR spacer
tggacgtcctcccggaggtgctgcg-cgcgctg	Protospacer
  ******* ********.****** **. .* 

12. spacer 2.5|986722|32|CP025280|PILER-CR,CRISPRCasFinder,CRT matches to MN807249 (Mycobacterium phage Megiddo, complete genome) position: , mismatch: 8, identity: 0.75

acgtggcgcgggatcataccgtgggataaaac	CRISPR spacer
gtgtggcgcggcatcatcccgtgggtcaagcc	Protospacer
..********* ***** ******* .**. *

13. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to LR606152 (Rhizobium sp. Q54 genome assembly, plasmid: 9) position: , mismatch: 9, identity: 0.719

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
cgcccggccgccaggaggcgctgcgacgccgt	Protospacer
    ** ***** ***************.. *

14. spacer 2.1|986459|32|CP025280|PILER-CR,CRISPRCasFinder matches to NZ_LR134466 (Tsukamurella tyrosinosolvens strain NCTC13231 plasmid 24, complete sequence) position: , mismatch: 9, identity: 0.719

acgacgtccgcccggaggcgctgcgacgtttt	CRISPR spacer
gcagcgaccgcccggaggcgctgcgccgcacc	Protospacer
.*..** ****************** **. ..

15. spacer 2.9|986539|32|CP025280|CRT matches to NZ_CP007129 (Gemmatirosa kalamazoonesis strain KBS708 plasmid 1, complete sequence) position: , mismatch: 9, identity: 0.719

tgccctttccgccgactcaccgacgcgcccgg	CRISPR spacer
gaccgccgccgccgactcaccatcgcgcccgc	Protospacer
 .** .. *************. ******** 

16. spacer 2.4|986661|32|CP025280|PILER-CR,CRISPRCasFinder,CRT matches to GQ478088 (Enterococcus phage phiFL4A, complete genome) position: , mismatch: 10, identity: 0.688

gcttacgaagttctttacctgtacttggcgca	CRISPR spacer
tattacgcaggtctttacctgtacttttttag	Protospacer
  ***** ** ***************  .  .

17. spacer 2.4|986661|32|CP025280|PILER-CR,CRISPRCasFinder,CRT matches to MG945146 (UNVERIFIED: Microviridae sp. isolate 192-18011, partial genome) position: , mismatch: 10, identity: 0.688

gcttacgaagttctttacctgtacttggcgca	CRISPR spacer
agaaatatagttctttgcctatacttggcgct	Protospacer
.   *.. ********.***.********** 

Region Region Position Protein_number Hit_taxonomy Key_proteins Att_site Prophage annotation
DBSCAN-SWA_1 670892 : 707258 49 Escherichia_phage(26.67%) capsid,terminase,integrase,holin,tRNA,head,tail,plate,portal attL 660116:660139|attR 709544:709567
DBSCAN-SWA_2 1177691 : 1270623 83 Cronobacter_phage(53.66%) capsid,terminase,integrase,holin,tRNA,head,tail,portal attL 1215285:1215300|attR 1244662:1244677
DBSCAN-SWA_3 1722126 : 1731297 10 Enterobacteria_phage(66.67%) tRNA NA
DBSCAN-SWA_4 1798489 : 1808996 10 Enterobacteria_phage(37.5%) NA NA
DBSCAN-SWA_5 1891538 : 1898774 8 Morganella_phage(33.33%) NA NA
DBSCAN-SWA_6 2183484 : 2190141 9 Salmonella_phage(33.33%) NA NA
DBSCAN-SWA_7 2664630 : 2671868 8 Escherichia_phage(42.86%) NA NA
DBSCAN-SWA_8 2677146 : 2724964 63 Enterobacteria_phage(38.1%) capsid,terminase,integrase,transposase,tRNA,tail,head,portal,lysis attL 2671604:2671619|attR 2720865:2720880
DBSCAN-SWA_9 4451947 : 4486673 41 Cronobacter_phage(63.33%) capsid,terminase,integrase,holin,tail,head,portal attL 4451239:4451283|attR 4482048:4482092
Click the colored protein region to show detailed information
Click the colored protein region to show detailed information
Acr ID Acr position Acr size Homology with known anti Neighbor HTH/AcRanker Neighbor Aca In prophage Protospacer in prophage
CP025280.1|QBJ37968.1|2710793_2711663_-|DNA-binding-protein 2710793_2711663_- 289 aa aa NA HTH_XRE NA 2677146-2724964 yes
CP025280.1|QBJ37969.1|2711707_2712202_-|hypothetical-protein 2711707_2712202_- 164 aa aa NA HTH_XRE NA 2677146-2724964 yes